ID: 1188585216

View in Genome Browser
Species Human (GRCh38)
Location X:31766203-31766225
Sequence CTAGTTAGGGCTCCTTTATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 68}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188585216 Original CRISPR CTAGTTAGGGCTCCTTTATA TGG (reversed) Intronic
902605233 1:17565451-17565473 CCAGTTAGTGCTCCTTGAAAGGG - Intronic
907671768 1:56480467-56480489 CTCATAAGGGCTCCCTTATAAGG + Intergenic
908462114 1:64356118-64356140 CTAGAGATGGCTCTTTTATAAGG + Intergenic
909803422 1:79844275-79844297 CTCCCTAGGGCTTCTTTATAAGG + Intergenic
910669659 1:89760610-89760632 CTCCCTTGGGCTCCTTTATAAGG - Intronic
915291194 1:154884549-154884571 CAAGTTGGGGCTCCATTAAATGG + Intergenic
919515494 1:198516763-198516785 TTAGTTAGGGTTCTTTTAGAGGG + Intergenic
1074728708 10:116344490-116344512 CTCTATAGGGCACCTTTATAGGG + Intronic
1081462891 11:43287891-43287913 TTATTTTGGGCTCCTTTATTTGG - Intergenic
1081721479 11:45292365-45292387 ATAGTTTGGGCTTCTTTACATGG - Intergenic
1084507411 11:69576865-69576887 CTGGTAAGGACTCCTTTATAAGG - Intergenic
1089773626 11:120820732-120820754 TTTATTAGGGCTCCTTTCTATGG + Intronic
1092004960 12:5061470-5061492 GTAGTTAGGGCTCCTGGAAAAGG + Intergenic
1092514502 12:9194965-9194987 ATAGTTGTGCCTCCTTTATATGG + Intronic
1096788846 12:54032959-54032981 CTATTTAAGGCTCCCTTATTTGG + Exonic
1097227155 12:57484377-57484399 CTAGTTAGGGCCCCTCTAATGGG - Intronic
1100302345 12:93319533-93319555 ATAGTTAGGGCTCATCTCTAGGG - Intergenic
1100339824 12:93668046-93668068 CTAGTTATAGTTACTTTATAAGG + Intergenic
1102380913 12:112466202-112466224 CTATTTAGGTCTCTTTGATAAGG + Intronic
1107048182 13:36016399-36016421 CTATTTAGGGCTCCTTTTAATGG - Intronic
1109994455 13:70105838-70105860 ATATTTAGGTCTCCTATATATGG + Intronic
1111569775 13:90068823-90068845 CTAGATTGTGCTCCTTTAAATGG + Intergenic
1112104185 13:96222849-96222871 CAAGTTAGGACTCTTTTGTAAGG + Intronic
1116307726 14:43280154-43280176 CTAATTAGAGCTCCATTGTAAGG - Intergenic
1119431302 14:74569755-74569777 CTTGTTAGGGGACCTTTATAAGG - Intronic
1133505943 16:6412382-6412404 CTAATAAGGCCTCCTTTAAAAGG - Intronic
1143202863 17:5123974-5123996 CTTGTTAGGGGTCCTTGTTAGGG - Intronic
1149984825 17:61339376-61339398 CTAGTTTGAGCTCCTTTAGGCGG - Intronic
1151435412 17:74092778-74092800 CTAGTAGGGGCTGCTTTCTATGG + Intergenic
1152328164 17:79654610-79654632 AAAGTTAGAGCTCCTTAATAGGG - Intergenic
1156494129 18:37514783-37514805 CAGGTTGGGGCTCCTTTAAATGG + Intronic
1163147174 19:15387993-15388015 TAAATTTGGGCTCCTTTATAGGG - Intronic
929718455 2:44338694-44338716 CTAGTCAGGACTCATTCATATGG - Intronic
940444132 2:153756394-153756416 CTAGTTCTGTCTCCTTTAAATGG - Intergenic
943807710 2:192142903-192142925 CTAGTTTGGGATCTTTTATAGGG - Intronic
944852728 2:203736383-203736405 CTGGTGAGAGCTCCTTTACAGGG + Exonic
1171187541 20:23133460-23133482 GTATTTAGGGCTCTTTTCTAAGG + Intergenic
1174141647 20:48418516-48418538 ATAGTTATGGCTCATTTAAAAGG - Intergenic
1174732083 20:52927753-52927775 CTAGCTAGGTCTCTGTTATAAGG + Intergenic
1182636083 22:31728112-31728134 CTAGTCTGGGCTCCTGAATATGG + Intronic
957179431 3:76857900-76857922 CAAGTTAGGGTTCCTTAAAAAGG + Intronic
963568897 3:146966734-146966756 CCAGTTAGGGTTCATTAATAAGG + Intergenic
964776463 3:160283992-160284014 CTAGTTTGGGCTCTGTTATTGGG + Intronic
965767154 3:172142959-172142981 CTTCTTGGGCCTCCTTTATAAGG + Intronic
971407539 4:26336047-26336069 TTAGTTATGGCTCTTTTATGTGG + Intronic
972249666 4:37286916-37286938 CTAGTTATGGTTCTTTTAGATGG - Intronic
975241591 4:72066237-72066259 CTAGTGAAGGCTCTTTCATAAGG + Intronic
975930401 4:79514791-79514813 CTAGTTACTGCTCCTTTTTGTGG + Intergenic
977340924 4:95756510-95756532 GTAGATAAGGCTACTTTATAGGG + Intergenic
978791973 4:112672255-112672277 CTAGTCAGGGCTCTCTTAGAGGG - Intergenic
981505361 4:145493659-145493681 CTAGAAAAGGCTCCTTTAAAAGG + Intronic
991582919 5:68175109-68175131 CCGGTTAGGCCTCTTTTATAAGG + Intergenic
1001145195 5:169177650-169177672 ATAGTTACTTCTCCTTTATAAGG - Intronic
1007649012 6:43405698-43405720 CTACTTAGATCTCCTTTACAGGG - Intergenic
1012488777 6:99753862-99753884 ATAGTTATGGCCCCTTTTTATGG - Intergenic
1015996380 6:138999048-138999070 TTACTAAGGGCTCCTTAATAGGG + Intergenic
1020534528 7:9379141-9379163 CTTTTTTGGGCTCTTTTATAAGG - Intergenic
1021025729 7:15664547-15664569 CTAGTAAAAGCTCCTATATAGGG + Intronic
1021791721 7:24212780-24212802 CTAGTAATGGTTCTTTTATAAGG + Intergenic
1023723630 7:43119932-43119954 CTCGTTTGGGCTGCTGTATAGGG - Intronic
1026661351 7:72305360-72305382 CTTGTTAAGGCTCCTTCTTAAGG + Intronic
1031751707 7:125582970-125582992 TTAGTTAGGGTTCTTTTAGAGGG + Intergenic
1033935620 7:146582055-146582077 CTAGAAAGGGCTTCTTTAGAGGG - Intronic
1037188600 8:16094636-16094658 CTAATTAGAACTGCTTTATAAGG - Intergenic
1039083682 8:33758981-33759003 CTCCTTAGGGCTCTTTTATAAGG + Intergenic
1042543872 8:69933649-69933671 CTTCCTAGGGCTCCTTTTTAAGG + Intergenic
1044015493 8:87045278-87045300 CTAGTTAGCTCTCCTTTACTGGG - Intronic
1046674197 8:117090577-117090599 CTACTTAGGGTTTCTTAATAAGG + Intronic
1060387349 9:123243565-123243587 CTAGTTAGAAGTCCTTTATTGGG - Intronic
1188585216 X:31766203-31766225 CTAGTTAGGGCTCCTTTATATGG - Intronic
1188976735 X:36684494-36684516 CTTGTTAATGCTACTTTATATGG + Intergenic
1191844128 X:65533936-65533958 CCAGTTAGGTGTCCTGTATACGG - Intronic
1194440500 X:93927580-93927602 CTATTTAGGTCTCTTTTCTAAGG + Intergenic
1199321957 X:146450310-146450332 CTGGTTAGAGCTCCTTCACATGG + Intergenic