ID: 1188585753

View in Genome Browser
Species Human (GRCh38)
Location X:31772701-31772723
Sequence ATCCTTGTTCTGCTACTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 595
Summary {0: 1, 1: 3, 2: 23, 3: 94, 4: 474}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188585753 Original CRISPR ATCCTTGTTCTGCTACTTAC TGG Intronic
900865835 1:5268000-5268022 ATCCTAGTTCTGACACTTGCAGG + Intergenic
901002794 1:6156918-6156940 ATCCTGGCTCTGCCACATACCGG + Intronic
901299090 1:8185643-8185665 ATCCCGGTTCTGTCACTTACTGG - Intergenic
901518813 1:9768087-9768109 ATCGTAGCTCTGCTACTTATTGG - Intronic
902408667 1:16200214-16200236 ATCCCAGTTCTGCCGCTTACTGG + Intronic
902556807 1:17251642-17251664 ATCCTGGCTCTGCCACTCACTGG - Intronic
902773552 1:18660211-18660233 ATCCTGGCTCTGCCACTTGCTGG + Intronic
902785716 1:18731426-18731448 ATCCCAGCTCTGCCACTTACCGG + Intronic
903200851 1:21737623-21737645 ATACATGTTCTGTTATTTACTGG + Intronic
903630881 1:24769479-24769501 ATCACAGTACTGCTACTTACTGG - Intronic
903666807 1:25013025-25013047 ATCCCAGCTCTGCCACTTACCGG - Intergenic
904005959 1:27363422-27363444 ACCCTTGCTCTGCCACTCACCGG + Exonic
904212320 1:28894082-28894104 ATCCTTTTTCTGTTGCATACAGG + Intronic
904279831 1:29411121-29411143 ATCCTGGCTCTGCTACTCCCTGG - Intergenic
904291637 1:29489844-29489866 ATCCCAGTTCTGCCACTTACTGG + Intergenic
904491231 1:30860633-30860655 ATCCTCATTCTGCCACGTACTGG + Intergenic
904608605 1:31712878-31712900 ATCCTGGCTCTGCTACTTCCTGG + Intergenic
904694739 1:32322816-32322838 ATTCTGGTTCTGCTACTGCCTGG + Intronic
904894489 1:33803997-33804019 ATCCCAGTTCTGCCACTTACTGG + Intronic
905224453 1:36469915-36469937 ATCCTGGCTTTGCTATTTACAGG + Intronic
905542578 1:38772156-38772178 AACCTGGTTCTGCCACTTCCTGG - Intergenic
905586652 1:39124872-39124894 ATCCTGATTCTGCCACTGACTGG - Intronic
905766124 1:40602594-40602616 ACCCTGGCTCTGCCACTTACTGG + Intergenic
905779557 1:40695979-40696001 ATCTGGGCTCTGCTACTTACTGG - Intronic
906477380 1:46178774-46178796 ATCCTGGCTCTGCCACTTACAGG + Intronic
906780775 1:48571214-48571236 ATCCTAGTTTTGCCACTTCCAGG - Intronic
906898814 1:49810187-49810209 ATTCTGTCTCTGCTACTTACTGG - Intronic
907173290 1:52492596-52492618 ATTTTAGTTCTGCCACTTACTGG - Intronic
907264440 1:53248519-53248541 ATTCTGGTTCTGCCACTTCCTGG + Intronic
907391519 1:54161346-54161368 ATCCTGGTTCTGCCACTTAGAGG - Intronic
907766389 1:57415892-57415914 ATTCTTGTTCTGCTAACTGCTGG + Intronic
908124712 1:61018864-61018886 ATCCTGGTTCTGCCACTTACTGG - Intronic
908449324 1:64236058-64236080 ATCCTGGGTCTGCCATTTACTGG + Intronic
908528370 1:65009800-65009822 ATCCCAGCTCTGCCACTTACTGG - Intergenic
908816717 1:68042724-68042746 ATCCTGGCTCTGCTACTTACCGG + Intergenic
909265561 1:73553516-73553538 TTCCTTGTTCTTCAACTTACAGG + Intergenic
909888721 1:80975568-80975590 ATTTTTGTTCTGCTACTTTAAGG - Intergenic
909956099 1:81780906-81780928 ATCCTTGTTCTGTTATTCAAGGG + Intronic
910259606 1:85282894-85282916 ATCCCGGTTCTGCTACTTGGTGG - Intergenic
910369295 1:86498887-86498909 AGCCGTGTTCTGATACTTAGGGG + Intronic
910706368 1:90133816-90133838 ATCCTGGTTCTGCTTCTCCCTGG + Intergenic
910719176 1:90266647-90266669 ATCCTGACTCTGCTATTTACTGG + Intergenic
911166324 1:94727778-94727800 ATCCTGTTTCCTCTACTTACTGG + Intergenic
911173842 1:94798650-94798672 ATCCTAGCTCTGCAACTTCCCGG + Intergenic
912248339 1:107984584-107984606 ATGCCTGTACTGCTACTTACTGG - Intergenic
912299378 1:108498435-108498457 ATCCCGGCTCTGCCACTTACTGG - Intergenic
912390608 1:109300143-109300165 ATCCTTGTTCTGGTGCTTACAGG - Intronic
913174243 1:116259453-116259475 ATCCTGGCTCTGCTACTCTCTGG - Intergenic
914469016 1:147957277-147957299 ATCCTTGATCTACAACTTAATGG + Intronic
914877260 1:151521391-151521413 ATCCTGGTTCTGTTACTTGTTGG + Intronic
914878813 1:151532205-151532227 ATCCTGGCTCTACCACTTACTGG - Intronic
915169227 1:153966306-153966328 ATCTTGGTTCAGCTACTTACAGG + Intronic
915453316 1:156021908-156021930 ATCCCAGTTCTGTCACTTACTGG + Intergenic
916185667 1:162130282-162130304 ATCCTAGTTCTGCCACTTACAGG - Intronic
916810322 1:168299945-168299967 ATCCTTGCTCTGTAATTTACTGG + Intronic
916930122 1:169568614-169568636 GTCCTTGTTCAGCTGCTTGCTGG + Intronic
917626312 1:176850070-176850092 ATCCTGGCTCTGCCACTTACTGG - Intergenic
917954651 1:180082048-180082070 ATCCTGGATCTCTTACTTACCGG + Intronic
918187898 1:182144021-182144043 GTCCTTCTTCTGCTCCTTTCTGG + Intergenic
918479610 1:184964481-184964503 AACCTTCTTCTACTACATACTGG + Intronic
918712873 1:187752828-187752850 ATCCAAGTTCTGACACTTACAGG - Intergenic
918984448 1:191605696-191605718 ATCCTGGCTTTGCTACTTACTGG + Intergenic
919094224 1:193010466-193010488 ATCCTAGATCTACTACTTACTGG + Intergenic
919572394 1:199265039-199265061 ATCCTGGTTCTACCACTTACTGG + Intergenic
919887935 1:201948487-201948509 GTCCTGGTATTGCTACTTACAGG + Intergenic
919898214 1:202023100-202023122 CTCCTTCTTCTGCTACGTGCAGG + Intergenic
919918625 1:202154512-202154534 ATCCCTGTTCTGCTGTTTCCTGG + Intronic
920658219 1:207892177-207892199 ATCCTTACTCTGCTCTTTACTGG + Intronic
920694026 1:208168051-208168073 ATCCTGGTTTTGCTACTCATGGG + Intronic
920700136 1:208211746-208211768 TCCCCTGTTCTGCTACTAACTGG + Intronic
922852783 1:228747937-228747959 ATTCTGGCTCTGCCACTTACTGG + Intergenic
922967121 1:229699605-229699627 ATCCTTGCTTTGCTACTTACTGG + Intergenic
1064391671 10:14947534-14947556 ATCCTGGTCCTGCCACTTACTGG + Intronic
1065313930 10:24443322-24443344 ATCTCTGTTCTGCTACTCTCTGG - Intronic
1067091497 10:43267819-43267841 AGCCTTGCTCTGCCACTTATAGG - Intergenic
1068718187 10:60211419-60211441 ATCCTTGTTCTGCCACTAATTGG + Intronic
1068842510 10:61631185-61631207 ATCCTTCCTCTGCCACTTACTGG + Intergenic
1069883970 10:71611665-71611687 ATCATGGGTCTGCTACTTACTGG - Intronic
1069927819 10:71863347-71863369 CTCCTTGATCTGCTTCTTGCTGG + Intergenic
1070319822 10:75346208-75346230 GTTCCTGCTCTGCTACTTACTGG + Intergenic
1070452584 10:76576794-76576816 GTTCAGGTTCTGCTACTTACTGG + Intergenic
1070485047 10:76922296-76922318 ATCCTGGTTCTGCTGCTAACTGG - Intronic
1070677970 10:78426600-78426622 CTCCTTGTTCTGTCAATTACTGG + Intergenic
1070750796 10:78962923-78962945 ATCCCAGCTCTGCTACCTACTGG + Intergenic
1071463455 10:85919753-85919775 ATCCCAGTTCTGCCACTTCCTGG + Intronic
1071873079 10:89816218-89816240 ATCCTAGATCTACTGCTTACTGG - Intergenic
1072813349 10:98481000-98481022 ATCCCTGCTCTGTTACTTGCTGG - Intronic
1073084760 10:100881025-100881047 ATCCTGGCTCTGCCACTCACTGG - Intergenic
1073107185 10:101038971-101038993 TTCCTGATTCTGCCACTTACTGG + Intronic
1073140534 10:101244302-101244324 ATCCTTACTCTGCCACTTCCTGG - Intergenic
1073565972 10:104535998-104536020 ATCCTTGCTCTGTTACTTCTAGG + Intergenic
1073911803 10:108354128-108354150 ATCCTCATTGTGTTACTTACCGG - Intergenic
1074164510 10:110863240-110863262 ATCCTAGTTGTGCTACTAATTGG - Intergenic
1074555336 10:114484082-114484104 CTCCTTCTTCTGCTTCTTTCGGG + Intronic
1074788434 10:116862777-116862799 ATCATGGTTGTTCTACTTACAGG + Exonic
1074893901 10:117758144-117758166 ATCCTGGTTCTGCCACCTACTGG + Intergenic
1074987162 10:118668730-118668752 ATCGTGGTTCTGCCACCTACTGG + Intergenic
1075268050 10:121022576-121022598 ATCCTTTCTCAGATACTTACTGG - Intergenic
1077674207 11:4182858-4182880 ATCCCAGCTCTGCTACTTCCTGG - Intergenic
1078182733 11:9026315-9026337 ATCCTTGTTTTACCACATACTGG - Intronic
1078472702 11:11604498-11604520 ATCCTGGTGCTGCCTCTTACTGG - Intronic
1078513714 11:12006420-12006442 GTCCCTGCTCTGCCACTTACTGG - Intronic
1079099220 11:17530400-17530422 ATCCTGGCTCTGCCACTTACTGG + Intronic
1079305532 11:19317993-19318015 ATCCTAGCTCTGCCACTTACTGG + Intergenic
1079932047 11:26576178-26576200 ATCCTGGTTTTGCCACTTAATGG + Intronic
1080088139 11:28311164-28311186 ATCATTGTTTTGCTACTTAATGG + Intronic
1080119402 11:28659331-28659353 ATCCCTGTTCTGCTGTTTGCTGG - Intergenic
1080267983 11:30421647-30421669 ATCTTGGCTCTACTACTTACTGG - Intronic
1080308930 11:30867296-30867318 ATCCCAGTTCTGCCACTTATTGG + Intronic
1080684058 11:34501100-34501122 CTCCTAGCTCTGCCACTTACGGG - Intronic
1080857142 11:36122052-36122074 ATCCTGGCTCTGCCATTTACTGG - Intronic
1081568976 11:44278061-44278083 ATCCCTGTTTTGCAACTTCCTGG + Intronic
1081670086 11:44937866-44937888 AGCCTGGTCCTGCCACTTACCGG + Intronic
1081912905 11:46711579-46711601 GTCCTGGTTCTGCTACTGACTGG - Intergenic
1082195997 11:49306529-49306551 ATGCTTCCTCTGCCACTTACTGG - Intergenic
1082828064 11:57595656-57595678 ATCCTGGCTCTGTCACTTACTGG + Intergenic
1082864351 11:57884982-57885004 ATCCTGGTTCTGATATTTATTGG + Intergenic
1083033787 11:59617623-59617645 GTCCTGCTTTTGCTACTTACTGG + Intergenic
1083052554 11:59790253-59790275 ATCCTTGCCCTGGCACTTACTGG - Intronic
1083349664 11:62018427-62018449 TTCCTTGTTCTGCTGCCTAGAGG + Intergenic
1083379649 11:62254902-62254924 ATCCTGGTTCTGCCTCTTCCTGG + Intergenic
1084033847 11:66496132-66496154 ATCCTGGCTCTGCCACTTAGTGG - Intronic
1085299996 11:75452266-75452288 ATCCTGGCTCTGCTACCTACTGG + Intronic
1085718983 11:78896793-78896815 ACCCTGGTTCTGCCACTTACTGG + Intronic
1085840854 11:80010174-80010196 ATCCTGGCTCTGCCACTTAGAGG + Intergenic
1086048007 11:82555782-82555804 ATTCTAGTCCTGCTACTTGCTGG - Intergenic
1086141915 11:83508786-83508808 ATCCCAGTTCTGCCACTTGCCGG - Intronic
1086255118 11:84866534-84866556 AGTCTTGTCTTGCTACTTACTGG + Intronic
1086659832 11:89401704-89401726 ATGCTTCCTCTGCCACTTACTGG + Intronic
1087658815 11:100961259-100961281 ATCCTAGCTCAGCCACTTACAGG + Intronic
1088148645 11:106716436-106716458 ATCCTGGCTCTACTACTTAACGG + Intronic
1088437587 11:109832303-109832325 ATCCTATCTCTCCTACTTACTGG - Intergenic
1088609720 11:111565493-111565515 GTCCTATTACTGCTACTTACTGG + Intergenic
1089283910 11:117393608-117393630 ATCCTAGCTCTTCTACTTATTGG - Intronic
1089372372 11:117970590-117970612 ATCTCACTTCTGCTACTTACTGG - Intergenic
1089488126 11:118862961-118862983 ATCCCAGTTCTGCTACTTATTGG + Intergenic
1089745126 11:120611251-120611273 ATCCTAGCTCTGCTGATTACTGG + Intronic
1090006888 11:123010727-123010749 ATCCCAGTTCTGCTATTTATTGG - Intergenic
1090478888 11:127050176-127050198 ATCCTGACTCTACTACTTACTGG - Intergenic
1090917938 11:131182813-131182835 ATCCCAGCTCTGCTACTTACTGG + Intergenic
1091825001 12:3505685-3505707 ATTCCAGCTCTGCTACTTACTGG - Intronic
1093552120 12:20425859-20425881 ATCCTGGCTGTGCTTCTTACAGG + Intronic
1094008692 12:25783738-25783760 ATCATCGTTCCACTACTTACAGG - Intergenic
1094089002 12:26627380-26627402 ATCCTTGTGCCACTACTTTCAGG + Intronic
1094531032 12:31275131-31275153 ATCCTGGTTTTGCTACTTACTGG - Intergenic
1094764963 12:33583839-33583861 ATACAAGTTCTGCTACTTACTGG - Intergenic
1096622532 12:52873554-52873576 CTCCTGGTTCTGCCTCTTACTGG - Intergenic
1097023760 12:56038877-56038899 ATTCTGGTTCTGTCACTTACTGG - Intergenic
1097262996 12:57729963-57729985 ATCCTGGTTCTGCCACTTACTGG + Intronic
1097535595 12:60866170-60866192 ATCCTTGTTCTTCTAGTCACTGG + Intergenic
1097840956 12:64320675-64320697 ATCCTGGCTCTGCCACTTAATGG + Intronic
1097847082 12:64377946-64377968 ATTCTGGTTCTGCCACTTAATGG + Intronic
1098055461 12:66500251-66500273 TTCCTGGCTCTGCAACTTACTGG - Intronic
1098234297 12:68403686-68403708 ATCCTTGCTCTGTCACTTACTGG - Intergenic
1098369784 12:69745448-69745470 ATACTTATTCAGCTCCTTACAGG - Intronic
1099602586 12:84760484-84760506 ATCCTTGCTCTGATACATAGAGG - Intergenic
1100079397 12:90829152-90829174 ATCCCAGTTCTGCCACTGACTGG + Intergenic
1100476496 12:94940259-94940281 ATCCTGCTTCTTCCACTTACTGG + Intronic
1101132615 12:101704983-101705005 ACATTTGCTCTGCTACTTACTGG - Intronic
1101132690 12:101705645-101705667 ACATTTGCTCTGCTACTTACTGG - Intronic
1101406784 12:104435796-104435818 TTCCTAGTTCTACCACTTACTGG - Intergenic
1101511849 12:105400355-105400377 ATCCCAGTTCTTTTACTTACTGG + Intergenic
1101898188 12:108771100-108771122 ATCTTTGCTCTGCCACTTCCTGG - Intergenic
1102241116 12:111325489-111325511 ATCCTAGGTCTGCCACTCACTGG - Intronic
1102721830 12:115023207-115023229 ATCCTTGCCCTTTTACTTACTGG - Intergenic
1102894297 12:116586295-116586317 ATCTTGGCTCTGCCACTTACTGG + Intergenic
1103217810 12:119216254-119216276 ATCCTATTTCTGCTGCTGACTGG + Intronic
1103428994 12:120865403-120865425 ATCCTGGGTCTACCACTTACTGG + Intronic
1104261548 12:127187687-127187709 CTTCTTGTTCTGCCTCTTACAGG + Intergenic
1108094894 13:46891305-46891327 ATCCTTGTTGTGCTACTTACTGG + Intronic
1108801656 13:54104151-54104173 ATCATTGTTCGGTTACTTATTGG + Intergenic
1109316526 13:60755940-60755962 ATTCTGGTTCTGCAACTTACAGG - Intergenic
1109470313 13:62795490-62795512 ATTTTTGCTTTGCTACTTACTGG - Intergenic
1109588593 13:64444290-64444312 ATCTCTGTTCTGTCACTTACTGG + Intergenic
1110335780 13:74328366-74328388 ATTCTTGTTTTACTACTTAGTGG + Intergenic
1110446526 13:75589162-75589184 ATCCCGGTTCTGTTACCTACTGG + Intronic
1110591891 13:77272776-77272798 ATCTTTGGTCTGCTAATAACAGG + Intronic
1110664442 13:78100310-78100332 TTCCTTGCTCTGCCACTTGCTGG + Intergenic
1111187894 13:84764704-84764726 CTCTGAGTTCTGCTACTTACTGG - Intergenic
1111654904 13:91140094-91140116 ATCCTTTTTCTGACAATTACTGG + Intergenic
1112481294 13:99777900-99777922 ATCTTGGTTCTGCTATTTAATGG - Intronic
1112788981 13:102982767-102982789 CTCCTTTTTCTGCTCCTTCCAGG - Intergenic
1112981967 13:105396000-105396022 ATTCTTCTTCTTATACTTACTGG - Intergenic
1113284160 13:108828380-108828402 ATCCTGGCTCTGCCATTTACTGG + Intronic
1113461998 13:110488635-110488657 ATCCCGGTTCTGCCACTTGCTGG + Intronic
1113965691 13:114152312-114152334 AACCATGGTCTGCTACTTGCTGG - Intergenic
1115429207 14:33297173-33297195 ATCCTAGCTCTGCCATTTACTGG + Intronic
1115451805 14:33556690-33556712 ATCCTGGCTCTGCCACTGACTGG + Intronic
1115604779 14:34989967-34989989 ATCCTAGCTCTGTTACATACTGG - Intronic
1115630853 14:35243681-35243703 AACCTAGTTCTGCTACTTACTGG + Intronic
1117062252 14:51974918-51974940 ATCCTTGGTCTGCCACTTCATGG - Intronic
1117601998 14:57385728-57385750 ATCCTGGCTCTGCCAATTACTGG - Intergenic
1117832743 14:59769050-59769072 ATTCTTCTTCAGCTACTTATAGG - Intronic
1117903101 14:60555959-60555981 GTCCTAGTTCTGGTACTTGCAGG + Intergenic
1118163521 14:63314248-63314270 GTCCCTGTTCTGCCACTTGCTGG + Intronic
1118416444 14:65541967-65541989 ATTCTGGTTCTGCTACTTACTGG + Intronic
1118760429 14:68877678-68877700 ATCCCAGTTCTGCTGCTTCCTGG - Intronic
1119529818 14:75352233-75352255 ATTCTTGATCTGGCACTTACTGG - Intergenic
1119702358 14:76763641-76763663 ATCTCAGTTCTGCCACTTACTGG - Intronic
1119851566 14:77870245-77870267 ATCCTGGTTCTGCTTCTTACTGG - Intronic
1120067329 14:80058298-80058320 ATCCTGGTTTTGCTGCTTACTGG - Intergenic
1120815548 14:88853604-88853626 ATTCTTGTTCTGCCACTTACTGG - Intronic
1121229354 14:92345268-92345290 ATCCTGGCTTTGCTGCTTACTGG + Intronic
1121258311 14:92548309-92548331 ATCCCAGTTCTGCCACTTATTGG + Intronic
1121584784 14:95055770-95055792 ATCCTGGCTCTGCTCCTTACAGG + Intergenic
1121829265 14:97035497-97035519 ATCCTGGCTCTGCCATTTACCGG - Intergenic
1121844029 14:97157721-97157743 ATCCCATTTCTGCTACTTCCTGG + Intergenic
1123776628 15:23587212-23587234 ACTCTTGTTCTGCTTCATACTGG + Intronic
1124901548 15:33827781-33827803 ATCCTGGTTCTGCCACTTACTGG + Intronic
1125098826 15:35886293-35886315 ATCTTGGTTCTGCTACTGACTGG + Intergenic
1125704979 15:41726210-41726232 ATTCTGGTTCTGCCTCTTACTGG + Intronic
1125768795 15:42151798-42151820 ACCCTGGCTCTACTACTTACTGG + Intronic
1126669033 15:51099540-51099562 ATCCTGGTGCTGCTATTTAAAGG - Intronic
1127147966 15:56044392-56044414 CTTCTTGTTCTGCTCCTTAGAGG - Intergenic
1127597975 15:60506086-60506108 ATGCTTGTTCTGCAATTTGCAGG - Intronic
1127696795 15:61457692-61457714 ATTCTGATTCTGCCACTTACTGG - Intergenic
1127698771 15:61476799-61476821 GTCCTTGTTTTACTACTTACTGG - Intergenic
1128353267 15:66906212-66906234 ATCCTTCCTCTGCTACTTACTGG + Intergenic
1128412202 15:67410930-67410952 ATCCCTGTTTTGCTACTTTATGG + Intronic
1128566126 15:68701256-68701278 ATCCTGGCTCTGCCACTTCCAGG + Intronic
1128581843 15:68816325-68816347 ATCCTGGTTCTGCCACTCACTGG + Intronic
1128600294 15:68990185-68990207 ATCCTGGCTCTGCCCCTTACTGG + Intronic
1128648723 15:69395354-69395376 ATCCTAGCTCTGCTTCTTATTGG + Intronic
1128715190 15:69902891-69902913 ATCTCTGTGCTGCTACTTCCTGG - Intergenic
1129484867 15:75860997-75861019 ATCTTTGTTCTGCTACTTACTGG + Intronic
1129490381 15:75919494-75919516 ACTCTAGTTCTGCTACTTTCTGG + Intronic
1129667147 15:77585589-77585611 ATCCTCACTCTGCTACTTACTGG + Intergenic
1129748222 15:78039849-78039871 ATCCCAGTCCTGCTACTTATTGG - Intronic
1129915014 15:79261164-79261186 ATCGTGGATCTGCTACTTGCTGG + Intergenic
1130829362 15:87583893-87583915 ATCCTTGCTCTGCTTCCTAAGGG - Intergenic
1130878055 15:88031569-88031591 GTCCTTTTTCTGATACTGACAGG + Intronic
1131317667 15:91354347-91354369 ATCCTCATTCTGTTGCTTACTGG - Intergenic
1131955816 15:97734973-97734995 ATCTTGGTTCTGCCATTTACAGG - Intergenic
1131990315 15:98086764-98086786 ATCCTGGCTTTGCTACTTACGGG - Intergenic
1132005111 15:98219450-98219472 ATCCCTGTTCACCCACTTACTGG + Intergenic
1132078274 15:98841288-98841310 ATCCTTGGCCTGCCATTTACTGG + Intronic
1133152224 16:3843194-3843216 AGCCTGGTTCTGCCACTCACTGG + Intronic
1133711205 16:8402916-8402938 TTCCTCGCTCTGCCACTTACTGG + Intergenic
1134080142 16:11319359-11319381 ATTCTTGCTCTGCCACTTAATGG + Intronic
1134740239 16:16536528-16536550 ATTCTGGTTCTGCCACATACTGG + Intergenic
1134811496 16:17170879-17170901 GTCCTAGTTCTACTACTTATTGG + Intronic
1134927262 16:18175633-18175655 ATTCTGGTTCTGCCACATACTGG - Intergenic
1135185828 16:20314993-20315015 ATCCCAGCTCTGCTACTGACTGG - Intronic
1135210362 16:20520859-20520881 ATTCCAGTTCTGCCACTTACTGG + Intergenic
1135792253 16:25407840-25407862 GTACTGGTTCTGCCACTTACAGG + Intergenic
1135796170 16:25444952-25444974 ATCCTGGCTCTGCCACTTACTGG - Intergenic
1136017061 16:27407152-27407174 ATTCTTCTTCAGCTACTTATGGG + Intronic
1136047949 16:27630183-27630205 AACCCTGTTCTGCCACTTTCTGG + Intronic
1136090434 16:27915881-27915903 ATTCTGGTTCTGCCACTTACCGG + Intronic
1137559962 16:49496172-49496194 ATCTTGGCTCTGCCACTTACTGG + Intronic
1138276529 16:55738838-55738860 AGCCTGGCTCTGCTACTTACTGG - Intergenic
1138282454 16:55782196-55782218 AGCCTGGCTCTGCTACTTACTGG - Intergenic
1138286494 16:55814447-55814469 AGCCTGGCTCTGCTACTTACTGG + Intronic
1138349203 16:56337558-56337580 GTCCTGGCTCTGCTACTCACTGG + Intronic
1138542220 16:57695330-57695352 ATCCCAGACCTGCTACTTACTGG + Intronic
1139250233 16:65488396-65488418 AGCCTTGTTTTGCCACTCACTGG - Intergenic
1141685165 16:85565960-85565982 ATCCTGCCTCTGCTCCTTACTGG + Intergenic
1143253696 17:5540581-5540603 ATCCTGGTGCAGCTACTTCCTGG + Intronic
1143701514 17:8664114-8664136 ATCCTAGTTCTCCCACTTCCTGG - Intergenic
1143893800 17:10121439-10121461 GGCCTGGTTCTGCTACTCACTGG + Intronic
1144085302 17:11802937-11802959 ATCCTTGTTCTGCCACAAATTGG + Intronic
1144220508 17:13095507-13095529 AGCCTGGTTCTACTTCTTACTGG + Intergenic
1144403261 17:14927245-14927267 ACCCTAGTTCTTCTACTTACTGG + Intergenic
1144959211 17:19035474-19035496 ATGCTAGTTCTGCCACTTCCTGG - Intronic
1144975948 17:19139050-19139072 ATGCTAGTTCTGCCACTTCCTGG + Intronic
1146131136 17:30276339-30276361 ATCCTAATTCTGCCATTTACTGG - Intronic
1146318119 17:31825050-31825072 ATTCTTTTTCTTCTACTTAGCGG - Intergenic
1146570434 17:33948052-33948074 ATCCTGATTCTGCCACTTACAGG - Intronic
1146668849 17:34723062-34723084 AGCCTGATTCTGCTACTTCCAGG - Intergenic
1146944018 17:36862164-36862186 ATCCTGGCTCTGCCATTTACTGG + Intergenic
1146980082 17:37152111-37152133 ATCCTTGCTCTGATACACACAGG + Intronic
1147127442 17:38381590-38381612 ATCCTGGTTCTGCAACTCACTGG - Intronic
1147246515 17:39124667-39124689 GTCCTGGTTTTGCCACTTACTGG + Intronic
1147266759 17:39238960-39238982 ATCTCAGTTCTGCTACTTGCTGG - Intergenic
1147647304 17:42041313-42041335 ATCCTGGCTTTGCCACTTACTGG + Intronic
1148004403 17:44413969-44413991 ATGCTTGTTTTGCTATTTTCAGG + Intronic
1149003619 17:51781962-51781984 ATCCCAGTCCTGCCACTTACTGG - Intronic
1149502665 17:57166319-57166341 ATCCTGCTTCTGCAATTTACTGG - Intergenic
1149606388 17:57927950-57927972 ATCCTTCCTCTGCTACTTGTGGG - Intronic
1150186992 17:63192618-63192640 ATCCTGGCTCTGCCATTTACTGG + Intronic
1151235618 17:72717774-72717796 CTCCTTATTCTGGAACTTACAGG + Intronic
1151276597 17:73039050-73039072 ATCTTGGCTCAGCTACTTACTGG + Intronic
1152055350 17:78021117-78021139 CTCCTTCTTCAGCTACCTACTGG - Intronic
1152979784 18:266268-266290 TTCCTTGCTCTGCCACTAACAGG + Intronic
1153095243 18:1393781-1393803 GTCCTGGTTCTTCTACTTACTGG - Intergenic
1155148812 18:23106057-23106079 AGACTGGTTCTGCTACTTCCAGG + Intergenic
1155203905 18:23540724-23540746 ATCCTGACTCTGCCACTTACGGG + Intronic
1155287279 18:24302936-24302958 ATCCTTACTCTTCCACTTACCGG - Intronic
1155528336 18:26740369-26740391 TTCCTGGTTCTACCACTTACTGG + Intergenic
1156697949 18:39790631-39790653 ATCCTTGTTCTGCTTCCCAGAGG - Intergenic
1158268494 18:55686487-55686509 GTCCTAGTTCTGTTACTAACTGG - Intergenic
1158535377 18:58303822-58303844 ATCCTAGTCCTGCCACTTTCTGG + Intronic
1159380777 18:67655602-67655624 ATTCTAGTTCTGATGCTTACTGG + Intergenic
1159491281 18:69138360-69138382 ATCTTATCTCTGCTACTTACTGG - Intergenic
1161602849 19:5195392-5195414 ATCCTGGCTCTGCTATTTCCTGG + Intronic
1162922312 19:13910462-13910484 ATCCGAGCTCTGCCACTTACTGG + Intronic
1163018003 19:14468507-14468529 ATCCTGGACCTGCTGCTTACTGG - Intronic
1164551624 19:29217106-29217128 ATCAGTGTTCTGCTACTCTCCGG - Intergenic
1166528918 19:43530732-43530754 ATCCTGGCTCTGATACTTCCTGG + Intronic
1166713890 19:44954473-44954495 ACCCTTGTGGTGCTACTGACTGG - Intergenic
1166726716 19:45032878-45032900 ATCCTGGCTCTGCTGCTTACTGG + Intronic
1166818215 19:45559904-45559926 ATCCTGGTTCTGTCACTTTCTGG + Intronic
1167135926 19:47615508-47615530 ATCCCAGTTCTGCTATTTGCTGG + Intronic
1167247892 19:48384756-48384778 ATCATTGCTCTGCTGCTTGCTGG - Intronic
1167289907 19:48618877-48618899 ATCCTGGCTCTGCCACTTCCTGG + Intronic
1167565765 19:50255679-50255701 ATCCCAGCTCTGCCACTTACTGG - Intronic
1168667481 19:58215341-58215363 ATCCTGGCTCTGCTCCTCACTGG + Intergenic
925838402 2:7967368-7967390 ATCCTTAGTTTGCTCCTTACCGG + Intergenic
926328294 2:11804252-11804274 TTCCTTGTTCTGGTTCTTTCCGG - Intronic
926691566 2:15738116-15738138 ATCCCAGCTCTGCCACTTACTGG + Intronic
926707125 2:15844776-15844798 ATGCTTTTTCTGGTATTTACAGG + Intergenic
926802276 2:16669040-16669062 ATCCTAATTCTGCCACTCACTGG + Intergenic
926961211 2:18360362-18360384 ATCCCAGCTCTGCTTCTTACTGG + Intronic
927123167 2:19988114-19988136 ATCCTTGTTCCGCCACTTACTGG + Intronic
927493736 2:23538132-23538154 ATCCTAGTTCTGCTACTTATTGG - Intronic
927727707 2:25439680-25439702 ATCCTAGCTTTGCTACTTTCTGG + Intronic
928363774 2:30686247-30686269 ATCCCTGTTCTGCCACCTGCTGG - Intergenic
928611249 2:32994395-32994417 ATCTTGGTTCTACCACTTACTGG - Intronic
930080600 2:47444658-47444680 ATCCCAGCTCTGCTACCTACTGG - Intronic
930084818 2:47488757-47488779 ATCCCAGCTCTGCCACTTACTGG - Intronic
930281126 2:49371231-49371253 ACCCTTGTTATGGTACTTCCTGG + Intergenic
930784036 2:55253074-55253096 ATCCTGGCTATGCTACTTACTGG + Intronic
931431848 2:62214770-62214792 ATTCTGGTTATGCTACCTACTGG - Intronic
932124780 2:69133902-69133924 ATCATGGTTCTGCTGCTTACAGG + Intronic
932286301 2:70534969-70534991 ATCCTTATTCTGCTACTTGCTGG + Intronic
934952811 2:98590391-98590413 ATCCTGGTTCTGCCCCTGACTGG + Exonic
935282621 2:101532311-101532333 ATCCTGGTTCTGCCATTTACAGG - Intergenic
935366125 2:102292738-102292760 GTCCTAGCTCTACTACTTACTGG - Intergenic
935495804 2:103780242-103780264 ATCCTAATTCTGTCACTTACTGG - Intergenic
937550941 2:123090439-123090461 ATCCTTGTGCTGCTTGTTTCGGG + Intergenic
939209577 2:139156547-139156569 ATCCTGGCTCTGCTGCTTTCTGG + Intergenic
940448133 2:153802961-153802983 ATCTTGATTCTGCTACTTTCTGG + Intergenic
941135446 2:161711778-161711800 ATCTTAGCTATGCTACTTACTGG + Intronic
941383657 2:164826608-164826630 ATCTGTGCTCTGCCACTTACTGG - Intronic
941501385 2:166281932-166281954 ATTATGGCTCTGCTACTTACTGG + Intronic
941625031 2:167822069-167822091 TTCCTTGGTCTGCCACTCACTGG - Intergenic
941960799 2:171251227-171251249 AGCCTTTTTCTGCTGCTTCCAGG - Intergenic
941972055 2:171361689-171361711 ATTCTGGTTCTGCCACTTCCTGG - Intronic
942297991 2:174535772-174535794 ATCCCTGTTCTGCCACTTAATGG - Intergenic
944354332 2:198767867-198767889 ATCCTGGCTCTGCCACTTCCTGG - Intergenic
944529529 2:200653550-200653572 ATCCTTGTTCTGCCATTTATTGG - Intronic
945302009 2:208223298-208223320 ACCTCTGTTCTGCTACTTACTGG + Intergenic
945323278 2:208452155-208452177 AGGCTTGTTCTGCTACTTCTTGG + Intronic
945359930 2:208884974-208884996 ATACCTGTTCTGCTACTCAGTGG - Intergenic
945653016 2:212588412-212588434 ATCCTGGTTCTGGTACCTACTGG + Intergenic
946649844 2:221880317-221880339 ATCCTGGCTCTGCTACTCACTGG + Intergenic
946765149 2:223033605-223033627 TTTCTTTTTCTGCTACTTTCAGG + Intergenic
946915148 2:224511833-224511855 ATACTTGTTCTGCTATTTTTTGG - Intronic
947459977 2:230295597-230295619 ATCCTGGATCTGCCACTTAAGGG - Intronic
1168876947 20:1178330-1178352 ATCCAGGCTCTGCCACTTACTGG - Intronic
1169419470 20:5448344-5448366 ATCCATGGTCTGCTGTTTACTGG - Intergenic
1169815977 20:9656629-9656651 ACCTTTGTTCTTCTACTTAATGG + Intronic
1171011869 20:21513391-21513413 AGCCAAGTTTTGCTACTTACGGG + Exonic
1172052292 20:32127342-32127364 ATCCTTGTTCCTCCACTTTCTGG + Intronic
1172282061 20:33714876-33714898 ATCCTGGCTCTGATACTTCCTGG + Intronic
1172373163 20:34412028-34412050 ATTACAGTTCTGCTACTTACTGG + Intronic
1172995181 20:39065037-39065059 ATCCTGGATTTGCTACTCACTGG + Intergenic
1173011956 20:39191001-39191023 ATCCCAGCTCTGCCACTTACAGG - Intergenic
1173692466 20:44973669-44973691 ATCCTTGCTCTACTGTTTACTGG + Intronic
1173725182 20:45292468-45292490 ATCCTGGTTCAGCTTCGTACTGG + Intergenic
1174457030 20:50656267-50656289 ATCCTAGCTCTGCCACTTGCTGG + Intronic
1174565925 20:51464416-51464438 ATCCTGCCTCTGCCACTTACTGG - Intronic
1174570309 20:51496714-51496736 ATCCTGGTTCTGCCACTTATTGG - Intronic
1174776657 20:53349151-53349173 ATCCTTGCTCTACCACTAACTGG + Intronic
1174917438 20:54668506-54668528 GTTCCTGTTCTGCTGCTTACAGG + Intergenic
1177185758 21:17794207-17794229 ATCCTTGATCTGCTACTGATTGG + Intronic
1179819347 21:43927714-43927736 GTCCTGATTCTGCTACTGACTGG + Intronic
1182067506 22:27441225-27441247 ATCCTTGTTCTGCCTCCTACAGG + Intergenic
1182258516 22:29055365-29055387 GTCCTTGTTCTCCTACCCACAGG - Exonic
1182779859 22:32858890-32858912 AGTCTAATTCTGCTACTTACTGG + Intronic
1182794810 22:32984310-32984332 ATCCTTGTGCTGCCACGTGCTGG - Intronic
1182827877 22:33281472-33281494 ATCCAGGCTCTGCTATTTACTGG + Intronic
1183014646 22:34975910-34975932 ATCCTGGCTCTGCCACCTACTGG + Intergenic
1183083233 22:35470529-35470551 ATCCTGTTTCTGCCACTTCCTGG + Intergenic
1183625957 22:39001891-39001913 ATCCTGCTTCTGCCACTTACTGG + Intergenic
1183737674 22:39652943-39652965 ATCCTGGTTCTGCTATTGACTGG + Intronic
1184110727 22:42392691-42392713 AGCCTTGTTCTTTTGCTTACTGG - Intronic
949829592 3:8199627-8199649 ATCCCAGTTCTACTACTTACTGG + Intergenic
950187130 3:10952111-10952133 ATCCTGGCTCTGCCACTTCCTGG + Intergenic
950217644 3:11170624-11170646 ATCCTGGCTCTGCCACTGACCGG - Intronic
950657824 3:14447984-14448006 ATCCCAGTTCTGCCACTTACTGG + Intronic
951158955 3:19392369-19392391 ATACTTGTTCTGCTTTTCACAGG + Intronic
951333424 3:21392593-21392615 ATCCTGATTCTGCCACTTCCAGG - Intergenic
951590452 3:24258825-24258847 ATTCTGGTTTTGCTACTTGCTGG - Intronic
951696200 3:25448119-25448141 ATCCTCACTCTCCTACTTACTGG - Intronic
951771034 3:26258072-26258094 ACCCATGTTCTGCTATTTGCAGG + Intergenic
952062185 3:29524191-29524213 ATCCCCTTTCTGCGACTTACTGG - Intronic
952518778 3:34133113-34133135 ATGCATGCTCTGCTACTCACAGG + Intergenic
952818410 3:37465458-37465480 ATCCCAGCTCTGCCACTTACTGG + Intronic
956051810 3:65256126-65256148 TTCCTAGTTCTACCACTTACTGG + Intergenic
956069632 3:65434148-65434170 ATCTGTGCTCTGCTACTTAGTGG + Intronic
956425385 3:69129081-69129103 ATCCTGGTTGTGCCACTGACTGG + Intergenic
956449734 3:69362294-69362316 AGCCTTCATCTGCTACTTCCTGG - Intronic
956669710 3:71675193-71675215 ATCCCTCTTCTACTTCTTACTGG - Intergenic
956923482 3:73956201-73956223 ATTCTAGTTCTGCCACTAACTGG + Intergenic
957128627 3:76195703-76195725 ATCCTTATTCTTCTCCTTATTGG - Intronic
957951641 3:87135314-87135336 ATCCTGATTCTGCCACTTACCGG - Intergenic
958794759 3:98695182-98695204 ATCCTGGTTCTGCCATTTTCTGG + Intergenic
958794891 3:98696407-98696429 ATCCTGGTTCTGCCATTTTCTGG - Intergenic
958870018 3:99547433-99547455 ATCCTTGTCTTGGGACTTACAGG + Intergenic
959095879 3:101955133-101955155 CTCCTTGTTCTGCTATTTCCTGG + Intergenic
960571085 3:119185974-119185996 AGCCTAGCTCTGCCACTTACTGG + Intronic
960719045 3:120607388-120607410 ATCTTTGCTCTGCCACTTACTGG + Intergenic
961122170 3:124382064-124382086 ATCCTGGTTCTGCCACTTACTGG + Intronic
961455086 3:127020093-127020115 ATCCTGGCTCTGACACTTACTGG - Intronic
961772443 3:129259946-129259968 ATCTTGGTTCTGCCACTTACTGG + Intronic
963895326 3:150679530-150679552 ATCCTTGCTTTTCTCCTTACAGG - Intronic
964380321 3:156092120-156092142 ATTCTGATTCTGCCACTTACTGG + Intronic
964557924 3:157961252-157961274 ATCCTAGTTCTGATTCTGACAGG + Intergenic
964558354 3:157965529-157965551 ATCCTGGCTCTGCTGCTTAAGGG + Intergenic
965432733 3:168609682-168609704 CTCCTTGTTCAGCTCCTTTCTGG - Intergenic
965835601 3:172848493-172848515 ATCCCAGCTCTGCTATTTACTGG + Intergenic
966054641 3:175670173-175670195 ATCCTAGTTTTGCTACTTTCTGG - Intronic
966440899 3:179942917-179942939 ATTCTGGCTCTGCTACTTATGGG + Intronic
966780156 3:183577420-183577442 ATCCCTGCTCTGCCACTTACTGG - Intergenic
966784783 3:183613395-183613417 ATCCCAGTTCTGCTACTTACTGG - Intergenic
966851155 3:184165862-184165884 TTCCTGGCTCTGCCACTTACTGG + Intronic
967206216 3:187124707-187124729 CTCCTCATTCTTCTACTTACTGG + Intronic
968124354 3:196147459-196147481 CTCCTTTTTCTACTCCTTACAGG - Intergenic
970394369 4:15651251-15651273 TTACTAGTTCTGCTACTTATTGG - Intronic
970799468 4:19954930-19954952 CTCCTTGTTCTGGTACTTCTTGG - Intergenic
971343951 4:25795632-25795654 GTCCTGGGTCTGCTACTCACTGG - Intronic
971524134 4:27594595-27594617 ATCTTGGTTCTACCACTTACTGG + Intergenic
971646425 4:29211385-29211407 ATTATTGCTCTGCCACTTACTGG + Intergenic
972156923 4:36174789-36174811 ATTCTTGTTCTGCTACTAATTGG - Intronic
972802661 4:42493670-42493692 ATCCTTGCTCTGCCGCGTACTGG + Intronic
973019950 4:45190567-45190589 ATCCTAGTTCTTCTACTGCCTGG - Intergenic
977415699 4:96730195-96730217 ATGCTTGCTCTGGTACTTACTGG + Intergenic
977604503 4:98968815-98968837 ATCCTAGCTCTGCTGCTTACTGG - Intergenic
977851081 4:101830574-101830596 AACCTTGAACTGCTACTGACTGG - Intronic
977979859 4:103308377-103308399 ATGCGTGTTCTGCAACTTCCAGG - Intergenic
978061264 4:104343477-104343499 ACCCTTGTTCTGCAACTGTCTGG + Intergenic
979589093 4:122457802-122457824 ATCCTTCTTCTGCCCCTTACTGG - Intergenic
979672455 4:123374136-123374158 ATCCCAGTTTTGATACTTACTGG + Intergenic
979673582 4:123386438-123386460 ATCCTTGTTCTCCCACATGCCGG + Intergenic
981041557 4:140227640-140227662 ATCCTTGTTCTGCAACTTACTGG + Intergenic
981132305 4:141171230-141171252 GTCCTGATTCTGCTACTGACTGG - Intronic
981943864 4:150317763-150317785 ATCCTACTTCTGCCACTGACTGG + Intronic
982841536 4:160193972-160193994 ATCCTGGTTCTGCCACTTGGTGG + Intergenic
984281849 4:177679813-177679835 ATCTTAGCTCTGCTACTTTCTGG - Intergenic
984503394 4:180586462-180586484 ATCCTTGTTCTGCTGATAAAGGG + Intergenic
984529925 4:180903132-180903154 GTTCTTGTTCTGCTACGCACTGG + Intergenic
984853621 4:184174636-184174658 ATCCTGGTTCTGACACATACTGG - Intronic
986698377 5:10378398-10378420 ATCCTGGTTCTGCCACTAACTGG - Intronic
986937498 5:12907623-12907645 TTTATTGTTCTGCTACTGACTGG + Intergenic
987101730 5:14597053-14597075 ATTCTGGCTCTTCTACTTACTGG + Intronic
987422543 5:17737526-17737548 CTCCGAGTTGTGCTACTTACCGG - Intergenic
988173417 5:27689222-27689244 ATACTTATTGTGCTAGTTACCGG - Intergenic
988702484 5:33689276-33689298 ATGCTGGTCCTGCTGCTTACTGG - Intronic
989085025 5:37666804-37666826 ATCCTGGCTCTGCCCCTTACTGG + Intronic
990514652 5:56520094-56520116 GTCCTGGTTCTGCCACTTCCTGG + Intronic
990739758 5:58900509-58900531 ATCTTTGTTCTGCTAATTCCTGG - Intergenic
990942986 5:61222235-61222257 ATCCTTGTTCTGCTACCTGCTGG + Intergenic
991411021 5:66345909-66345931 ATCCCAGCTCTGCCACTTACAGG + Intergenic
992160777 5:73999061-73999083 ATTCTGGCTCTGCCACTTACTGG - Intergenic
992359462 5:76022007-76022029 CTCCTTGTTCTGTTAATTATAGG - Intergenic
994680006 5:102874939-102874961 ATCCTTGTTCTCCTATTTACCGG - Intronic
995449231 5:112281710-112281732 ATGCTTGTTCTGCTATGTAACGG + Intronic
995786687 5:115838413-115838435 ATCCTGGCTCTGCCACTTGCTGG + Intronic
997342212 5:133153522-133153544 ATCCTGGTTCTGCTGCCCACTGG - Intergenic
997619291 5:135274391-135274413 GTCCTTGCTCTGCTGTTTACTGG + Intronic
997670821 5:135670488-135670510 GTCCTGGTTCTGCTGCTCACTGG + Intergenic
997845686 5:137283867-137283889 GTCCTTGCTCTGCTGCCTACTGG - Intronic
998808130 5:145938547-145938569 TTCCTTGTTCTACTACTTTCTGG - Intronic
998841013 5:146253814-146253836 ATCCTAGTTGTGCTGCTTATTGG + Intronic
999345058 5:150810604-150810626 GTCCTGGATCTGCCACTTACTGG - Intergenic
999656386 5:153814859-153814881 ATCCTGGTGCTGTCACTTACAGG - Intergenic
999803353 5:155058389-155058411 ATCCTGGCTCTACCACTTACAGG + Intergenic
1000790918 5:165606049-165606071 TTCCTTTTTCTTCTACTTACAGG + Intergenic
1001082864 5:168679830-168679852 ATCCTAGCTCTGCCACTTACTGG + Intronic
1001593499 5:172882530-172882552 ATCCTAGCTCTGCCACTCACTGG + Intronic
1001712190 5:173787826-173787848 ATTTTAGCTCTGCTACTTACTGG + Intergenic
1001713911 5:173799110-173799132 ATGCCTGCTCTGCTACTTGCTGG + Intergenic
1001833733 5:174811866-174811888 ATCCTCCTTCTGCCACTTATGGG + Intergenic
1002027268 5:176404119-176404141 ATCCTGGTTCTGCCACTTCCTGG - Intronic
1004115201 6:12759890-12759912 ATCCTCACTCTGCCACTTACTGG + Intronic
1004174086 6:13323862-13323884 ATCCTAGCTCTGCCACTTACAGG + Intronic
1004316314 6:14591212-14591234 ATCCTGCCTCTGCTACTTATTGG + Intergenic
1004612336 6:17255300-17255322 ATCCTAGCTCTGCCTCTTACTGG - Intergenic
1004755969 6:18610549-18610571 AACCTGGTTCTCATACTTACTGG + Intergenic
1005413402 6:25575113-25575135 ATCCTGAACCTGCTACTTACTGG - Intronic
1005695675 6:28350466-28350488 ATCCTGCCTCTGCCACTTACTGG + Intronic
1005913625 6:30332157-30332179 TTCCTGGTTTTGCCACTTACTGG - Intronic
1006838614 6:37014312-37014334 ATCCCAGTTCTGCTACTCTCTGG - Intronic
1007737797 6:43992731-43992753 ATCGGGTTTCTGCTACTTACTGG - Intergenic
1008987743 6:57565492-57565514 ATCCTTGGACTGGGACTTACTGG - Intronic
1009024406 6:57981459-57981481 TTTCTTGCTCTGCTTCTTACTGG + Intergenic
1009176347 6:60464092-60464114 ATCCTTGGACTGGGACTTACTGG - Intergenic
1009199988 6:60732945-60732967 TTTCTTGCTCTGCTTCTTACTGG + Intergenic
1009983367 6:70752554-70752576 ATTTTTTTCCTGCTACTTACTGG + Intronic
1010046292 6:71447766-71447788 ATTCTGGTTCTGCTACTCACCGG + Intergenic
1010359820 6:74979590-74979612 ATCCTTGTTCTTCTCCCTCCAGG - Intergenic
1011743288 6:90385035-90385057 ATCCTGGCTCTGCCATTTACTGG + Intergenic
1013646652 6:112149227-112149249 ATCCTGAATCTGCTTCTTACTGG + Intronic
1015022823 6:128497184-128497206 ATTAGTGTTCTGCTACTGACTGG - Intronic
1015509246 6:134021679-134021701 ATCCCAGCTCTTCTACTTACTGG - Intronic
1016375542 6:143416907-143416929 ATTCTGGTTCTGCTACTCACTGG + Intergenic
1017058713 6:150460706-150460728 GTCCTGGCTCTGCTACTTATGGG - Intergenic
1017244870 6:152213024-152213046 ATCCTTATGTTGCTATTTACCGG - Intronic
1018668388 6:166160529-166160551 ATCCTGGTTCTGCCACTTACTGG - Intronic
1021846844 7:24771541-24771563 ATCCTGGTTCTGCCACTTACTGG + Intergenic
1021895559 7:25231956-25231978 ACCCTGGTTCTGACACTTACTGG - Intergenic
1022115649 7:27258212-27258234 ATTCTTGTTTTGTTGCTTACTGG + Intergenic
1022399423 7:30023272-30023294 CTCCTTGTTCTGCAACCTAGTGG - Intronic
1022412950 7:30153538-30153560 ATCCTGGCTCTGCCACTTACTGG + Intronic
1022620548 7:31979567-31979589 ATCCTGGCTCTGCCATTTACTGG - Intronic
1024486074 7:49921474-49921496 ATCCCAGTTCTACCACTTACTGG + Exonic
1024499701 7:50091894-50091916 ATCCTAATTCTGCCACTTACTGG + Intronic
1025225618 7:57158901-57158923 ATCCTGGTTCTGACACTTATGGG - Intergenic
1025267715 7:57478522-57478544 ATCCTGGTTCTGTCACTTATGGG + Intergenic
1025749077 7:64275674-64275696 ATCCTGGTTCTGCCACTTATGGG + Intergenic
1025794912 7:64730387-64730409 ATCCCAGTTCTGCCACTTATGGG + Intergenic
1026455325 7:70567418-70567440 ATCCTGGTTCTGCCACTCTCTGG + Intronic
1027462464 7:78471992-78472014 ATCCTGGTTTTGCCATTTACTGG - Intronic
1028683511 7:93566455-93566477 CTCCTAATTCTGTTACTTACAGG + Intronic
1028850980 7:95537165-95537187 AATCTTATTCTGCTACTTATTGG + Intronic
1030275325 7:107714726-107714748 GTCCTCATTCTGCTACTTACTGG + Intronic
1030511388 7:110486705-110486727 AGTCTAGTTCTGCCACTTACTGG + Intergenic
1031020088 7:116618428-116618450 ATCCTGGCTCTGACACTTACTGG + Intergenic
1031307157 7:120143418-120143440 ATCCTTATTTTGATCCTTACTGG - Intergenic
1031857387 7:126938890-126938912 ATCCTAGTTCTCCCAATTACAGG + Intronic
1032595342 7:133234073-133234095 ATCCTTTTTCTGCCACTTACTGG - Intergenic
1033637614 7:143226557-143226579 AACTTTGTTTTGCTGCTTACAGG - Intergenic
1033637673 7:143226992-143227014 GTCCTGGCTCTGCCACTTACTGG + Intergenic
1036469949 8:9044010-9044032 ATCTTGGTTCTGAGACTTACTGG + Intronic
1037340610 8:17840588-17840610 ATCCTGGCTCTATTACTTACTGG - Intergenic
1037895580 8:22651542-22651564 AACCTTGTTCTTCTACCTGCAGG + Intronic
1037994930 8:23345185-23345207 ATACTTGTTTACCTACTTACTGG - Intronic
1038494826 8:27993960-27993982 ATACTAGCTCTGCCACTTACTGG - Intergenic
1038793098 8:30686050-30686072 ATCCTAGCTCTGCAACTTACCGG + Intronic
1039518231 8:38150658-38150680 ATCCTAGTTGTGCCTCTTACTGG - Intronic
1040828402 8:51648995-51649017 TTCCTTTTTCTTCTACTAACAGG + Intronic
1043959327 8:86397969-86397991 ATTCCAGTTCTGCTACTTATTGG - Intronic
1044717105 8:95110618-95110640 ATCCCAGCTTTGCTACTTACTGG - Intronic
1046861656 8:119099523-119099545 ATCCTGGCTTTGCCACTTACTGG - Intronic
1047281197 8:123447590-123447612 ATCCTGGCTCTACTACTTACTGG - Intronic
1047722326 8:127652616-127652638 ATCCTGGTTCTGCAATTTACTGG + Intergenic
1047765144 8:127984393-127984415 ATCCTAGCTCTGCCACTTGCTGG - Intergenic
1047795605 8:128252088-128252110 AATCTTGTTCTGCTGCTTTCGGG + Intergenic
1048126976 8:131646536-131646558 ATCTTGGTTCCACTACTTACTGG - Intergenic
1048186644 8:132248037-132248059 ATCCTAGCTCTGCCACTTCCTGG - Intronic
1048335479 8:133499115-133499137 ATCCCAGCTCTGCCACTTACCGG + Exonic
1048413496 8:134200363-134200385 ATCCTTGTTCTGGGAGTTGCAGG + Intergenic
1049934362 9:486551-486573 ATCCTGCCTCTGCTACTCACAGG - Intronic
1050301952 9:4268139-4268161 ATCCTGACTCTGCCACTTACAGG + Intronic
1050336765 9:4597132-4597154 ATCCTAGTTCTGCCATTTACAGG - Intronic
1050360018 9:4821310-4821332 ATCCTGGTTTTGCCACTTTCTGG + Intronic
1051521644 9:17995847-17995869 ATCCTGGCTCTGCTACCTCCTGG + Intergenic
1051590490 9:18772524-18772546 ATCCTGACTCTGCCACTTACTGG + Intronic
1052843303 9:33312245-33312267 ATCCTGGTTCTGTCACTTACTGG + Intronic
1053372588 9:37575567-37575589 ATCACAGTTCTGCCACTTACTGG - Intronic
1053474082 9:38369557-38369579 GTCCTGATTCTGCTACTCACAGG - Intergenic
1053609103 9:39692922-39692944 ATCCAGGATCTGCTACTCACTGG + Intergenic
1053866947 9:42449192-42449214 ATCCAGGATCTGCTACTCACTGG + Intergenic
1054089213 9:60778567-60778589 ATCCAGGATCTGCTACTCACTGG - Intergenic
1054244422 9:62649476-62649498 ATCCAGGATCTGCTACTCACTGG - Intergenic
1054558549 9:66684019-66684041 ATCCAGGATCTGCTACTCACTGG - Intergenic
1054892538 9:70267638-70267660 ATCGTTTTTCTGGCACTTACTGG + Intronic
1055743215 9:79412371-79412393 ATCCTGGCCCTGCCACTTACTGG + Intergenic
1057144966 9:92752132-92752154 CTCCTTGTTCTGTTGCTGACAGG + Intronic
1057772537 9:97981720-97981742 ATCCTAGCTCTGCTTCTTGCTGG + Intergenic
1057983741 9:99688397-99688419 ATTCTGGTTCTGCCACTTATTGG - Intergenic
1058106533 9:100978218-100978240 CTTCTAGTTCTGCTTCTTACTGG - Intergenic
1058642060 9:107097159-107097181 ATCCTGGATCTGCTACCTTCTGG + Intergenic
1058951550 9:109908424-109908446 ATCCCAGCTCTGCCACTTACTGG + Intronic
1059159599 9:112021484-112021506 ATCCTAGCTCTGCTAGGTACTGG + Intergenic
1059640261 9:116209870-116209892 ATCCTTGTTCTGCTTCACACTGG - Intronic
1059691660 9:116690702-116690724 ATCCTTGCTCTATTACTTATTGG + Intronic
1059722038 9:116969258-116969280 AACCTGGTTCTATTACTTACTGG + Intronic
1059739219 9:117133372-117133394 ATCCTAGCTCTGCCACTGACTGG - Intronic
1060055596 9:120410173-120410195 ATTCTGGTTCTGCCACCTACTGG - Intronic
1060246219 9:121948669-121948691 AGCCTGGTTCTGCCACTTCCTGG - Intronic
1060354161 9:122888455-122888477 TTCCTCGTTCTTCTACATACTGG + Intronic
1060454970 9:123783648-123783670 ATCCTGGCTCTGCCATTTACAGG - Intronic
1060665926 9:125432131-125432153 ATCCTAGTGCTGCCACTTGCTGG - Intergenic
1062218430 9:135401662-135401684 ATCCTGGCCCTGCCACTTACAGG - Intergenic
1186830608 X:13386481-13386503 GTCCTGGTTCTGCTACTAACTGG - Intergenic
1188184552 X:27097904-27097926 ATCCAAGCTCTGCTACCTACTGG - Intergenic
1188585753 X:31772701-31772723 ATCCTTGTTCTGCTACTTACTGG + Intronic
1189263170 X:39692488-39692510 ATCCTTGTTCTATTGCTAACTGG + Intergenic
1189599127 X:42602836-42602858 ATCCTCGCTCTGCAACTTTCTGG + Intergenic
1189883702 X:45517819-45517841 GTCTTTGTTCAGCTACTAACAGG + Intergenic
1190337716 X:49272353-49272375 ATCCTGGCGCTGCCACTTACTGG + Intronic
1191654564 X:63582024-63582046 ATCCTGGTTCTTCGACTTAGAGG + Intergenic
1191678148 X:63813302-63813324 ATCCCAGATCTGCCACTTACTGG + Intergenic
1191911364 X:66154051-66154073 ATCCTTGTCCTGTTCCTTAAAGG - Intergenic
1193621617 X:83759337-83759359 GTCCTGGTTTTGTTACTTACTGG + Intergenic
1193851275 X:86540174-86540196 ATCATTCTTCTGCTACTGAGTGG + Intronic
1195835472 X:109110132-109110154 ATGCTGGTTCTCCTACTTCCTGG + Intergenic
1196010118 X:110877854-110877876 ATCTTGATTCTGCTGCTTACTGG + Intergenic
1196188181 X:112766680-112766702 ATCCTAGCTCAGCTACTTACAGG - Intergenic
1196282772 X:113842612-113842634 ATCCCAGCTCTGCCACTTACTGG + Intergenic
1196750096 X:119108252-119108274 ATTCCTACTCTGCTACTTACTGG - Intronic
1198373584 X:136015442-136015464 ATCCTGGTTCTACTACTTGCTGG + Intronic
1199018871 X:142852014-142852036 ATACTTCCTCTTCTACTTACTGG + Intergenic