ID: 1188585816

View in Genome Browser
Species Human (GRCh38)
Location X:31773882-31773904
Sequence TAGGAGAGTAAAGTGATTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 258}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188585813_1188585816 1 Left 1188585813 X:31773858-31773880 CCTAAGAACTGGTGGGAAATGGT 0: 1
1: 0
2: 0
3: 12
4: 147
Right 1188585816 X:31773882-31773904 TAGGAGAGTAAAGTGATTGGTGG 0: 1
1: 0
2: 1
3: 25
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188585816 Original CRISPR TAGGAGAGTAAAGTGATTGG TGG Intronic
900759652 1:4462232-4462254 AAGGAAAGTAAAGTGAGTGGTGG - Intergenic
904938208 1:34146781-34146803 TGGGAGAGTAAAGTTTCTGGGGG + Intronic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
907340980 1:53736176-53736198 GAGGAGAATAAAGGGATGGGAGG - Intergenic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
911035782 1:93545667-93545689 TAGTATAGGAAAGAGATTGGAGG + Intronic
911049246 1:93655589-93655611 TAGTATAGTATAGTGCTTGGAGG - Intronic
911499656 1:98669286-98669308 TAGGAGAGGAAACTGAAAGGAGG - Intronic
912213062 1:107576244-107576266 GAGAAGAGTAAAGTGCATGGTGG + Intronic
915212959 1:154323834-154323856 TAGCAGAGGAAGGTGAGTGGAGG - Intronic
916999594 1:170342032-170342054 TTAAAGAGTAATGTGATTGGTGG - Intergenic
917115150 1:171595474-171595496 TATGATAGAAGAGTGATTGGGGG + Intergenic
917186399 1:172361470-172361492 CAGGGGAGTTAAGTGATTGAAGG - Intronic
917528818 1:175814666-175814688 TGGGAGGGTAAAGTAAGTGGTGG - Intergenic
919510395 1:198455928-198455950 TAGGAGACTAAAGTGAGTTCTGG - Intergenic
919747307 1:201016932-201016954 CAGGACAGGAAAGTGATTAGGGG - Intronic
919773090 1:201175467-201175489 TTGGAGAGGAAAGTGATGGAAGG + Intergenic
920702617 1:208229206-208229228 GAGGAGAGAAAGGAGATTGGAGG + Intronic
921596559 1:217060465-217060487 TAGGAGAATCAAGTAAATGGTGG - Intronic
923400253 1:233609969-233609991 TGGGGGAGTAAAGAGAGTGGGGG - Intergenic
923556548 1:235005287-235005309 TAGGAGAGCAAATTGATGAGTGG - Intergenic
924840197 1:247701480-247701502 TAGGAAAGGAAACAGATTGGTGG + Intergenic
1063126283 10:3139327-3139349 CAGGAGAGGAAAGTCAGTGGAGG + Intronic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1066556906 10:36624241-36624263 AAGTAGAGTAGAGAGATTGGGGG - Intergenic
1066704953 10:38167277-38167299 TTGGAGAGTGAAAAGATTGGTGG - Intergenic
1066710189 10:38224829-38224851 TAGGAGCTTAAAGTGTTTGAGGG - Intergenic
1067324464 10:45253729-45253751 GAGGAGAGCACAGTGATTGGAGG + Intergenic
1069555898 10:69398489-69398511 TGGATGAGTACAGTGATTGGGGG + Intronic
1071753806 10:88512744-88512766 TGGGAGAGTAAAGTGCTCGTTGG - Intronic
1071886892 10:89961150-89961172 TAGGAGATTTGAGTGATTGAGGG + Intergenic
1072492500 10:95921317-95921339 AGGGAGAGTTAAGTGATTGGGGG - Intronic
1073618644 10:105024131-105024153 TAAGAAAGCAAAGTGATGGGAGG + Intronic
1075344253 10:121670631-121670653 GAGGAGAGGAAAGGAATTGGTGG + Intergenic
1077747857 11:4927645-4927667 TTGGAGAGAAAAGGGCTTGGAGG + Intronic
1077909381 11:6560795-6560817 TAAGAGAGTAAAGAGATGGAGGG - Intronic
1077911879 11:6579595-6579617 AAGGAGAGCAGAGTGATTGTGGG + Intronic
1078442295 11:11377972-11377994 CAGGCGAGTAAAGTGTTTGCAGG + Intronic
1078813067 11:14790718-14790740 TTGGAGAATAAATTAATTGGTGG + Intronic
1079416299 11:20239182-20239204 AAGGAGAGCACAGTGACTGGGGG - Intergenic
1081084444 11:38781845-38781867 TTGGAGTGCAAACTGATTGGAGG + Intergenic
1085756358 11:79205058-79205080 AAGGAGAGGAATGAGATTGGGGG + Intronic
1088098378 11:106126402-106126424 TAGGAGAGAGAAGTGATTCTAGG + Intergenic
1088409372 11:109516572-109516594 TAGGAGAGTAAAGGTGTTAGAGG - Intergenic
1090236207 11:125149394-125149416 TAGGAGAGGAGATAGATTGGAGG + Intergenic
1092111438 12:5967648-5967670 TATGAGAGTGAGGTGAGTGGGGG - Intronic
1092204832 12:6608341-6608363 TAGGAGAGTAAAATTATTATGGG - Intergenic
1093042263 12:14396132-14396154 TAGCAGAGTAAAGTGAAGAGTGG + Intronic
1093506303 12:19870793-19870815 TAGGAGACTAAAATGAGAGGAGG - Intergenic
1093596802 12:20972370-20972392 TAGGAGAGAAAAATGGTTGTGGG + Intergenic
1093690491 12:22103161-22103183 TAGGAGTCTGAAGTGACTGGAGG - Intronic
1096846862 12:54412187-54412209 TAGGAGAGGACAGAGAATGGCGG - Intronic
1097534624 12:60851574-60851596 TAGGAGAGAAATGTGATTGGAGG + Intergenic
1097730802 12:63126012-63126034 TAGTAGAGTAAAGTGAATCAGGG - Intergenic
1098401100 12:70076830-70076852 TTGGAAAGTAAAATGATTGCGGG - Intergenic
1099448604 12:82781717-82781739 TTGGAGAGGAAAGTGAAAGGCGG + Intronic
1099674994 12:85747631-85747653 TATGAGAGCAATGTGTTTGGAGG + Intergenic
1100804943 12:98273203-98273225 CATGAAAGTAAAGAGATTGGTGG + Intergenic
1101074423 12:101113732-101113754 TAGGGTAGTACAGTGATTGCTGG + Intronic
1102866178 12:116376920-116376942 TGGGAGAGGGACGTGATTGGAGG + Intergenic
1104650340 12:130526892-130526914 TGGGAGAGTAAAGTGAAGGAAGG + Intronic
1105773072 13:23631209-23631231 TAGTAGAAAAAAGTGAGTGGTGG + Intronic
1106141061 13:27012066-27012088 AAGGAGAGTGAAGTGAATGGAGG + Intergenic
1106587731 13:31071939-31071961 TAGGAGAGAAAAGTCAAAGGTGG - Intergenic
1106785388 13:33102931-33102953 TAAGGGATTAAAGTGATGGGTGG - Intergenic
1108486051 13:50926279-50926301 AAGTAGAGTAAAGGGAGTGGGGG + Intronic
1108757590 13:53522724-53522746 TAACAGTGAAAAGTGATTGGGGG - Intergenic
1108911184 13:55553368-55553390 TAGGATAGTATAGTGGTTTGAGG + Intergenic
1110518012 13:76439376-76439398 TAGGAGGGTAAACTTGTTGGAGG - Intergenic
1112375200 13:98833307-98833329 TAGGAATGTAAATTCATTGGAGG - Intronic
1114820428 14:26011235-26011257 AGAGAGAGTAAAGAGATTGGAGG + Intergenic
1115747208 14:36449869-36449891 TAGGCGAGTTAAGTTATTTGAGG + Intergenic
1116642948 14:47487966-47487988 TAGGAAAATAAAATTATTGGTGG + Intronic
1119377427 14:74206172-74206194 TAGCAAAGTACAGTGATTTGAGG - Intergenic
1119753158 14:77095031-77095053 AAAGAGAGTAAAGTGAGTGAAGG + Intergenic
1120384240 14:83824158-83824180 TATGACAGCAAAGTGATTGATGG - Intergenic
1121072804 14:91040013-91040035 TAGGAGAGTAAGTTGGTGGGTGG + Intronic
1122166818 14:99831531-99831553 TAAGAGAGTAAAATGGTGGGAGG + Intronic
1122703631 14:103606730-103606752 AAAGAGAGAAAAGTGAATGGTGG - Intronic
1123136409 14:106031449-106031471 TAGGAGAGTAGGGTGATAGTGGG + Intergenic
1124173241 15:27396907-27396929 TAGGAGAAAAAAGAGGTTGGTGG + Intronic
1124582594 15:30973289-30973311 TAGCAGAGTAGAGTGGTTGTAGG - Intronic
1125038776 15:35158830-35158852 TAGGTGAGTAAAGTCAGAGGTGG - Intergenic
1125317355 15:38445403-38445425 TAGTACAGTCAAGTGTTTGGTGG - Intergenic
1126572285 15:50164903-50164925 GAGGAGAGCACAGTGATTGTAGG - Intronic
1129360492 15:75021088-75021110 TAGGACAGGAAACTGATTGGAGG - Exonic
1129882907 15:79018838-79018860 TAGGAGGGTAAAGAGTTTTGGGG + Intronic
1130876557 15:88019479-88019501 GAGGAGCTTAAAGTGCTTGGGGG + Intronic
1130986665 15:88849044-88849066 TAGGGGTGCAAAGGGATTGGAGG + Intronic
1134227180 16:12400111-12400133 TAGATGAGTAAACTGGTTGGGGG - Intronic
1141453868 16:84125400-84125422 TTGGTGGGTAATGTGATTGGTGG - Intronic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1146411572 17:32590216-32590238 TTGGAGAGTTGAGTGATTGCAGG - Intronic
1147026010 17:37584092-37584114 GAGCAGGGTAAAGGGATTGGAGG - Intronic
1147565709 17:41535403-41535425 CAGAAGAGTAAAGAGAATGGGGG + Intergenic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1149514683 17:57271548-57271570 TAGGAGAATAAATTCCTTGGGGG + Intronic
1152268581 17:79310497-79310519 TAGGAGAGAAAAGAGAGGGGTGG - Intronic
1153597409 18:6741906-6741928 TAGAGGAATAAAGCGATTGGGGG - Intronic
1155328988 18:24695080-24695102 AAGAGCAGTAAAGTGATTGGAGG + Intergenic
1155813327 18:30268198-30268220 CATGGGAGAAAAGTGATTGGGGG + Intergenic
1155947430 18:31871524-31871546 AAGGAGAGTAATAAGATTGGGGG - Intronic
1156134214 18:34016889-34016911 TTGGAGAATAAATTAATTGGTGG + Intronic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1158225113 18:55192745-55192767 AAGGAGATTAAAGTGACTGAGGG + Intergenic
1159446200 18:68544532-68544554 CAGGAGAGTGCAGTGATTGTGGG + Intergenic
1159600443 18:70423845-70423867 TAGCAGATTAAGGTCATTGGGGG + Intergenic
1163767342 19:19170893-19170915 AAGGAGAGGGAAGTGGTTGGTGG - Intronic
1164409713 19:27990820-27990842 TAGGAGATTAAAATGTTTGGGGG - Intergenic
1164642851 19:29839104-29839126 TAGGTGAGGAATGTGATTTGAGG - Intergenic
1168484243 19:56747545-56747567 TAGGAGAGCTGAGTGATTCGTGG - Intergenic
1168512992 19:56988297-56988319 TCGGAGAGAAAAGTGAGTGGGGG + Intergenic
926196601 2:10767881-10767903 TGGGAGAATAAAGGGAATGGGGG - Intronic
926603242 2:14869600-14869622 GAGGAGTGTAAAATGATTAGTGG - Intergenic
927963325 2:27254393-27254415 AAGGGGAGTAAAGAGACTGGTGG + Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928506365 2:31957568-31957590 TAGGAAAGTAAAGTAAAAGGAGG - Intronic
928847610 2:35696689-35696711 AGGGAGAGCAAAGTGACTGGGGG - Intergenic
929711547 2:44271741-44271763 CAGGAGAATATAGGGATTGGAGG - Intergenic
930224528 2:48778722-48778744 TAGGAGAGTCAAGAAACTGGAGG + Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930981271 2:57528779-57528801 AGGGAGAGTTAAGTGATTGTGGG - Intergenic
931590633 2:63879659-63879681 TAGAAGAGGAATGTGATTAGGGG + Intronic
931997318 2:67851683-67851705 TAGGAAAGTCAAATGTTTGGAGG - Intergenic
932627422 2:73308802-73308824 CAAGAGAGTAAAGTGGTTAGGGG - Intergenic
932638422 2:73414914-73414936 TTGGAGAGTAATGGGATTTGTGG - Intronic
936262271 2:110971706-110971728 TAGGAGAGTAGATTATTTGGGGG + Intronic
936811829 2:116412304-116412326 TAGGAGAGAAAAGAGATTAGAGG + Intergenic
936932270 2:117802253-117802275 TATGGGAGTAAAGTGAGAGGAGG - Intergenic
937268929 2:120634839-120634861 CAGGAGACTCAAGTGTTTGGAGG - Intergenic
937698746 2:124839453-124839475 TAGGAGAGTAAAGAGAGAGGGGG - Intronic
939026845 2:137024231-137024253 GGGGAGACTAAACTGATTGGTGG + Intronic
939798333 2:146676649-146676671 TAGGACAGTTAACTGATTGAGGG + Intergenic
941161481 2:162040516-162040538 GGAGAGAGTAAAGAGATTGGTGG + Intronic
941415962 2:165221768-165221790 GAGGATAGTAAAGTGAAGGGAGG + Intergenic
942972378 2:181971868-181971890 AAGGAGAGCAAAGGGATTGTGGG - Intronic
943892814 2:193312120-193312142 TATAAGAGAAAAGTGATTGCTGG + Intergenic
943933490 2:193885306-193885328 AGGGAGAATAAAGTGACTGGTGG + Intergenic
944585390 2:201167941-201167963 TATGAGATTAAAATGTTTGGAGG + Exonic
945645453 2:212486207-212486229 TAGGACATTAAAGTAACTGGGGG + Intronic
945955616 2:216083194-216083216 TAGTAGAGTTAAGTGATTCCTGG - Intronic
946217074 2:218192635-218192657 TAGGAGAATAAAGGGAAAGGGGG + Intergenic
946348319 2:219129448-219129470 TATCAGAGTAAAGTCATAGGTGG - Intronic
946508175 2:220324102-220324124 TGGGAGAGTGATGTGATTGATGG + Intergenic
946968819 2:225069112-225069134 CAGGAGAGTGAAGTGAATGGGGG - Intergenic
947009273 2:225547616-225547638 AAGGAGAGTATAGTGATTGTGGG - Intronic
948103043 2:235390546-235390568 TAGGAGAGTCAAGTGAATGTGGG - Intergenic
948313009 2:237003765-237003787 TAGGAAAGTAATGGGATTGGTGG - Intergenic
1170037862 20:12008745-12008767 TAGGAGAACATAGAGATTGGGGG + Intergenic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1174741180 20:53015657-53015679 TAGGAGGGTAATGTGACTTGGGG + Intronic
1176669150 21:9715893-9715915 TAGTAGAGAAATATGATTGGAGG - Intergenic
1177212830 21:18091473-18091495 GAGGAGAGCAAAGTGTATGGAGG + Intronic
1177482610 21:21710787-21710809 TAAGAAAGTAAAATGAGTGGGGG - Intergenic
1181450055 22:23013839-23013861 TAGCAGAGAGGAGTGATTGGCGG - Intergenic
1181783884 22:25211856-25211878 CAGTAGAGTCAAGTGATAGGAGG + Intergenic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
952683366 3:36121723-36121745 AAGGAGAGCAAAGTGAGTGTGGG + Intergenic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
955761111 3:62283786-62283808 TAGGAGAGTACTATGATTTGAGG - Intronic
956763591 3:72464953-72464975 TTGGAGAGGGAAGAGATTGGAGG + Intergenic
957372700 3:79316216-79316238 TAGTAGGGCAAACTGATTGGAGG + Intronic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
959945660 3:112123188-112123210 TTGGAGAGTATAGTGGTAGGAGG - Exonic
961955279 3:130795251-130795273 GAGGAGAATTAAGTGATTTGTGG - Intergenic
962638917 3:137362309-137362331 AAGCAGAGTAAAGTAATTGTGGG - Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963029791 3:140958068-140958090 TATGAGAGTAAAGTTATTTCAGG + Intronic
963993597 3:151681352-151681374 TGGGAGAGTAAATTTATGGGAGG - Intergenic
964020946 3:152009929-152009951 TAGGAGAATAAACTGAGTGGAGG - Intergenic
964140888 3:153397455-153397477 AAGGAGAGCAAAGTGATTGTGGG - Intergenic
965027096 3:163316168-163316190 AGTGAGAGCAAAGTGATTGGAGG - Intergenic
966549307 3:181186313-181186335 TAGAGGAATAAAGTCATTGGAGG + Intergenic
967424550 3:189311601-189311623 TGGGAGAATAATGTGATTCGAGG - Intronic
967439566 3:189491109-189491131 TAGGAGAGTGAAGTCTTTGTAGG + Intergenic
967677360 3:192316458-192316480 AAGGAGAGTACAGTGGTTGTGGG + Intronic
968053814 3:195675600-195675622 TAGGGAAGAAAAGGGATTGGTGG + Intergenic
968102077 3:195973554-195973576 TAGGGAAGAAAAGGGATTGGTGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972278568 4:37582066-37582088 AGGGAGAGTACAGTGATTTGGGG - Intronic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
975224885 4:71859756-71859778 TAGGAGAGTAACGTGGTTTTTGG - Intergenic
979015644 4:115430006-115430028 TAGGAGAGAACAGTAATTGAAGG - Intergenic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
979604995 4:122628824-122628846 TAAGACATTGAAGTGATTGGAGG + Intergenic
981227674 4:142315786-142315808 TTGGAGAGAAAGGGGATTGGAGG + Intronic
982287123 4:153747059-153747081 TAGGAGAGTAGAATGGTTTGGGG - Intronic
982558278 4:156897108-156897130 TAGGAGAGAAAACTTATTTGGGG + Intronic
984522018 4:180813394-180813416 TAGGGGAGAAAAGAGAATGGGGG + Intergenic
984539592 4:181021357-181021379 TAGGAAAGTAAAGAGATAGAGGG + Intergenic
985405628 4:189635624-189635646 TAGTAGAGAAATATGATTGGAGG + Intergenic
985567232 5:625356-625378 TAGGAGTTTAAAATGAGTGGAGG - Intronic
987886184 5:23815904-23815926 AGGGAGAGTAAAGTGAGTGTGGG + Intergenic
988384075 5:30539155-30539177 GAGAAGAGTACAGTGATTGCAGG + Intergenic
989480134 5:41921168-41921190 TAGGAATGTAAAGTTATTGTGGG - Exonic
989782929 5:45291199-45291221 TGAGAGAGAAAAGTTATTGGAGG - Intronic
991002765 5:61798940-61798962 CATGAGAGTCAAGTGAGTGGTGG + Intergenic
993287454 5:86017133-86017155 ATGGAGAGTACAGTGACTGGAGG - Intergenic
995441379 5:112196148-112196170 TAAGAGAGCAAAGTGTTTGGAGG - Intronic
995734515 5:115285751-115285773 TTGGAGAGGAAATTGATGGGAGG + Intronic
997506770 5:134423907-134423929 TTGTGGAGTAATGTGATTGGAGG - Intergenic
1000149577 5:158486330-158486352 TAGGAGAGTGAAGGGCTTGTGGG + Intergenic
1002917928 6:1544084-1544106 TAGAAGAATAAACTGATGGGTGG + Intergenic
1003082270 6:3031006-3031028 CAGGATAGTAATGTGATGGGAGG + Intergenic
1004722344 6:18277979-18278001 TAGGATAGTAAAGGAAGTGGGGG - Intergenic
1008597682 6:53059532-53059554 CAGGAGAGTAAAGAGAAGGGAGG + Intronic
1008665068 6:53708020-53708042 GAGGACAGTAAAGTGAATGAGGG + Intergenic
1008802437 6:55386041-55386063 TAGGAAAGGAAAGTTATTGGTGG - Intronic
1009044211 6:58218080-58218102 TATGAGAGGAAAATGGTTGGGGG - Intergenic
1009220035 6:60972347-60972369 TATGAGAGGAAAATGGTTGGGGG - Intergenic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1013618019 6:111862799-111862821 CAAGAGAATAAAGAGATTGGGGG + Intronic
1013837723 6:114352157-114352179 GAAGAGAGGAAAGTGAATGGTGG + Intergenic
1013881859 6:114914442-114914464 TAGTAGAGAAAATTGATTGTGGG - Intergenic
1013979974 6:116118915-116118937 TAGGACAATAAAGTGATGGGTGG - Intronic
1014568944 6:122985855-122985877 TAAAAGAGTAAAGTAATAGGTGG + Intergenic
1014806173 6:125832396-125832418 AAAGAGAGTAAAGTATTTGGGGG - Intronic
1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG + Intronic
1017370552 6:153701221-153701243 TAGGAGAGAAAAGACATTTGTGG + Intergenic
1018677255 6:166233850-166233872 TAAGAAAGTAAAGTGCTTTGAGG + Intergenic
1020831175 7:13097263-13097285 TAGGGGAGAAAAGTGAGTGTGGG + Intergenic
1021491975 7:21228843-21228865 GAGGAAAGTAAAGTTTTTGGGGG + Intergenic
1022194642 7:28052615-28052637 TAAGAAACTGAAGTGATTGGAGG - Intronic
1022859932 7:34357274-34357296 TAGGAGAACAAAGGGAGTGGAGG + Intergenic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1026374101 7:69732905-69732927 TAGGAGAGTAGAGTGCCTAGTGG + Intronic
1027747181 7:82091423-82091445 CAGGAAACTAAAGTGATAGGGGG - Intronic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028079859 7:86561926-86561948 TAGGAGAGTAAAGAAAGTTGAGG + Intergenic
1033320664 7:140336675-140336697 TAGAAGAGTATACTGATTAGGGG + Intronic
1033502514 7:141966088-141966110 AAGGAGAGTGCAGTGATTGAGGG - Intronic
1037475253 8:19250959-19250981 AAGGAGAGTAAAGTTGATGGAGG - Intergenic
1038479027 8:27888839-27888861 TAGGAGAGGAAAGTGGTTTGAGG + Intronic
1039173290 8:34773672-34773694 TAGGAAATTAAAATGAGTGGTGG - Intergenic
1042031965 8:64486157-64486179 TAGGAAGGTAAATTGATTGGTGG + Intergenic
1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG + Intergenic
1043714148 8:83460476-83460498 TAGGAAAGGAAAATGATTTGGGG + Intergenic
1045379754 8:101611558-101611580 GAGGAGAGGAAGGTGATTGCTGG - Intronic
1046010080 8:108535788-108535810 TAGAAGAATAGAGTGAATGGAGG + Intergenic
1046504674 8:115122224-115122246 AGGGAGATTAAAGTGATTTGGGG - Intergenic
1048887740 8:138922176-138922198 TAGAAGAGAAAAGTGATGGCCGG - Intergenic
1051008155 9:12374895-12374917 TTGGGGAGTAAAATGATTAGTGG + Intergenic
1051714456 9:19967462-19967484 TATGAAAGCAAAGTGATAGGGGG - Intergenic
1053650585 9:40164747-40164769 ATGGAGAGTGAAGTCATTGGAGG - Intergenic
1053755153 9:41299177-41299199 ATGGAGAGTGAAGTCATTGGAGG + Intergenic
1054331095 9:63756518-63756540 ATGGAGAGTGAAGTCATTGGAGG - Intergenic
1054533998 9:66211455-66211477 ATGGAGAGTGAAGTCATTGGAGG + Intergenic
1057259133 9:93574659-93574681 TAGGAGTGTTAAGGGATGGGGGG + Intergenic
1057528882 9:95826748-95826770 AAGGAGAGCAAAGAAATTGGAGG - Intergenic
1058429486 9:104905370-104905392 TAGAAAAGTCAAGAGATTGGAGG + Intronic
1058579515 9:106439785-106439807 TAGGAGAGGAAATGAATTGGTGG + Intergenic
1060245598 9:121943439-121943461 TGGGAGAGGTAAGTGTTTGGGGG - Intronic
1061367896 9:130182039-130182061 TAGGGGAGTATTGTGGTTGGGGG + Intronic
1202798469 9_KI270719v1_random:149438-149460 ATGGAGAGTGAAGTCATTGGAGG - Intergenic
1203656716 Un_KI270753v1:5043-5065 TAGTAGAGAAATATGATTGGAGG + Intergenic
1185755848 X:2652309-2652331 AAGGAGACTACAGTGTTTGGGGG + Intergenic
1187565531 X:20445846-20445868 TAGGAGGGAAAAGTGATTTGAGG + Intergenic
1187723890 X:22182388-22182410 AAGGAGAGTACGGTGATTGTGGG - Intronic
1188585816 X:31773882-31773904 TAGGAGAGTAAAGTGATTGGTGG + Intronic
1189646823 X:43142210-43142232 TAGCAGAGTATAGTTATGGGAGG - Intergenic
1190498451 X:51051566-51051588 AAAGAGAGTAAAGTGATTATGGG + Intergenic
1191197061 X:57736027-57736049 TGGGAGAGTTTAGTGACTGGGGG + Intergenic
1192076478 X:68003349-68003371 TAGGAGATCATAGTGGTTGGAGG - Intergenic
1192732853 X:73818581-73818603 TAAAAGAGTAAATTGATAGGAGG + Intergenic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1194309167 X:92282119-92282141 AAGGAGAGAAAAGGGAGTGGGGG + Intronic
1195114522 X:101683402-101683424 TTGTAGAGTAATGTGGTTGGTGG + Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1195974166 X:110507923-110507945 AAGGACAGTAAAAAGATTGGTGG + Intergenic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196383971 X:115127831-115127853 TTGGAGGGTAAGGTGAATGGAGG + Intronic
1196461512 X:115936428-115936450 TGGGAGAGGAAAATGATAGGTGG + Intergenic
1196579357 X:117361343-117361365 TAGGAGGAAAAAGTGATTGCAGG + Intergenic
1197084292 X:122454185-122454207 TAGGACAGTAAAGGTATTGCTGG + Intergenic
1197755950 X:129994970-129994992 AAGCAAAGTAAAGTGTTTGGGGG + Intronic
1197887222 X:131231126-131231148 TGGGAGAGCGGAGTGATTGGAGG + Intergenic
1198376521 X:136045515-136045537 GAGGCGAGTAAAGAGAATGGTGG + Exonic
1198714794 X:139545743-139545765 TAGGAGAGTAAAGAAAATGTGGG + Intronic
1198868691 X:141153324-141153346 TAGAAGAGTTATGAGATTGGAGG + Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG + Intergenic
1201747987 Y:17401585-17401607 TAGTAGAGTAATGTGATACGGGG - Intergenic