ID: 1188592743

View in Genome Browser
Species Human (GRCh38)
Location X:31859076-31859098
Sequence TCAGAGCCACAAGGTCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 240}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188592739_1188592743 3 Left 1188592739 X:31859050-31859072 CCGTATTTCCTGATGAAAATACA 0: 1
1: 0
2: 4
3: 40
4: 501
Right 1188592743 X:31859076-31859098 TCAGAGCCACAAGGTCAGCAGGG 0: 1
1: 0
2: 0
3: 27
4: 240
1188592740_1188592743 -5 Left 1188592740 X:31859058-31859080 CCTGATGAAAATACAAGCTCAGA 0: 1
1: 0
2: 0
3: 34
4: 248
Right 1188592743 X:31859076-31859098 TCAGAGCCACAAGGTCAGCAGGG 0: 1
1: 0
2: 0
3: 27
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188592743 Original CRISPR TCAGAGCCACAAGGTCAGCA GGG Intronic
902270982 1:15304861-15304883 TCATAGCCACAAGGTTTTCAGGG + Intronic
902377055 1:16034873-16034895 TCAGAGACACCAGGGCAGCCTGG - Intergenic
902382229 1:16058132-16058154 TCAGAGACACCAGGGCAGCCTGG - Exonic
903495108 1:23760765-23760787 TCTGAGCCACAGCGTCAGGATGG + Exonic
904225288 1:29012447-29012469 GCAAAGCCACAATGTCAGAAGGG - Intronic
906327412 1:44855850-44855872 TAAGATCCTCAAGGTCAGCTGGG - Intronic
906974942 1:50560128-50560150 TTAGAGTAACATGGTCAGCAAGG + Intronic
907421313 1:54349259-54349281 TCAGCTCCACAAGGTAGGCAGGG + Intronic
907784789 1:57600859-57600881 TCAGAGCGCCAAGGTGAACAGGG + Intronic
907847918 1:58226429-58226451 TCAAAGCCACAAAGTTAGGAAGG + Intronic
909801316 1:79811939-79811961 TTAAAGCCACAAGCTCAGCTTGG + Intergenic
910857487 1:91710194-91710216 TCAGAGCAGCAATGACAGCAAGG - Intronic
911090849 1:94015752-94015774 GCAGTGCCACAAGGGCAGGAAGG + Exonic
913076317 1:115343366-115343388 TGAAAGCCACAGGGTCACCAGGG - Intergenic
913996160 1:143653309-143653331 TCATAGCCACTAGACCAGCACGG + Intergenic
914241132 1:145853904-145853926 CCAGAGCCATGGGGTCAGCAAGG + Intronic
916720934 1:167484339-167484361 TCTCAGTCACAAGGACAGCAGGG + Intronic
917468806 1:175308222-175308244 TCAGAGCCACAAGCTCTCTAAGG - Intergenic
919149162 1:193673134-193673156 TCACAGTCACAAGGACAGCATGG - Intergenic
922473199 1:225889046-225889068 GCAGAGCCACAGGGGCTGCATGG + Exonic
922779698 1:228241521-228241543 GCAGAGCCACCAGGTCACCAAGG + Intronic
924154591 1:241163132-241163154 ACACAGCCAAAAGGTCAGAAAGG + Intronic
1063483673 10:6399559-6399581 CCAGAGCCACAAGATGAGGAAGG + Intergenic
1063979835 10:11444478-11444500 CCTGAGCCACCAGGTGAGCAGGG + Intergenic
1066193937 10:33080408-33080430 TCACAGCCACGAGAACAGCATGG - Intergenic
1067877953 10:50020861-50020883 CCAGCCCCACCAGGTCAGCACGG + Intergenic
1068741846 10:60482163-60482185 TCAGAGCAACAAGGGGAGCAAGG - Intronic
1069743527 10:70700412-70700434 GCAGAGTCACAAGGTCACCCAGG - Intronic
1070378708 10:75859802-75859824 TTACAGCCAAAAGGTCAGGAAGG - Intronic
1071942157 10:90601781-90601803 TCACTGTCACAAGGACAGCATGG - Intergenic
1073430225 10:103481027-103481049 ACAGAGCTACCAGGTCAGCCTGG + Intergenic
1076874862 10:133211026-133211048 TGAGAGCCAGAAGGTCAGCTGGG + Intronic
1077273989 11:1694820-1694842 TCAGAGCCTCACGCTGAGCAGGG - Intergenic
1079318677 11:19431599-19431621 TCAGAACCACAAGGAGAGGAAGG - Intronic
1083900092 11:65639436-65639458 ACAGAGGCTCAAGGTCAGCATGG + Intronic
1084121959 11:67074689-67074711 GCCAAGCCACAAGGTGAGCAGGG - Intergenic
1085455542 11:76663467-76663489 TGAGAGCCCCAAGGTGAGTAGGG + Intronic
1085860361 11:80226133-80226155 TCATTGCCACAAGAACAGCATGG + Intergenic
1086882237 11:92162278-92162300 ACAGAGTCACAATGTCAGCAAGG + Intergenic
1088553227 11:111036056-111036078 TCAGATCCACCATGTCAGAAGGG + Intergenic
1089901670 11:121992958-121992980 TCAGTGTCACAAGGTCATTATGG + Intergenic
1090639813 11:128720809-128720831 TCACAGCAACAGGGTCAGCCGGG + Intronic
1091057383 11:132431500-132431522 ACAGAGCCACAAGGACAGAGTGG - Intronic
1092229414 12:6768334-6768356 TCTGTGCCACAAGGTCAGTATGG - Intronic
1095950370 12:47778436-47778458 TCAAAGTCACAAGGCCTGCAGGG - Intronic
1099446069 12:82753078-82753100 GAAAAGCCACAAGGTCAACAGGG - Intronic
1101374908 12:104163229-104163251 TCACTGCCACAAGAACAGCATGG + Intergenic
1102736456 12:115165069-115165091 ACAGAGCAGGAAGGTCAGCAGGG - Intergenic
1103839261 12:123849566-123849588 ACAGAGGCAGAAGGACAGCAAGG - Intronic
1104352524 12:128057171-128057193 TCAGGGCCACACTGTCAGCAAGG - Intergenic
1104484069 12:129134410-129134432 CCTGAGCCACAAAGTGAGCAGGG - Intronic
1104966180 12:132509692-132509714 GCGGTGCCACAGGGTCAGCAGGG - Intronic
1104974908 12:132548080-132548102 TCACAGGGCCAAGGTCAGCAGGG - Intronic
1107348202 13:39486031-39486053 TCAGGGCCACAAAGTCTGCTGGG + Intronic
1111545790 13:89734287-89734309 TCAGAGCCACAGGCTCACTAAGG - Intergenic
1112574941 13:100627279-100627301 TCAGAGCCACGAGGCCGGCGCGG + Intronic
1119475308 14:74923384-74923406 TTAAAGCCGCAAGGTCTGCACGG + Intronic
1120707790 14:87762149-87762171 TCACTACCACAAGGACAGCATGG - Intergenic
1121730678 14:96185000-96185022 TCAGAGGCACAATGTCAACCGGG + Intergenic
1122269850 14:100564000-100564022 GCAGAACCACGAGGACAGCAAGG + Intronic
1122563089 14:102631108-102631130 TCAGAGACACAAAGTCATCGGGG - Intronic
1125448855 15:39786903-39786925 TCAGAGTCTCAAAGTCACCATGG - Intergenic
1125680749 15:41528742-41528764 GCAGAGCAGCAGGGTCAGCAGGG + Intronic
1126359703 15:47833792-47833814 TGAGAAGCAAAAGGTCAGCAGGG + Intergenic
1126381285 15:48049928-48049950 TCAGAGCCAGAAGAACAGGAAGG - Intergenic
1129276810 15:74450932-74450954 TCAGAGCAACCAGCTCAACAGGG + Intronic
1129420476 15:75421827-75421849 TCAGAGATACAAGGTTAGCTGGG + Intronic
1130163924 15:81433289-81433311 GCAGAGCCTCATGGTCAGCCAGG + Intergenic
1130644360 15:85710674-85710696 TCAGAACCAGAAAGTCAGAAAGG - Intronic
1130877172 15:88024558-88024580 ACAGAGCTACCAGGTCAGCCAGG + Intronic
1132662636 16:1068433-1068455 TCATAGCCACATGGACAGCAAGG - Intergenic
1132736267 16:1387664-1387686 TCAGAACCAAAAGCTCAGGATGG + Intronic
1133278501 16:4652067-4652089 ACAGAGCCACAGGGTCCCCAGGG - Intronic
1134198955 16:12181774-12181796 TCACAGCCACAAGGCCTACATGG - Intronic
1134613072 16:15626443-15626465 ATAGAGCCAGAAGGTGAGCAGGG + Intronic
1136187529 16:28596938-28596960 TTGGAGCCACAAGCTGAGCAGGG + Intronic
1136190002 16:28609872-28609894 TTAGAGCCACAAGCTGAGCAGGG + Intronic
1136316940 16:29460022-29460044 TTGGAGCCACAAGCTGAGCAGGG - Intronic
1136431515 16:30199364-30199386 TTGGAGCCACAAGCTGAGCAGGG - Intronic
1136486262 16:30573580-30573602 CCAGAGCCAGAATGACAGCAGGG - Intergenic
1140233995 16:73142205-73142227 CCAGAGGCACAAGGTCATCATGG - Intronic
1142053060 16:87972999-87973021 TGGAAGCCACAAGGTCAGCATGG - Intronic
1143343500 17:6232480-6232502 TCAGAGCCACCAGAACAGCAAGG - Intergenic
1143864937 17:9916966-9916988 TCAGAGCGGCAAGCACAGCATGG + Exonic
1147304977 17:39556872-39556894 TGAGAGCCAGGAGGGCAGCAGGG - Intronic
1147479945 17:40751023-40751045 TCGGAGCCACAACCTCAGCCCGG - Exonic
1148056952 17:44804803-44804825 GCAGAGCCTCCAGGTCAGCTGGG + Exonic
1148750043 17:49940409-49940431 TCAGAGCCACCAGCTGAGCCTGG - Intergenic
1150499951 17:65641237-65641259 TCAGAGTCACAGGGTCAGACTGG - Intronic
1151804624 17:76397756-76397778 CCATAGTCACAAGCTCAGCAGGG + Intronic
1153590223 18:6665966-6665988 TAAGAGCCACAAATTCAGAAAGG - Intergenic
1155843624 18:30677925-30677947 TCACTGCCACAAGAACAGCATGG - Intergenic
1156759509 18:40570481-40570503 TCCAACCAACAAGGTCAGCATGG - Intergenic
1157740413 18:50087919-50087941 TAAGAGCCACAAGAGCAGCAGGG + Intronic
1158063939 18:53381991-53382013 TGAGAGCCACTAGGTCAGAGAGG - Intronic
1158090822 18:53711021-53711043 TCAGAAACAGAAGGTCACCAGGG + Intergenic
1158441379 18:57477261-57477283 TCACAGCCACAACATCAGAATGG + Exonic
1159748597 18:72271598-72271620 CGAGGGCCACAAGGTCAGGAGGG - Intergenic
1160362421 18:78295242-78295264 TCAGAGTCATATGGTCATCAAGG - Intergenic
1161354478 19:3811195-3811217 TCAGAGGCACCAGGTCAACCCGG - Intronic
1161666715 19:5581575-5581597 TCAGAGCCACGAGGACAGGCAGG + Intergenic
1163709771 19:18839744-18839766 TCAGTCCCACAAGCACAGCAAGG - Intronic
1165320795 19:35084026-35084048 TCAAAGCCAATAGGTAAGCAAGG + Intergenic
925029927 2:642568-642590 TCAGAACCCCAAGATCAGCCTGG + Intergenic
925678061 2:6387078-6387100 TCAGAGACACAAGCTCAACTGGG - Intergenic
926147927 2:10408049-10408071 GCAGAGGCACAAGGTGTGCAGGG + Intronic
929778412 2:44942560-44942582 TGAGAACCACAAGTTCACCAAGG + Exonic
929911068 2:46089800-46089822 TAAGGGCCAAAAGGTCATCATGG - Intronic
929929176 2:46238863-46238885 TCACAATCACAAGATCAGCATGG - Intergenic
931786002 2:65620024-65620046 TGGGAGCCAAAGGGTCAGCATGG - Intergenic
933476926 2:82803156-82803178 CCAAAGCCCCAAGGTCAGAATGG - Intergenic
934567534 2:95348795-95348817 TCAGAGCCTCAGAGTCAGCCAGG + Intronic
934856554 2:97733520-97733542 TAAAGGCCACAGGGTCAGCAAGG - Intronic
935581043 2:104756052-104756074 TGTGGGCCACAGGGTCAGCAGGG - Intergenic
936075987 2:109402210-109402232 TCAGACGCACATGGCCAGCAAGG - Intronic
936125972 2:109789568-109789590 TCAGGCCCACAAGGTCACCTAGG - Intergenic
936218721 2:110581900-110581922 TCAGGCCCACAAGGTCACCTAGG + Intergenic
944371062 2:198984694-198984716 TCAGTGTCACAAGAACAGCAAGG + Intergenic
946119752 2:217499658-217499680 ACAGAGCCTCAAGGTCAACTAGG - Intronic
946735053 2:222745590-222745612 TGAGAGCCACAAGATAAGGAGGG + Intergenic
946765820 2:223039257-223039279 ACAGAGCCTTAAGGTCAGCCAGG - Intergenic
948335944 2:237207169-237207191 TGGGAGCCACATCGTCAGCACGG + Intergenic
949062860 2:241971340-241971362 TCACACCCACAAGGTCAACCAGG - Intergenic
1169111091 20:3034387-3034409 TCAGAACCATAAGGTCCCCATGG - Intronic
1169199072 20:3698945-3698967 TCCCAGCCTCAAGCTCAGCATGG - Intronic
1169859679 20:10137989-10138011 GCAGATCCACAAGCCCAGCAAGG - Intergenic
1170055072 20:12193102-12193124 GCAAAGCCTCAAGGTCAGCCAGG + Intergenic
1170465209 20:16616700-16616722 TCAGATCCACTATGTCAGCTAGG + Intergenic
1171174514 20:23041457-23041479 TCAGATCCATAAGGTCAAGAGGG - Intergenic
1171977637 20:31605639-31605661 CCAGAACCGCAAGGTGAGCAAGG + Exonic
1172245437 20:33442808-33442830 TCACAGGCAGAAGGCCAGCAAGG - Intronic
1173163000 20:40666114-40666136 CCAGATCCAAAAGGGCAGCAAGG + Intergenic
1173604876 20:44324757-44324779 TCTGGGGCACAGGGTCAGCAGGG + Intergenic
1175295405 20:57905087-57905109 TCAGAGCCCATAGCTCAGCAAGG - Intergenic
1175344717 20:58264632-58264654 CAAGAGCAACGAGGTCAGCAAGG + Intergenic
1175541275 20:59749493-59749515 TGAGAGCCACACTGTCAGCCTGG - Intronic
1175984669 20:62758690-62758712 TCAGAGCCCCAAGGCCACCCAGG + Intronic
1176000822 20:62830513-62830535 CCAGGGCCAGAAGGGCAGCATGG + Exonic
1176107489 20:63396259-63396281 TCAGAACCACCAGGTCACCAGGG - Intergenic
1176128366 20:63485992-63486014 TCAGAGCCACGAGGCCTCCAAGG - Intergenic
1179728507 21:43354164-43354186 TCAGAGCCAACAGGACAGCCTGG + Intergenic
1181038889 22:20182659-20182681 TCAGAGCCACAGGTTGAGAAGGG - Intergenic
1181443915 22:22953724-22953746 GCAGTGCCCCAGGGTCAGCAAGG + Intergenic
1181462401 22:23093557-23093579 TCACAGCGACAAGCACAGCAGGG + Intronic
1183806490 22:40215840-40215862 ACAGAGCCACCAGCTCAGCATGG + Intronic
1184190059 22:42888365-42888387 TCAGAGACACAAGGACAGCTGGG - Intronic
1184330248 22:43822562-43822584 TCAGAGCCAGGAGGACAGCAAGG + Intergenic
1185053664 22:48566828-48566850 GCAGAACCACAAGGGCTGCATGG - Intronic
1185345898 22:50310487-50310509 ACTGAGCCACAAGGACAGCGGGG - Exonic
949124246 3:426802-426824 TCATAGCCACAAGTTATGCATGG - Intergenic
949509391 3:4755033-4755055 TCAGAGCCACAGGGTCCTCCAGG + Intronic
949978405 3:9481836-9481858 TAATAGCCACAAGACCAGCATGG + Intergenic
951338137 3:21449988-21450010 TCAGAGCCAGAAGGCAAGCTGGG + Intronic
951481420 3:23166189-23166211 CCAGAGCCACATGATTAGCAGGG + Intergenic
952952608 3:38537211-38537233 GCACAGGCACAATGTCAGCATGG - Intronic
953034810 3:39202412-39202434 TCAGTGCCCCCAGGTCACCAGGG + Intergenic
953296787 3:41726725-41726747 TCAGAGCTACAAGGTGATCCAGG - Intronic
954576402 3:51678677-51678699 CCAGGGCCACTAGGTCTGCAGGG + Intronic
955863984 3:63362161-63362183 TCAGAGACACAGAGTGAGCATGG - Intronic
956358778 3:68423381-68423403 GCATAGCCAGAAGGTCAGCCTGG + Intronic
959385843 3:105705437-105705459 TCAGAGCCAAAAGGAGAGTAGGG - Intronic
959664621 3:108906646-108906668 TAAGAGCCAGAACATCAGCAAGG - Intergenic
960181533 3:114585933-114585955 GCAGAGCCAAAACGTCAGCAGGG + Intronic
961477020 3:127153327-127153349 TCAGAGTCACAACTCCAGCAAGG - Intergenic
961950558 3:130745629-130745651 TCATAGCCCCAAGCACAGCACGG - Intronic
962873765 3:139519971-139519993 TGAGAGCCACACAGTGAGCAAGG - Intronic
962953022 3:140237540-140237562 TCAGAGTCAGAAGTTCAGGAAGG - Intronic
963642107 3:147873609-147873631 TCATAGCCACAAGGGCTGCTTGG - Intergenic
963860847 3:150308714-150308736 TCAGTGGGGCAAGGTCAGCAAGG + Intergenic
965122240 3:164575700-164575722 TCCTAGCCACAAAGTCAGAATGG - Intergenic
966148475 3:176839626-176839648 TAAGAGCGTCAATGTCAGCAGGG + Intergenic
966327959 3:178778365-178778387 TCAAAGCCACATGGTCAATAAGG + Intronic
967208591 3:187146607-187146629 TCACTGCCACAAGAACAGCATGG + Intronic
969455133 4:7296144-7296166 CCACAGAAACAAGGTCAGCATGG - Intronic
969852972 4:9976694-9976716 TCAAAGCCAGAAGGTGGGCATGG + Intronic
974821221 4:67068654-67068676 TCAAAGTCACAAGGACAGAAAGG + Intergenic
975357945 4:73430361-73430383 GAAGTGCCTCAAGGTCAGCAAGG - Intergenic
977562312 4:98544967-98544989 TTCAAGCCACAAGGTCAGAATGG - Intronic
981334881 4:143559038-143559060 TCAGAGCGTCAAGGTGAGCCTGG - Intergenic
983917839 4:173311615-173311637 TCAGAGTCACAAGGACAGTGTGG + Intronic
983994404 4:174163629-174163651 TCAGAGGAACATGGTCATCATGG + Intergenic
984234857 4:177143123-177143145 TCAGTGCCACAAGAACAGTATGG - Intergenic
986071734 5:4291847-4291869 TCTGAGCCACAATGCAAGCAGGG + Intergenic
986710839 5:10486874-10486896 GCAGAGCCCCAAGGTCGGGAGGG + Intergenic
987532872 5:19143403-19143425 TCAGTGCCACATGAACAGCATGG + Intergenic
989057183 5:37377051-37377073 TCAGTGCCATAAGTTCACCATGG - Intergenic
990623250 5:57583059-57583081 ACAGAGCCTGAAGGTCAACAGGG - Intergenic
991091700 5:62699845-62699867 TCAGAGCCACAATCTAACCATGG - Intergenic
993430835 5:87830729-87830751 TCACTGTCACAAGGACAGCATGG + Intergenic
994081608 5:95713391-95713413 TCACTGTCACAAGATCAGCAAGG - Intergenic
994402390 5:99297702-99297724 TCAGTTCCACAAAGTCAGGAAGG - Intergenic
994695937 5:103073634-103073656 TCAGTACCACAAGAACAGCATGG - Intergenic
1003164047 6:3660839-3660861 GCAGGACCACAAGGTCTGCAAGG - Intergenic
1005984822 6:30864882-30864904 CCAGAGCCACTTGGTCAGCGGGG - Intergenic
1006719031 6:36138319-36138341 TCAGACCCACCAGGAGAGCAAGG + Intronic
1008509238 6:52260845-52260867 TGAGAGCCAAAAGGTTGGCAGGG - Intergenic
1010836321 6:80591328-80591350 TCGTTACCACAAGGTCAGCATGG + Intergenic
1011154559 6:84315483-84315505 TCATAACCACACAGTCAGCAGGG - Intergenic
1012029332 6:94037877-94037899 TCACTGCCACAAGAACAGCAAGG - Intergenic
1012823929 6:104124028-104124050 GCAGAGCCACAAGGACAGAGTGG + Intergenic
1013280863 6:108635818-108635840 ACAGAGGCAGTAGGTCAGCATGG - Intronic
1013958011 6:115862795-115862817 TCAGAGCCACATATTCAGGAAGG - Intergenic
1014656600 6:124113569-124113591 TCAGAGCTTCAAGGCTAGCAAGG + Intronic
1014777628 6:125528870-125528892 TCAGACCCACAGTGTCTGCAAGG - Intergenic
1016452018 6:144193161-144193183 TCAGTGTCACAAGAACAGCAAGG + Intergenic
1017111731 6:150939105-150939127 CCAGACCCGCAAGGCCAGCAGGG - Intronic
1017682415 6:156877558-156877580 TGAGGGTCACAAGTTCAGCAGGG - Intronic
1018389658 6:163332335-163332357 TCAGAGCCACCAGGTACCCAGGG - Intergenic
1018916172 6:168133918-168133940 TGAGAACCAGCAGGTCAGCAGGG - Intergenic
1019567955 7:1694032-1694054 TCAGGGCCACAGACTCAGCAGGG + Exonic
1021279374 7:18698545-18698567 TGAGAGCTCCAAGGTCAGGAAGG - Intronic
1021296886 7:18919144-18919166 TCAGAAACACAAAGTCAGAAGGG + Intronic
1023092507 7:36630162-36630184 CCAGAGCCAAAATGGCAGCAGGG - Intronic
1024228968 7:47349631-47349653 ACAGGCACACAAGGTCAGCAAGG + Intronic
1025849788 7:65236543-65236565 TCAGGGCATCAAGGTCAGCCTGG - Intergenic
1026104744 7:67411877-67411899 TCAGAGCCCCAAGTTCAGACAGG + Intergenic
1032695110 7:134329078-134329100 TCAGAGAGACAAGATAAGCATGG + Intergenic
1034078794 7:148257626-148257648 TGAGAGCCACAAGCCCATCAGGG - Intronic
1034809714 7:154120989-154121011 TCATTGCCACAAGAACAGCATGG - Intronic
1035783033 8:2243926-2243948 TCAGAACCAACAGGTGAGCAGGG - Intergenic
1035809094 8:2475660-2475682 TCAGAACCAACAGGTGAGCAGGG + Intergenic
1036679832 8:10863938-10863960 TCAGAGTCTCACGGTCAGCAAGG + Intergenic
1037758050 8:21724079-21724101 TCAGAGCCACAGAATCTGCAGGG + Intronic
1040314934 8:46255979-46256001 ACAGAGCCACAAGGTGACCTGGG + Intergenic
1040551642 8:48442348-48442370 TCAGAGCCACATCCACAGCATGG - Intergenic
1042648465 8:71013269-71013291 GCAGAGCCACAATCCCAGCAGGG + Intergenic
1043385829 8:79747227-79747249 TCACTACCACAAGGACAGCATGG + Intergenic
1047371113 8:124256873-124256895 TGAGACCCAGAAGGACAGCAAGG - Intergenic
1048180976 8:132193880-132193902 TCAGAGCCAGAGGGAGAGCAGGG + Intronic
1048807079 8:138250857-138250879 GCAGAGCCACCAGGGCAGCATGG + Exonic
1049587396 8:143438397-143438419 TCCCGGCCACAAGGTCTGCAGGG + Intronic
1050261275 9:3843126-3843148 TCTAAGCCACAAGATCAGTATGG - Intronic
1052569468 9:30201132-30201154 TCACATCCAGAAGGTCAGAAAGG + Intergenic
1053703955 9:40730870-40730892 TCAGTGTCACAAGAACAGCATGG + Intergenic
1054414038 9:64854479-64854501 TCAGTGTCACAAGAACAGCATGG + Intergenic
1054788174 9:69229666-69229688 TCAGAACCCCTAGTTCAGCAGGG + Intronic
1054860316 9:69945679-69945701 TCAGAGCAACAAAGTCTACATGG + Intergenic
1057302242 9:93893725-93893747 TCAGAACCACACGGTGAGGAAGG - Intergenic
1058366313 9:104213339-104213361 TCACAGCCACAAGAACAGCATGG + Intergenic
1058847201 9:108972767-108972789 TTAGAACCACATGATCAGCATGG + Exonic
1058909134 9:109505155-109505177 TCACAGCCACCAGGTCACCATGG + Intergenic
1059437328 9:114284593-114284615 TCAGAGCCACACAGCCAGCTGGG + Intronic
1060477249 9:123995961-123995983 TCAGAGCCACATGGGCAGGGTGG + Intergenic
1060544978 9:124454206-124454228 TCAGAGCTTCAAGGTCTCCATGG + Intronic
1060798240 9:126526927-126526949 TCACAGCCATAAAGTCAGCAAGG - Intergenic
1060813264 9:126622066-126622088 TTGGGGCCCCAAGGTCAGCAGGG - Intronic
1061178278 9:129010042-129010064 CCTGAACCACAAGGTCAGCAGGG - Intronic
1062317240 9:135973999-135974021 TCAGGGAGACAAGGCCAGCAGGG - Intergenic
1062358420 9:136176004-136176026 CCAGAGCCACAGGCTCAGCCGGG + Intergenic
1062718029 9:138020978-138021000 TCTGAGCCACTTGGTCAGCAGGG - Intronic
1185928381 X:4172419-4172441 TCATATCTACAAAGTCAGCAAGG - Intergenic
1186140160 X:6563471-6563493 TCACAATCACAAGGACAGCATGG + Intergenic
1186590400 X:10924642-10924664 TCAGAGCCAAAATGGCAGCCAGG + Intergenic
1187408295 X:19024307-19024329 TCAGAAGCACAAGGTCCCCAGGG - Intronic
1188592743 X:31859076-31859098 TCAGAGCCACAAGGTCAGCAGGG + Intronic
1189621680 X:42847192-42847214 GCAGAGCCTCAAGGTCAGCCAGG - Intergenic
1191115025 X:56843345-56843367 TCAGAAGCTCAAGGTCAGCTTGG - Intergenic
1192638805 X:72844764-72844786 TCAGAGTCAGAGGGGCAGCAGGG - Intronic
1192642907 X:72876044-72876066 TCAGAGTCAGAGGGGCAGCAGGG + Intronic
1194093572 X:89606815-89606837 TCACAGCCACATGGTCAGGGAGG - Intergenic
1195794069 X:108624250-108624272 TCAGGGCCAAAAGGTTATCAGGG + Exonic
1195992558 X:110696967-110696989 TCTGAGTTACAAGGTCAGAATGG - Intronic
1196460566 X:115924876-115924898 TCACAGTCACAAGAACAGCATGG - Intergenic
1197352674 X:125397601-125397623 TCAGGGGCAGAAGGTCAGGAGGG + Intergenic
1198190552 X:134299999-134300021 TCAGGGCAACAAGGTCACCCAGG - Intergenic
1199482383 X:148311769-148311791 TTAAAGCCACAAGATCATCAGGG - Intergenic
1200252454 X:154560836-154560858 TCCTAGCCACTAGGTCATCAGGG + Intronic
1200265313 X:154643580-154643602 TCCTAGCCACTAGGTCATCAGGG - Intergenic