ID: 1188593754

View in Genome Browser
Species Human (GRCh38)
Location X:31871464-31871486
Sequence AAACTGAGGCTCACAGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1051
Summary {0: 1, 1: 5, 2: 33, 3: 217, 4: 795}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188593754 Original CRISPR AAACTGAGGCTCACAGAGAG AGG Intronic
900396862 1:2456678-2456700 AAACTGAGGCCCAAGGAGGGCGG - Intronic
900471184 1:2855769-2855791 AAACCGAGGCTGGCAGAGGGAGG + Intergenic
900526978 1:3134209-3134231 ACACAGAGGCTCCCACAGAGAGG + Intronic
900704576 1:4072250-4072272 AGACTGAGGCTCAGAGAGGAGGG + Intergenic
900831948 1:4971778-4971800 AAACTGAGGCTCAGAGGGTCCGG + Intergenic
901400761 1:9013846-9013868 AACCTGAGGCCCAGAGAGGGAGG - Intronic
901782505 1:11603057-11603079 AAACTGAGGCCCAGAGAGCTTGG + Intergenic
901788537 1:11640903-11640925 AAACCGAGGCTCAGAGAGGTGGG - Intergenic
901872836 1:12148206-12148228 AAACTGAGGCTCGGGGAGTGGGG + Intergenic
901935741 1:12625480-12625502 AAACTGAGGCCCAGAGAGGACGG + Intergenic
902399612 1:16150807-16150829 AAACTGAGGCCCAGGGAGCGTGG - Intronic
902450515 1:16493989-16494011 AAACTGAGGCTCAGAGAGATTGG + Intergenic
902451301 1:16498684-16498706 AAACTGAGGCCCAGAGCGCGCGG - Intergenic
902466883 1:16624051-16624073 AAACTGTGGATCTCAGGGAGTGG + Intergenic
902502344 1:16919353-16919375 AAACTGAGGCTCAGAGACATTGG - Intronic
902507717 1:16948723-16948745 AAACTGTGGATCTCAGGGAGTGG - Intronic
902517521 1:16997330-16997352 ACACTGAGGCTCAGAGAGGACGG + Intronic
902541415 1:17158122-17158144 AAACTAAGGCTCAGAGAGCCTGG - Intergenic
902612486 1:17605327-17605349 CAACTGAGGCCCAGAGAGATTGG - Intronic
902620531 1:17648272-17648294 AAATTGAGGCTCAGAGAGTTGGG + Intronic
902642643 1:17776542-17776564 AGACTCAGCTTCACAGAGAGGGG - Intronic
902819651 1:18936206-18936228 AAACTGAGGCTGGCAGGGAGGGG - Intronic
902889958 1:19435687-19435709 AAACTGAGGTACGGAGAGAGTGG + Intronic
902921631 1:19669428-19669450 AAACTGAGGCTCAGAGCGAGAGG + Intronic
903008169 1:20312011-20312033 AAACTGAGGCCCAGAGGGAGCGG + Intronic
903267435 1:22166280-22166302 AAGCTGAGGCTCAGAGACAGGGG + Intergenic
903386814 1:22932416-22932438 AAACTGAGGCTCACAGAGATGGG + Intergenic
903643590 1:24876729-24876751 AAACTGAGGCCCAGAGAAGGCGG - Intergenic
903656429 1:24951342-24951364 AAATTGAGGCACAGAGAGAGAGG - Intronic
903733647 1:25516427-25516449 AAACTGAGGCTCAGAGAGGCAGG + Intergenic
904046913 1:27614689-27614711 AGACTGAGGCCCAGAAAGAGAGG + Intronic
904092435 1:27954723-27954745 ACCCTGAGGCTCATAAAGAGTGG + Intronic
904265713 1:29317614-29317636 AAACTGAGGTCCAGAGAGAAGGG - Intronic
904369080 1:30037307-30037329 AAATTGAGGCCCAAAGTGAGAGG + Intergenic
904372353 1:30057734-30057756 AAACTGAGGCTGGGAGAGAAGGG + Intergenic
904698293 1:32342853-32342875 ATACTGAGGCTCACTCAGAGAGG - Intergenic
904807952 1:33144988-33145010 AAACTGAGTCCCAGAGAGGGTGG + Intergenic
904826106 1:33274819-33274841 AAACTGAGGCTCAGAGAGAGGGG - Intronic
904879010 1:33680458-33680480 AAACACAGGATCCCAGAGAGAGG - Intronic
905453901 1:38074485-38074507 AAACTGAGGCTCATTGGGAAGGG + Intergenic
905651894 1:39662175-39662197 AAACTGAGGATCACAGAGGCTGG + Intronic
905732831 1:40308034-40308056 AAACTGAGGCACAGAAAGGGAGG + Intronic
905873883 1:41419933-41419955 AAAATGAGGCTCAGAGAGAGGGG + Intergenic
905946193 1:41903337-41903359 AAACTGAGGCACAGAGAGTCTGG - Intronic
906506100 1:46380807-46380829 AAATAGAGGCCCACAGAGAGGGG - Intergenic
906608644 1:47187653-47187675 CAACAGAGGCTCAGAGAGAAGGG + Intronic
906696208 1:47825031-47825053 AATCTCAGGCTCAGAGAGAGGGG + Intronic
906712361 1:47940442-47940464 AAACTGAGGCGCAGAGACAGAGG + Intronic
906729861 1:48071766-48071788 CAACTGTGGCTCAGAGTGAGAGG - Intergenic
906802815 1:48752241-48752263 GAACTGAGGCTGAAAGAGACAGG + Intronic
906807021 1:48789080-48789102 CAACTGAGGTTCAGAGAGGGAGG + Intronic
907130162 1:52090208-52090230 AAACTGAGGCTCAGAGAGCAAGG - Exonic
907194714 1:52677042-52677064 AAACTGAGGCTCAGCCAAAGTGG - Intergenic
907311274 1:53540459-53540481 ACACTGAGGCTCACAGGAAGAGG - Intronic
907485937 1:54778195-54778217 AAACTGAGGCCCAAAGAGCAGGG - Intergenic
907637106 1:56146302-56146324 AAACTGAAGCTCAAAGAGAGGGG + Intergenic
907659388 1:56378094-56378116 AAACTGAGGCCCAGAGAAACTGG - Intergenic
907860837 1:58351584-58351606 AAACTGAGACTCAGAGAGGCTGG - Intronic
907915386 1:58864045-58864067 AAACTTAGGCTCAGAGGTAGAGG + Intergenic
908527504 1:65002091-65002113 AAACTGAGGCTCAGAGTCTGCGG + Intergenic
909111547 1:71484794-71484816 AAACTGAGGCCCACAGAAGGTGG + Intronic
909341749 1:74539969-74539991 AAACTGAGGCTCAGAAAGGATGG + Intronic
909473267 1:76053537-76053559 AAACTGAGGCTCACAAGGGGTGG - Intergenic
910665861 1:89725496-89725518 AGACTGAGGCTCAGAGTCAGTGG - Intronic
910931212 1:92444236-92444258 GCACTAAGGCTCACAGAGACAGG - Intergenic
911478314 1:98402085-98402107 AAAGTGAGTTTCACACAGAGAGG + Intergenic
911553512 1:99314037-99314059 AAACTGAGGCACACAGTAGGTGG - Intergenic
911886900 1:103313281-103313303 AAACTGAGGCTCAGAAAGAGGGG + Intergenic
912322272 1:108725228-108725250 AAACTGAGGCTTATAGAGGTTGG - Intronic
913091711 1:115480605-115480627 AAACTGAGGCTCAGAGGGGCTGG - Intergenic
915013604 1:152712935-152712957 TAACTGAGGCCCACAGAGAAGGG - Intergenic
915355116 1:155251141-155251163 AAGCTGAGGGTCAAAGAGAGTGG + Exonic
916188477 1:162156302-162156324 AAACTGAGGCTCAGAGGGGTAGG + Intronic
916581602 1:166114275-166114297 AAACTGAGGCTCAGGGAAGGAGG + Intronic
917744525 1:177995056-177995078 AAACTGAAGCTCAGAGAAGGTGG + Intergenic
918068325 1:181116997-181117019 AAACTAAGGCCCAGAGAGAAAGG - Intergenic
918103697 1:181398476-181398498 AAACTGAGGCCCAGAGAGGTTGG + Intergenic
918195038 1:182213329-182213351 AAATTGAGGATGCCAGAGAGGGG + Intergenic
918443550 1:184593581-184593603 AAACTGAAGCTCAAAGACATAGG - Intronic
919834383 1:201563617-201563639 AAACTGAGGCTCAGAGAAGTGGG - Intergenic
920052988 1:203174694-203174716 AAAATGAGGCCCAGAGAGGGAGG - Intronic
920115284 1:203616410-203616432 AAAGTGAGGATGACATAGAGAGG - Intergenic
920138895 1:203793128-203793150 AAAAAGAGGCTTACAGAGAGCGG + Intergenic
921064727 1:211614635-211614657 AAACTGAGGCTCAGAGGGGCTGG + Intergenic
921218344 1:212955507-212955529 GAAGCGAGGCTCAGAGAGAGTGG + Intronic
921359277 1:214315545-214315567 AAACTTACGCTCAAAGAGTGAGG + Intronic
921807884 1:219476799-219476821 AAATTGAGGCTCAGAGAAAAGGG - Intergenic
922052498 1:222007277-222007299 AAACTGAGACTCACAGATGTGGG - Intergenic
922173540 1:223177439-223177461 AAACAGAAGCTCAGAGAGGGGGG + Intergenic
922235829 1:223721789-223721811 AAACTGAGGCTCAGAGGGGTTGG - Intronic
922331536 1:224581037-224581059 AAACTGAGAGCCACAGATAGAGG - Intronic
922758975 1:228112971-228112993 AAAATGATGGTAACAGAGAGTGG - Intergenic
923562812 1:235054468-235054490 AAACCGAGGCTCAGAGGGACAGG - Intergenic
923679382 1:236106951-236106973 AAACTGAGGCTGAGGGAGATGGG + Intergenic
924802658 1:247338763-247338785 AAACTGATGTTCAGAGAAAGAGG + Intergenic
1062769593 10:88258-88280 AAACTGAGGCTCAGAGACCTGGG + Intergenic
1063102274 10:2961164-2961186 AAAGAGAGGCTCAGAGAGAGAGG - Intergenic
1063379339 10:5574653-5574675 AAACCGAGGCTCACAGAAAGTGG + Intergenic
1064068114 10:12201117-12201139 AAACTGAGGCACAGAGGGAAGGG - Intronic
1064561291 10:16597502-16597524 AAACTGAGGCACGGAGAGGGAGG - Intronic
1064699333 10:18002381-18002403 AAACTCAGGACCACAGATAGGGG - Intronic
1064856802 10:19777667-19777689 AAACTGGGGCTCACCAAGAGGGG + Intronic
1065587388 10:27233094-27233116 AAACTGAGCATCACAGTGTGTGG + Intronic
1065807166 10:29404741-29404763 AAAATGATGGTAACAGAGAGGGG - Intergenic
1066449310 10:35513654-35513676 AAACTGAGGGGCAGAGAGGGAGG + Intronic
1067288664 10:44925609-44925631 AAACTGAGACTCAGAGAGATTGG + Intronic
1067567969 10:47351704-47351726 AACCCCAGGGTCACAGAGAGTGG - Intronic
1068596129 10:58904953-58904975 AAAATGAAGCTCCCAGAGGGAGG + Intergenic
1069049879 10:63781113-63781135 AAACTAAGGCTCAAAGAGGTAGG - Intergenic
1069820567 10:71225149-71225171 AAACTGAGGCTCAAAGAAGGTGG - Intronic
1069915868 10:71786377-71786399 AAACTGAGGCCCAGAAAGAGTGG - Intronic
1070305493 10:75236544-75236566 AAACTGAGGCTCAGAGAGACTGG - Intergenic
1070579307 10:77707793-77707815 AAACTCATGGACACAGAGAGTGG + Intergenic
1070679489 10:78438635-78438657 AAACTGAGGCCCACAGAATGTGG + Intergenic
1070802169 10:79250235-79250257 AAACTGAGGCTCAGACAGAAGGG - Intronic
1071312698 10:84358353-84358375 AAACTGAGACTTACTGAGAGAGG + Intronic
1071890481 10:90001146-90001168 AAACTGATGTTCAGAGAGAATGG + Intergenic
1073004030 10:100307813-100307835 CATCTGAGGCTCACATGGAGGGG + Intronic
1073074815 10:100817260-100817282 AAACTGAGGCTCAGAGAGAGGGG - Intronic
1073917598 10:108424723-108424745 AAACTGAGGCTCAGAGAAAATGG + Intergenic
1074019637 10:109568923-109568945 AAATTGAGGCTCATAGAGTAAGG + Intergenic
1074026713 10:109643250-109643272 AAACAGAGGCTCACAGAGGTTGG - Intergenic
1074084167 10:110194994-110195016 GAACTGGGGCTCACGCAGAGTGG - Intergenic
1074225816 10:111483361-111483383 AAACTGAGGCACATATAGATTGG + Intergenic
1074390949 10:113057733-113057755 AGACTGAGGCTCAGAGGGAAGGG + Intronic
1074745031 10:116523959-116523981 AAACTGAGGTTTAGAGAGATAGG + Intergenic
1075005051 10:118824093-118824115 AAACTGAGGCCCAGAGCGAGTGG - Intergenic
1075413292 10:122244695-122244717 AAACTCAGGCCCAGAGAGATTGG + Intronic
1075538086 10:123287891-123287913 AAAATGCTGATCACAGAGAGTGG - Intergenic
1075684103 10:124352055-124352077 AAACTGAGGCTCAGAGAGGTTGG - Intergenic
1076126181 10:127975900-127975922 GAACTGAGGCTCAGAGATATAGG - Intronic
1076319405 10:129566848-129566870 GAACAGAGGCTCTAAGAGAGGGG + Intronic
1077186441 11:1237413-1237435 ACCCAGAGGCTCACAGGGAGGGG + Intronic
1077543340 11:3157976-3157998 CCACGAAGGCTCACAGAGAGAGG - Intronic
1077895057 11:6447954-6447976 AGACTGAAGCTCACAGAAATAGG - Intergenic
1077942988 11:6863508-6863530 AAACTGATGCCCAAGGAGAGAGG - Intergenic
1078209467 11:9258761-9258783 AAACTGAGGCCCTGAGAAAGTGG - Intronic
1078431169 11:11289920-11289942 AGGCTGAGGCTCACAGGCAGAGG + Intronic
1078490451 11:11763133-11763155 AAACTGAGGCTCAGAGAGGCTGG + Intergenic
1078755026 11:14200996-14201018 AAACTGAGGCTCAGAGAGGTAGG - Intronic
1078856854 11:15212981-15213003 AAAATGAGGCTCATAGAAGGTGG + Intronic
1079104072 11:17559306-17559328 AAACTGAGGCTCAGAGTGGGAGG + Intronic
1079316187 11:19409764-19409786 AAACTGAGACTCACAGAGGGTGG + Intronic
1079318386 11:19429486-19429508 AAACTGAGGTTCAGAGAGACTGG - Intronic
1079535006 11:21503502-21503524 AAATTGAGGCTCACATAGATAGG - Intronic
1080394621 11:31878424-31878446 AAACTGAGACCCAGAGAGACTGG - Intronic
1080613368 11:33924838-33924860 AAACTGAGGCCCAGAGGGAGAGG + Intergenic
1080665270 11:34330332-34330354 AAACTGAGGGTCAGAGAGATTGG - Intronic
1080786954 11:35484243-35484265 AAACTGAGATTCACAAAGATTGG + Intronic
1081546496 11:44075614-44075636 ACAATGAGGCTCACAGTGCGGGG - Intronic
1081645916 11:44790756-44790778 AAGCTGAGGCTCAGAGGGAGAGG - Intronic
1081656629 11:44861740-44861762 AAAATGAGGCACTTAGAGAGAGG - Intronic
1082085559 11:48046767-48046789 AAACTTAGGCTCAGAGAGGCTGG + Intronic
1082086726 11:48056348-48056370 AATCTGACGCTCAGAGAGTGAGG - Intronic
1082772799 11:57221669-57221691 AAACTGAGGCCCAAAGAAGGAGG - Intergenic
1082788838 11:57333217-57333239 AAACTGAGTTCCACAGAGACAGG + Intronic
1083284728 11:61651111-61651133 AAACTGAGTCTCAGAGAGCCTGG - Intergenic
1083305883 11:61761767-61761789 AAACTGAGGCTCAGAAAGGATGG - Intronic
1083317331 11:61824558-61824580 AAACTGAAGGTCAGAGACAGAGG + Intronic
1083643523 11:64158614-64158636 AAACTGAGGCTTGGAGAGCGAGG + Intronic
1084014153 11:66368913-66368935 AAACTGAGGCCCACAGGGAGGGG - Intronic
1084107094 11:66987331-66987353 AGACAGAGGCTCAGAGGGAGGGG + Intergenic
1084118055 11:67053327-67053349 AAACTGAGGCCCAAAGAGGTTGG - Intergenic
1084314962 11:68340299-68340321 AAACTGAGGCTCTGGGAGATGGG + Intronic
1084385830 11:68842092-68842114 AAACTGAGGCTCGGAGGGTGAGG - Intronic
1084428078 11:69096460-69096482 AAACTGAGGATCAAAGAAGGTGG + Intergenic
1084589471 11:70082074-70082096 AAACTGAGGCTCCCAGTTGGGGG + Intronic
1084900556 11:72306991-72307013 AAACTGAGGCACAAAGAGGTGGG + Intronic
1085259492 11:75196058-75196080 AAACTGAGGCCCAGAGAGGCAGG + Intronic
1085295423 11:75428967-75428989 AAACTGAGGCTCACATACCATGG + Intronic
1085304726 11:75478861-75478883 AAACTGAGGCTCAGAGAACAAGG + Intronic
1085351355 11:75800000-75800022 AAACTGAGGGTCAGAGAGGCAGG + Intronic
1085395286 11:76203972-76203994 AGACTGGGGCACACAGAGATGGG - Intronic
1085448533 11:76617005-76617027 AAACTGAGGCTCAGAGAGGCTGG + Intergenic
1085483121 11:76838943-76838965 AGACTGAGGGACAGAGAGAGAGG + Intergenic
1085751544 11:79166627-79166649 AAACTGAGGCACAGAGAGAATGG + Intronic
1086030599 11:82350580-82350602 AAACTGAGGCCCAGAGAGGGGGG + Intergenic
1086651724 11:89299664-89299686 AAACTGGGGCACACAGAGGTAGG - Intergenic
1086920655 11:92582575-92582597 AAACTGAGGCTCAGAGGCATTGG + Intronic
1087145315 11:94804985-94805007 AAACTTAGGCTTAGAGAGGGAGG + Intronic
1087304365 11:96471797-96471819 AAACTGAGTCTCACAGTAACGGG - Intronic
1087335339 11:96837077-96837099 AAACTGAAGTTCACAGAGATTGG - Intergenic
1087772375 11:102224823-102224845 AAACTGAGGCTAATTAAGAGAGG + Intronic
1088618658 11:111659914-111659936 AAGCTGAGGCTGGCAGAGTGAGG - Intronic
1088743584 11:112786373-112786395 AAGCTGAGGCTCAGAGAAGGTGG - Intergenic
1089061680 11:115630968-115630990 AAACTGAGGCTCAGAAAGACTGG + Intergenic
1089100303 11:115957552-115957574 AAACTGAGGTCCACAGGGATGGG + Intergenic
1089418726 11:118315296-118315318 AAGCTGAGGCTCACGGAAGGAGG + Intronic
1089616660 11:119698646-119698668 AAACTGAGGCTCACAGGGTAAGG - Intronic
1089628566 11:119769294-119769316 AAGCTGAGGCTTCGAGAGAGAGG + Intergenic
1089651915 11:119920173-119920195 AAACTGAGGCCCAGGGAGATGGG + Intergenic
1089686051 11:120147458-120147480 AAGCTGAGACGCACAGAGGGTGG - Intronic
1089730187 11:120514380-120514402 AAACTGAGGCTCAGAGAGGCTGG + Intronic
1089747809 11:120629281-120629303 AAACTGAAGCTCACATAGGAAGG - Intronic
1089783134 11:120888338-120888360 AAACTGAGGCTCTGAGAGGTTGG - Intronic
1089978901 11:122756324-122756346 AAGCTGAGGCTTAAAGAAAGAGG - Intronic
1090368872 11:126232332-126232354 AAACTGAGGCACAGAAAGATCGG - Intronic
1091236764 11:134027209-134027231 TAGCTGAGGCTCACAGGCAGAGG - Intergenic
1091306513 11:134539720-134539742 AAGCTGAGGGTCAGAGAGGGTGG + Intergenic
1091352492 11:134908210-134908232 AAACTGAGGCTCAGAGAGATTGG - Intergenic
1091613833 12:2034173-2034195 AAACTGAGGCTTGAAGAGAGCGG + Intronic
1091642137 12:2245484-2245506 CAACTGAGGCTCAGAGCGGGTGG + Intronic
1091774633 12:3176329-3176351 AAACTGAGCGTCCAAGAGAGGGG + Intronic
1091883456 12:3998614-3998636 AACCTGAGGCTCAGGGAGAAGGG - Intergenic
1091960617 12:4691124-4691146 AAACTGAGGCTGACAAAGAGAGG - Exonic
1092097001 12:5850981-5851003 CAACTGAGGCTCTGAGAGATGGG + Intronic
1092260973 12:6953208-6953230 CATGTGAGGCTCACAGAGAGAGG - Intronic
1092335012 12:7624672-7624694 TAACTGTGACTCACAGGGAGAGG + Intergenic
1092785058 12:12019022-12019044 GAACTGAGGCTCAGAGAGCCTGG + Intergenic
1094399119 12:30042067-30042089 AACCTGAGGAACACATAGAGTGG - Intergenic
1095086544 12:38062477-38062499 AAACTGTGGTTAACAGAGACAGG + Intergenic
1096413877 12:51396049-51396071 AAATTGAGGCACACAGAAATGGG - Intronic
1096470366 12:51871788-51871810 AAACTGAGGCTCAGAGGCAGAGG - Intergenic
1096477733 12:51918659-51918681 AAACTGATGCTCAGAGAAGGGGG - Intronic
1096729822 12:53600240-53600262 AAATTGAGGTTCACAATGAGTGG + Intronic
1096982195 12:55734756-55734778 AAGCTGAGGCTCAGGGAGAGAGG - Intergenic
1097711678 12:62924197-62924219 AAACTGAGGCCCAGAGTGGGGGG + Intronic
1098033068 12:66274016-66274038 AAACTGAGGCTTTCAGAGGTTGG + Intergenic
1099046847 12:77731549-77731571 AAACTAAGACTAAGAGAGAGAGG + Intergenic
1100284114 12:93148469-93148491 GCACTGAGGCACACACAGAGGGG + Intergenic
1100362529 12:93891705-93891727 AAACTGAGGCTCAGAGAGGTTGG + Intronic
1100364727 12:93909535-93909557 AAACTGAGGTTCAGAGAGAGAGG - Intergenic
1100539518 12:95544394-95544416 AAACTGAGGTTGAAAGAGAGTGG - Intronic
1100545170 12:95595019-95595041 AAACTGTGGCTCAGAGGGGGAGG + Intergenic
1100812641 12:98354598-98354620 AAACTAAGGCCCAGAGAGACTGG + Intergenic
1101308031 12:103549945-103549967 AAACTGAGACTCAAAGAGTGTGG - Intergenic
1101655816 12:106719224-106719246 AAACTGAGGGGCAGAGAGACTGG + Intronic
1101926119 12:108972693-108972715 GAACTGAGACTCAGAGAGAGAGG + Intronic
1102008393 12:109603153-109603175 ACACTCAGGCTCACAGAGCAGGG + Intergenic
1102023049 12:109697111-109697133 AAATTGAGGCTTAGAGAGGGAGG - Intergenic
1102028065 12:109724669-109724691 AAACTGAGGCACAGAGAGGGAGG - Intronic
1102030285 12:109736404-109736426 AAACTAAGGCTCAGAGAGGAGGG + Intronic
1102038606 12:109786522-109786544 AAACTGAGGCTGAGAGAGGTGGG + Intronic
1102047099 12:109836099-109836121 AAACTGAGGCACAGAGAGAGAGG - Intergenic
1102182003 12:110919906-110919928 CAACTGAGGCTCAGAGAGGTTGG + Intronic
1102211517 12:111130777-111130799 AAAAGGTGGCTCACAGTGAGGGG - Intronic
1102226876 12:111235024-111235046 AAACTGAGGGTCAGAAAGAGAGG - Intronic
1102227631 12:111240248-111240270 AAACTGGGCCTCCCAGAGGGTGG + Intronic
1102397586 12:112600505-112600527 AAACAGTGGCTCAGAGAGAGAGG - Intronic
1102527293 12:113520946-113520968 AAACCGAGGCTCACAGAACGAGG + Intergenic
1102549620 12:113682350-113682372 AAACTGAGGCTCAGAGAGTTTGG + Intergenic
1102587652 12:113934336-113934358 AAACTGAGCCTCAGAGAGGCAGG + Intronic
1102657167 12:114491802-114491824 AAACTGAGGCTCAGAAAGAAGGG + Intergenic
1102663202 12:114547522-114547544 AAACTGGGACCCACAGACAGTGG + Intergenic
1102798272 12:115708529-115708551 AAACTGAGGCTCAGAGAGGTAGG + Intergenic
1102874066 12:116436175-116436197 AAACTGAGGCACAGAGAGACTGG + Intergenic
1102956388 12:117061722-117061744 AAACTGAGGCTCCAAGAGTCAGG - Intronic
1103031981 12:117623070-117623092 AAAATGAGGCTCAAAGAGGTGGG - Intronic
1103176240 12:118865806-118865828 ACAGTGAGGCTCAGAGAGACAGG - Intergenic
1103198227 12:119065106-119065128 AAATTGAGGCTCACAGAAGTAGG + Intronic
1103222371 12:119256537-119256559 AAACTGAGACTCAGAAAGATTGG + Intergenic
1103486530 12:121286747-121286769 AAACTGAGGCACAGAGAGCCTGG + Intronic
1103719183 12:122964395-122964417 AAACTGAGGCCCACAGAGGGAGG + Intronic
1103800076 12:123532486-123532508 AAACCGAGGGTCACAGTGGGAGG - Intronic
1103858668 12:123993603-123993625 TACCTGAGGCTCATGGAGAGTGG + Intronic
1103888723 12:124222554-124222576 AAACTGAGGCACAAAGAGTGAGG + Intronic
1103920091 12:124394882-124394904 AAACTGAGGCACAGAGAGGTTGG + Intronic
1103984159 12:124755931-124755953 AAACTGAGGCTCAGAGTGGGTGG + Intergenic
1104401962 12:128483530-128483552 ATACTGAGGCACAGAGAGGGAGG - Intronic
1104575065 12:129959127-129959149 AGACTGATGTGCACAGAGAGGGG - Intergenic
1104665202 12:130642887-130642909 ACACTGCCGCTCACTGAGAGAGG + Intronic
1104727744 12:131088192-131088214 AAACTGAGCCCCAGAGAGAGGGG + Intronic
1104843009 12:131833637-131833659 AAACTAAGGCTCAGAGAGTGTGG - Intronic
1105210290 13:18253345-18253367 ACACTGAGGCCCAGAGAGTGGGG + Intergenic
1105621787 13:22074754-22074776 AAACTGAGTCCCACAGAGGTGGG + Intergenic
1106016134 13:25870604-25870626 AAACTGAGGCTTAGAGAGAAAGG + Intronic
1106486267 13:30175277-30175299 AAACTGAGGCTCACACAGGCTGG - Intergenic
1107836399 13:44415429-44415451 AAACTCAGGCTTAGAGAGTGCGG + Intergenic
1108106458 13:47015801-47015823 ATAATGAGGCTCACAGAGGTTGG - Intergenic
1108450936 13:50562253-50562275 AAACTGAGGCTTAAAGAATGAGG + Intronic
1108682563 13:52792181-52792203 AAACTGAGGCTCACAATGGTGGG - Intergenic
1109438720 13:62341335-62341357 TCACGGAGTCTCACAGAGAGAGG - Intergenic
1109765827 13:66895870-66895892 AAAATGATGCACAAAGAGAGGGG - Intronic
1110543353 13:76729670-76729692 AAACTGAAGCTTAGAGAGACTGG + Intergenic
1111661943 13:91222683-91222705 AAACTGAGCCCCACAGAATGTGG - Intergenic
1112202764 13:97292680-97292702 GACCTGGGGCTCACCGAGAGAGG - Intronic
1113411369 13:110093287-110093309 CCACAGAGGCTCTCAGAGAGAGG - Intergenic
1113793683 13:113044394-113044416 TTAATGATGCTCACAGAGAGCGG + Intronic
1114409343 14:22486105-22486127 AAACTGAGCCTCACAGACCCAGG + Intergenic
1115665606 14:35541907-35541929 TAACTGAGGAGCAGAGAGAGAGG + Intronic
1115760629 14:36577362-36577384 AAACTGAGGCTCAATGGGTGGGG - Intergenic
1116000084 14:39233412-39233434 AAACTGAGGCACAGAGAGATGGG - Intronic
1116269363 14:42741718-42741740 CAGCTGAGGCTCACTGAGAGAGG + Intergenic
1117411214 14:55452993-55453015 AAACTGAGTTGCACAGAGAATGG - Intronic
1117884689 14:60348300-60348322 TCACAGAGGCTCAGAGAGAGGGG - Intergenic
1118333180 14:64830072-64830094 AGACTGAGGCTAACAGAGCGGGG - Intronic
1118648747 14:67867678-67867700 AAACTGGGGCTCTCATAGCGAGG + Intronic
1118837800 14:69488839-69488861 AAACTGAGGCACAGAGGCAGGGG + Intronic
1118915256 14:70097527-70097549 AAACTGAGGCACAGAGAGGTTGG - Intronic
1119151860 14:72367827-72367849 AAACTGAGGCCCAAAGAGGTTGG - Intronic
1119153898 14:72390777-72390799 AAATGGAGGCTCAGAGAGATTGG + Intronic
1119567570 14:75641537-75641559 AAACTGAGGTTCCCAGAGGTTGG - Intronic
1119657615 14:76428619-76428641 GAGCTCAGGCTCACGGAGAGTGG - Intronic
1119870293 14:78011355-78011377 AAACTGATACACAGAGAGAGTGG - Intergenic
1119894300 14:78206764-78206786 AAACTGTGGCTCAAAGTGGGTGG + Intergenic
1120043396 14:79778959-79778981 AGACTGAGGTTCACAGAGCTTGG - Intronic
1120969116 14:90192647-90192669 AAACTGAAGCTCAGAGAGCAGGG - Intergenic
1121235100 14:92386308-92386330 AAACTGAGGCACAGAGAATGTGG - Intronic
1121268087 14:92617406-92617428 AAAATGATGGTAACAGAGAGTGG - Intronic
1121326160 14:93020777-93020799 AAACTGAGGTTCCTAGAGGGCGG - Intronic
1121424791 14:93842436-93842458 AAACTGAACCCCGCAGAGAGGGG + Intergenic
1121571739 14:94951520-94951542 AAACTGAGGCCTACAGAGGGGGG - Intergenic
1121660043 14:95627980-95628002 AAACTGAGGCCCAGAGAGGGTGG - Intergenic
1121898212 14:97668605-97668627 ACACTGAGGCTCAGAGAGACGGG - Intergenic
1122037263 14:98957802-98957824 AAGCTTAGGCCCACAGAGGGCGG + Intergenic
1122089264 14:99327483-99327505 AAACTGAGGCTCAGAGAGGAAGG + Intergenic
1122139156 14:99652128-99652150 AGACTGAGGCTCTGAGAGATGGG + Intronic
1122283098 14:100635885-100635907 AAACTGAGGACCAGAGAGGGAGG + Intergenic
1122334975 14:100967691-100967713 ATCCTGAGGCTCACAGAGGACGG - Intergenic
1122421278 14:101579083-101579105 GAAGTGAGGCTCACAGGCAGTGG - Intergenic
1122549923 14:102544383-102544405 AAACTAAGGCTCAAAGAGGTTGG - Intergenic
1122627575 14:103092070-103092092 AAACTGGGGCTCAGAGATTGAGG + Intergenic
1122631335 14:103109045-103109067 AGGCTGTGGCTCAGAGAGAGTGG + Intronic
1202841691 14_GL000009v2_random:126750-126772 AGACTGGGGCCCACAAAGAGAGG - Intergenic
1202911079 14_GL000194v1_random:116982-117004 AGACTGGGGCCCACAAAGAGAGG - Intergenic
1202881539 14_KI270722v1_random:65680-65702 AGACTGCGGCCCACAAAGAGAGG + Intergenic
1125287848 15:38113029-38113051 AAATTGAGTCTCACAGAGGGAGG + Intergenic
1125541891 15:40474451-40474473 AAACAGAGGCTCTGAGAGATAGG - Exonic
1125754819 15:42056423-42056445 AAACTAAGGCTCAGAAAGACTGG - Intergenic
1125811586 15:42546874-42546896 AAACTGAGGTTCTCAGAGTCGGG - Intronic
1126395914 15:48217386-48217408 AAATTGAGGCTAACATAGTGGGG - Intronic
1126583343 15:50260711-50260733 GAACTGGGGCTGACAGAGAGAGG + Intronic
1126864178 15:52919763-52919785 AAACTGGGGCTTATAGAGGGTGG + Intergenic
1127467617 15:59259513-59259535 AAAATGAGGGTAACTGAGAGGGG - Intronic
1127958190 15:63871232-63871254 AAACTGAGGCACAGAGAGGTGGG + Intergenic
1127995180 15:64149852-64149874 AAATGGAGACTCACAGACAGAGG + Intergenic
1128228639 15:66019715-66019737 AAACAGAGGCTCAGCGAGTGAGG - Intronic
1128456306 15:67833513-67833535 AAACTGAGGCACAGTAAGAGAGG - Intronic
1128880627 15:71239390-71239412 AAACTGAGGCATACAAAGATTGG + Intronic
1128932620 15:71718829-71718851 ATGCAGAGGCTCTCAGAGAGCGG - Intronic
1129153989 15:73706322-73706344 AAACTGAGGTCCACAGAGAAGGG + Intronic
1129228137 15:74181645-74181667 AAACTGAGGCCCAGAGAGATTGG + Intronic
1129248716 15:74296315-74296337 AAACTGGGGCTCAAAAAAAGAGG + Intronic
1129467601 15:75732608-75732630 CAATTGAGGCTCAGAGAGGGTGG + Intergenic
1129550888 15:76447933-76447955 GAGCTGAGTCTCACAGAAAGAGG + Intronic
1129719613 15:77870981-77871003 CAATTGAGGCTCAGAGAGGGTGG - Intergenic
1130130533 15:81137801-81137823 AACCAGAGGCTCACAAAGTGGGG + Intronic
1130895774 15:88169477-88169499 CAAATGAGGCACACAGGGAGGGG + Intronic
1130923368 15:88367215-88367237 AAACTGAGGCTCAGGGGGTGGGG + Intergenic
1131047889 15:89327517-89327539 GAACTGAGGCTCCGAGAGATGGG - Intronic
1131227720 15:90639133-90639155 AAACTGAGGCATAGGGAGAGTGG + Intronic
1131399336 15:92112062-92112084 GAACTGAGGACCAGAGAGAGGGG + Intronic
1131798105 15:96041284-96041306 ACACTGGGCCTCTCAGAGAGTGG + Intergenic
1131845357 15:96485200-96485222 AGACTGAGGCTTAGAGAGATAGG - Intergenic
1131863117 15:96675807-96675829 AAACTGTGCCTGACACAGAGTGG - Intergenic
1132249544 15:100324900-100324922 AAACTGAAGCTCAGAGAGGGTGG + Intronic
1132302980 15:100787907-100787929 CAACTGAGGCTCACTGGGTGAGG - Intergenic
1132386181 15:101401624-101401646 AGACTGAGGCTCAGCGAGACGGG - Intronic
1132530434 16:445634-445656 AATCTCAGGCCCACAGAGACTGG + Intronic
1132718853 16:1306169-1306191 AAACTGAGGCTTGGAGAGGGTGG - Intergenic
1133209673 16:4256640-4256662 AAATTGAGGCTCAGAGGAAGCGG + Intergenic
1133279259 16:4655834-4655856 AAACTGAGGCTCAGACAGAGGGG + Intronic
1133366961 16:5217739-5217761 AATCTGAGGATCCCAGAGAAGGG - Intergenic
1133460502 16:5982975-5982997 AAACTGAGGCAGAGAGGGAGTGG - Intergenic
1134134881 16:11671498-11671520 AAACTGAGGCGCACGCAGGGAGG - Intronic
1135115343 16:19718639-19718661 AAACTGAGGCTCGGAGAGGCTGG + Intronic
1135157115 16:20061944-20061966 AAACTGAGGCTTAGAGGGAAAGG - Intronic
1135467462 16:22699448-22699470 AAACTGAGGCACAGAGAAGGCGG - Intergenic
1135537142 16:23302902-23302924 AAACTGAGGGTCAGAGGGTGGGG + Intronic
1135551589 16:23402594-23402616 AAACGGAGGCTCACGGAGGAAGG + Intronic
1135632670 16:24048287-24048309 AAACTGAGACACAGAGAAAGAGG + Intronic
1135979004 16:27132065-27132087 AAACGGAGGCACAAAGAGAGAGG + Intergenic
1136277689 16:29188571-29188593 GAGCTGAGGCTCAGAGAGAAGGG + Intergenic
1136519773 16:30787720-30787742 AAACTGAGGCTCACGGTGGCAGG + Intergenic
1136536301 16:30901982-30902004 AAACTGACACCCCCAGAGAGCGG + Intronic
1137735184 16:50718653-50718675 AAACGGAGGCACACAGACATTGG - Intronic
1137753955 16:50886909-50886931 AAACTGAGGCACAGAGAGACAGG + Intergenic
1137887104 16:52117612-52117634 AAACTAAGGCCCAAAGAAAGTGG + Intergenic
1138342898 16:56302356-56302378 AAACTGAGGCACAGAGAGGCGGG - Intronic
1138487651 16:57357135-57357157 AAACTGAGGTTCAGAGAGAGAGG - Intergenic
1138656440 16:58494332-58494354 AAGCTGAGGCCCACACAGTGAGG - Intronic
1138850792 16:60627241-60627263 AAATTGAGGCTCACCCAGGGGGG + Intergenic
1138909468 16:61379005-61379027 AAACAGAGGAAGACAGAGAGGGG - Intergenic
1139789907 16:69425156-69425178 AAACTGAGGCTCACAGGTTGAGG + Intronic
1140107513 16:71974269-71974291 AAGCTGAGGCCCAGAGAGACTGG - Intronic
1140244642 16:73237094-73237116 GTACTCAGGCTCACAGAGAGAGG + Intergenic
1140509721 16:75498433-75498455 AAACTGAGGCACACACTGAGGGG + Intergenic
1140515515 16:75538641-75538663 AAACTGAGGCACACACTGAGGGG + Exonic
1140755431 16:78062169-78062191 AAACTGAAGATCACAAAAAGAGG - Intronic
1140836395 16:78798078-78798100 AAGCTGAGGTTCAGAGAGATGGG + Intronic
1141035619 16:80622972-80622994 AAACTGAGGCTCAGAGAGAAAGG + Intronic
1141300985 16:82815323-82815345 AAACTGAGGCAGAGAGTGAGAGG - Intronic
1141305630 16:82860921-82860943 AAACTGAGAATGAGAGAGAGGGG - Intronic
1141426777 16:83949383-83949405 AAACTGAGGCAGAGAGAGACAGG - Exonic
1141511277 16:84513863-84513885 AAACAGCTGCTCACCGAGAGTGG + Intronic
1141565071 16:84895905-84895927 AAACTGAGGCTCAGAGAAAAGGG + Intronic
1141629859 16:85281452-85281474 AAACCGAGGCCCACAGGGATGGG + Intergenic
1141710915 16:85698512-85698534 AAACTGAGGCTCAGAGAGGTTGG + Intronic
1141762051 16:86035047-86035069 AAACTGAGGCTATCAGAGGCTGG - Intergenic
1141854378 16:86671039-86671061 AAACTGAGGCTCAGACAGTGAGG - Intergenic
1141991592 16:87614027-87614049 AAACTGAGGCCCACCAAGGGAGG + Intronic
1142082064 16:88154613-88154635 GAGCTGAGGCTCAGAGAGAAGGG + Intergenic
1142114691 16:88350493-88350515 AAACTGAGGCTCTGAGAGGGAGG - Intergenic
1142125115 16:88406342-88406364 AAACTGAGGCACACATACACAGG - Intergenic
1142323308 16:89399016-89399038 AAACTGCGTCTCACAGAGCATGG - Intronic
1143277085 17:5719944-5719966 AAACTGAGGCTCAGACAGGTTGG + Intergenic
1143774520 17:9189229-9189251 AAACTGAGGCACAGAGAGATGGG + Intronic
1143832230 17:9661706-9661728 AGAGTGAGACTCAGAGAGAGAGG + Intronic
1144415403 17:15041714-15041736 AAACTGAGGCCCAGAGAGGCTGG - Intergenic
1145010147 17:19363295-19363317 AAACTGAGGCCCGCAGCGGGCGG + Intronic
1145249966 17:21291935-21291957 AAACCGAGGCTTGCACAGAGAGG + Intronic
1145297895 17:21608791-21608813 AAGCTGATGCTCAGAGAAAGGGG + Intergenic
1145352363 17:22094608-22094630 AAGCTGATGCTCAGAGAAAGGGG - Intergenic
1146259614 17:31412888-31412910 AAACTGAGGCTCAGAGAGGTCGG + Intronic
1146570017 17:33944448-33944470 AGACTGGTGCTCACAGGGAGAGG + Intronic
1147876992 17:43628731-43628753 AAACTGAGGCCCAGAGAGAAGGG - Intergenic
1148166361 17:45486596-45486618 AAACTGAAGCTAAGAGAGACAGG + Intronic
1148383064 17:47214075-47214097 AAACTGAGACACATAGAGATTGG + Intronic
1149165178 17:53742636-53742658 AAACTGAGGATTAGAGAGAATGG - Intergenic
1149605214 17:57919747-57919769 AAACTGAGGCTCAAGGAGGCTGG - Intronic
1149774190 17:59344350-59344372 AGATTGAGGCTCAAACAGAGAGG + Intronic
1150009868 17:61493639-61493661 AAAAGGAGGCTCAGAGAGAGGGG - Intergenic
1150397532 17:64832996-64833018 AAACTGAAGCTAAGAGAGACAGG + Intergenic
1150639026 17:66937282-66937304 AAGCTGAGCCTCACAGGGACTGG - Intergenic
1151355200 17:73554007-73554029 GCCCTGAGGCTCACAGGGAGAGG + Intronic
1151930646 17:77229669-77229691 AAACTGAGGCTCAGAGGGGTTGG + Intergenic
1151971572 17:77460161-77460183 AAACTGACGCACGCACAGAGAGG - Intronic
1152468395 17:80477839-80477861 AAACTGAGGCTCCGAGACTGCGG + Intronic
1152477562 17:80528053-80528075 AAACTGAGGCTCAGAGAGAAAGG + Intergenic
1152562138 17:81083876-81083898 AAAGAGAGGGGCACAGAGAGAGG - Intronic
1152962655 18:89052-89074 AAACTGAGGCTCAGAGACCTGGG + Intergenic
1154114724 18:11602832-11602854 GAACTCAGGCACACAAAGAGGGG + Intergenic
1154185086 18:12175806-12175828 AAACTTAGGCACACATAGTGAGG + Intergenic
1154500576 18:14994761-14994783 AAACTGAAGTTCAAAGAGATGGG - Intergenic
1155416742 18:25606698-25606720 AAACTGAGGCCCAAAAAGGGAGG + Intergenic
1155504510 18:26520187-26520209 AAACTGAGGCTCAGGGTGACTGG + Intronic
1155745303 18:29349291-29349313 AAACTGAGGCTCAGAGAAGAGGG + Intergenic
1156262905 18:35461204-35461226 AAACTGAGGTCCCCAAAGAGAGG - Intronic
1157883716 18:51346132-51346154 AAACGGAGGCTTGCAGTGAGCGG + Intergenic
1158256176 18:55551425-55551447 AAACTGAGACTCAGAGAGGTAGG + Intronic
1158509672 18:58079516-58079538 AAACTGAGCCTCAGAGAGGTTGG + Intronic
1159044241 18:63353700-63353722 AAACTGATGCTAAGAGAAAGAGG + Intronic
1159529559 18:69638260-69638282 AAACTGTGGCTCACAGCCTGTGG - Intronic
1159761508 18:72432010-72432032 AAAGTGAGACTCAGAGAGAGAGG + Intergenic
1159888470 18:73933070-73933092 AAACTGAGGCTGCGAGAGATGGG + Intergenic
1160614331 18:80112665-80112687 AAAATGAGGCTCTCAGAGATTGG - Intronic
1160789814 19:918227-918249 AAACTGAGGCTCAGAGGGTCAGG + Intronic
1160877259 19:1302503-1302525 AAACTGAGGCACAGAGAGGCTGG + Intergenic
1160878714 19:1309954-1309976 AAACTGAGGCTCAGAGAACAGGG - Intergenic
1160907914 19:1460453-1460475 AGACTGAGGCCCAGAGAGTGCGG + Intronic
1161143929 19:2665672-2665694 AAACTGAGGCACAGCGACAGTGG - Intronic
1161200258 19:3010667-3010689 AAACTGAGGCTCAGAGAGGTTGG + Intronic
1161231778 19:3178247-3178269 AAACTGAGGCCCAGAGAGCCCGG - Intronic
1161261796 19:3341849-3341871 AAACTGAGGCTGAGAGAGGAAGG - Intergenic
1161304977 19:3562283-3562305 AAACTGAGTTTCACAAAGACGGG + Intronic
1161455528 19:4367966-4367988 AAATGGAGGCTCCCAGAGGGAGG + Intronic
1161532782 19:4800258-4800280 AGAAACAGGCTCACAGAGAGGGG + Exonic
1161668870 19:5593371-5593393 AAAACTAGGCTCACGGAGAGCGG + Intronic
1161672509 19:5622186-5622208 AAACTGAGGCACAGAGAGAAAGG + Intronic
1161768553 19:6219547-6219569 AAACTGAGGCTGACATAGGACGG - Intronic
1161845087 19:6707653-6707675 AAACTGAGGCTCAGAGGGGAGGG + Intronic
1162525701 19:11204963-11204985 AAAGTGAGTCTCAGAGACAGAGG + Intronic
1163161168 19:15464739-15464761 CAACGGAGGCTCAGAGAGAGGGG - Intergenic
1163172068 19:15538325-15538347 AAACTGAGCCTCAGAAAGTGGGG - Intronic
1163176114 19:15564987-15565009 AGCCTGAGGCCCACAGAGATGGG - Intergenic
1163258378 19:16171730-16171752 AAACTGAGGCTCAGACAGGGCGG - Intronic
1163356383 19:16814246-16814268 AAACTGAGGCTCTGAGAGGCTGG + Intronic
1163415456 19:17183719-17183741 AGACTGAGAGACACAGAGAGAGG - Intronic
1163657920 19:18558372-18558394 AAACTGAGGCTCACAGGGGCGGG - Intronic
1163658942 19:18565066-18565088 AAACTGAGGCTCAGATGGGGAGG - Intronic
1163781462 19:19251432-19251454 AAACTGAGGCTCAGATATAAAGG + Exonic
1164479482 19:28600425-28600447 AGACTGAGGCTCAGAGAAATTGG + Intergenic
1164546813 19:29172796-29172818 AAAGTGAAGCCCAGAGAGAGGGG + Intergenic
1164605626 19:29595938-29595960 AAACTGTGGCACAAAGACAGTGG - Intergenic
1164673377 19:30086001-30086023 AATGTGTGGCACACAGAGAGAGG + Intergenic
1165075225 19:33276628-33276650 AAACTGAGGCCCAGAGAGACAGG - Intergenic
1165110222 19:33497983-33498005 AGGCTGAGGCTCAGAGAGAAAGG - Intronic
1165315795 19:35054702-35054724 AAGCTGAGGCTCAGAGAGGTGGG - Intronic
1165896751 19:39145966-39145988 AAACTGAGGCCAACAGAGGTGGG - Intronic
1165943546 19:39427801-39427823 AAACTGAGGCAGGCACAGAGAGG + Exonic
1166110862 19:40622310-40622332 AAACTGAGGCTGGCATAGATAGG - Intronic
1166338108 19:42121412-42121434 AAACTGAGAGGCCCAGAGAGGGG + Intronic
1166492910 19:43274518-43274540 AAGCTGAGGCAGAGAGAGAGAGG + Intergenic
1166527496 19:43521578-43521600 GAACTGAGGCTCCCAGAGGGAGG + Intronic
1166548414 19:43648764-43648786 AAACTGAGGCCCAGAGAGGTCGG + Exonic
1166729085 19:45048199-45048221 AAACTGAGGCTCAAAGCCATGGG - Intronic
1166729149 19:45048650-45048672 AAACTGAGGCTCAAAGCCATGGG - Intronic
1166938872 19:46351040-46351062 GCACTGAGGCCCACAGAGAGGGG - Intronic
1167107088 19:47436707-47436729 AGACTGAGGCTCAGAGACAGAGG - Intronic
1167119439 19:47507825-47507847 AAGCTGGGGCTCAGAGAGGGCGG + Intronic
1167133685 19:47604004-47604026 AAACTGAGGCTCGCAAACCGAGG + Intergenic
1167168195 19:47813618-47813640 AAACTGAGGAACAGAGAAAGGGG - Intronic
1167241017 19:48343065-48343087 AAACTGAGGCTCGGAGAGGGAGG - Intronic
1167315794 19:48762085-48762107 GAACAGAGACCCACAGAGAGGGG + Intergenic
1167315810 19:48762154-48762176 GAACAGAGACCCACAGAGAGGGG + Intergenic
1167315894 19:48762470-48762492 GAACAGAGGCCCAGAGAGAGGGG + Intergenic
1167341964 19:48921688-48921710 AAACTGAGGCCCACGGAGAAGGG + Intronic
1167470052 19:49670503-49670525 AAAGTGAGGCCCGGAGAGAGAGG - Intronic
1167604542 19:50474942-50474964 AAACTGAGGCTCAGAGAGCCGGG - Intronic
1167621265 19:50562308-50562330 AAACTGAGGCCCAGAGAGGTGGG - Intronic
1167641553 19:50685336-50685358 AAACTGAGGCTCAAGGAAGGAGG - Intronic
1167761395 19:51452137-51452159 AAAATGAGCCACACACAGAGAGG + Exonic
1167792552 19:51690726-51690748 AAACTGAGGCGGAGAGAGAAGGG - Intergenic
1168115793 19:54220894-54220916 ACACTGAGGGTCCCAGGGAGAGG - Intronic
1168118777 19:54240640-54240662 ACACTGAGGGTCCCAGGGAGAGG - Intronic
1168133719 19:54337210-54337232 AGACTGAGGGTCCCAGGGAGAGG - Intronic
1168182595 19:54672262-54672284 ATACTGAGGGTCCCAGAGAGAGG + Intronic
1168185694 19:54698109-54698131 AGACTGAGGGTCCCAGGGAGAGG + Intronic
1168187664 19:54710021-54710043 ACACTGAGGGTCCCAGGGAGAGG + Intergenic
1168272918 19:55259596-55259618 AAACCGAGGCTCAAAGCCAGAGG - Intergenic
1168351953 19:55680993-55681015 AAACTGAGGCCCAGAGACGGGGG + Intronic
1202657151 1_KI270708v1_random:34777-34799 AGACTGCGGCCCACAAAGAGAGG + Intergenic
925418235 2:3688645-3688667 AGGCTGAGGCTCACTTAGAGGGG - Intronic
925588203 2:5484263-5484285 AAACTGAGGCCCCAAGAGAAGGG - Intergenic
926312241 2:11683096-11683118 AAACTGAGTCTCTCAGGGAAGGG - Intronic
926634366 2:15164468-15164490 AAACTGAGGCTCAGAGAGAGAGG + Intergenic
926692758 2:15748519-15748541 AAACTGAGGCCCAGGGAGAGCGG - Intergenic
926704133 2:15824795-15824817 AAACTGAGGCTCAGAGAGACTGG - Intergenic
927197900 2:20560658-20560680 AAACTGAGGCCCAGAGAGAAGGG + Intronic
927307516 2:21590538-21590560 AATCTGAGGCCCAGAGAGAAAGG + Intergenic
928201494 2:29250272-29250294 ACACTGAGGCTCAGAGAGTCAGG - Intronic
928272249 2:29866880-29866902 AATCTGTGGTTCACAGACAGTGG + Intronic
928305943 2:30170544-30170566 AAACTGAGGCTTAGAGAGGTTGG - Intergenic
928545858 2:32328681-32328703 AAACTGGGGAGGACAGAGAGTGG - Intergenic
928767580 2:34665734-34665756 AAACTGAGGCACAGAAAGATTGG - Intergenic
928923771 2:36555119-36555141 AAGGTGAGGCTCACACAGGGTGG - Intronic
929600934 2:43204161-43204183 AACCTCAGGCACACAGACAGAGG + Intergenic
929840664 2:45459376-45459398 AAACAAAGGATCAGAGAGAGTGG - Intronic
929950720 2:46407671-46407693 AAACTGAGGCACAGAGAGGTTGG - Intergenic
930156049 2:48108627-48108649 AAACTGAAGCTCAGGGAGATTGG + Intergenic
931854766 2:66291422-66291444 AAACAGAGGCTCATAGACAGTGG - Intergenic
932085335 2:68752639-68752661 AGTCTGAGGTTCACAGAGAATGG + Intronic
932088564 2:68784428-68784450 AAACTGGTGATCACAGAGAGAGG - Intronic
932401505 2:71483736-71483758 AAACTGAGGCTCTGAGAGATTGG + Intronic
932441338 2:71737592-71737614 AAACTGAGGCTCAGAGAGCATGG - Intergenic
933183814 2:79256773-79256795 AAACTGGGGCTTAGAGAGACTGG - Intronic
933979407 2:87538248-87538270 AAACTGAGGCTCAGAGAGGTTGG - Intergenic
934054281 2:88239054-88239076 AAACCGAGGCCCACAGAGGGTGG - Intergenic
934517654 2:94998780-94998802 AAACTGAGGCACAGAGGGAACGG - Intergenic
935104639 2:100029280-100029302 AAACTGAGACAGACATAGAGGGG + Intronic
935237902 2:101153078-101153100 AAACTGAGGCTCATTGAGATTGG - Intronic
935735044 2:106099784-106099806 AAAATGAGGCTTACAGTGTGAGG + Intronic
936159255 2:110071549-110071571 AAACTGAGGCACAGAGAGACGGG + Intergenic
936185406 2:110299783-110299805 AAACTGAGGCACAGAGAGACGGG - Intergenic
936314418 2:111412543-111412565 AAACTGAGGCTCAGAGAGGTTGG + Intergenic
936735249 2:115433552-115433574 AAACTGTGTCACACAGAGAATGG - Intronic
936854499 2:116940291-116940313 AACCTAAGGATCACAGACAGAGG + Intergenic
937025903 2:118696934-118696956 AAGCAGAGGCTCAAGGAGAGCGG - Intergenic
937227495 2:120378152-120378174 AAACTAAGGCTCAGAGAGCTTGG - Intergenic
937289972 2:120776251-120776273 AAACTGAGGGTCAGAGAGGTTGG + Intronic
937913229 2:127086259-127086281 AAACTGGGGCACACAGACACTGG + Intronic
938228219 2:129635957-129635979 ACACTGTGGCTGACAGAAAGGGG - Intergenic
940100533 2:150033087-150033109 AAACTGAGGCTCAAAGATTAAGG + Intergenic
941278340 2:163518687-163518709 CCACTGAGGCTCACAGTCAGTGG + Intergenic
941638264 2:167959968-167959990 AAATTGAGGCTCACAAAGCGTGG - Intronic
941737708 2:168997668-168997690 AAAAGAAGGCTGACAGAGAGCGG - Intronic
941754789 2:169173539-169173561 AAACTGAGGTTCACATTAAGTGG - Intronic
941902411 2:170691218-170691240 AAAATAAGGCACAGAGAGAGAGG + Intergenic
942315302 2:174692131-174692153 AAACTGAGGCCCTGAGGGAGTGG + Intergenic
942593498 2:177570465-177570487 GAACTGAAGCTCACAGAGGCAGG + Intergenic
943805985 2:192126722-192126744 AAACTGAGGCTCAGAGAGACAGG + Intronic
946108518 2:217393384-217393406 TAACTGCGGATCATAGAGAGTGG - Intronic
946960879 2:224984531-224984553 TAACAGAGGCTAACAGAGAGAGG - Intronic
946966872 2:225045044-225045066 AAACTGAGGCTTACGGAGTTGGG - Intergenic
947040584 2:225914435-225914457 AAACAGAGACTAACAGACAGTGG - Intergenic
947845220 2:233238259-233238281 AAAGTGAGGCTCAGGGAGACAGG - Intronic
947988053 2:234465554-234465576 AAACCGAGGCTCAGAGAATGTGG - Intergenic
947991583 2:234492238-234492260 AAACTGAGGCTTAGAGGGAAAGG + Intergenic
948463297 2:238140455-238140477 AAATTGAGGTTCAGAGAGGGTGG - Intronic
948514506 2:238495396-238495418 AAACTGAGGTTCAGAAAGGGCGG - Intergenic
948860942 2:240752347-240752369 ACACTGAGGCCCACAGGGCGGGG + Intronic
948864761 2:240769591-240769613 AAACTGAGGCCCAGGGGGAGGGG - Intronic
948900804 2:240956077-240956099 AAACTGAGGCTCAGGAAGGGAGG - Intronic
1168842843 20:920860-920882 AAACTGATACTCAGAGAGGGAGG + Intergenic
1169385807 20:5148477-5148499 AAACTGAGGCTCATGGAGACTGG + Intronic
1170052334 20:12159537-12159559 AAACTGAGACACCCAGAGTGGGG - Intergenic
1170347957 20:15407650-15407672 AAACTGAGGCACAGAGAGGCTGG - Intronic
1170454437 20:16519236-16519258 AATGGGAGCCTCACAGAGAGAGG - Intronic
1170625614 20:18027903-18027925 TAACTTAGGCTCTCAAAGAGAGG + Intronic
1171291434 20:23985035-23985057 ACACTGAGGCCCAGAGAGTGGGG + Exonic
1171458104 20:25283135-25283157 AGGCTGAGGCCCACAGTGAGCGG + Intronic
1171522523 20:25786646-25786668 AAACGGAGGCCCACAGGGTGGGG - Intronic
1171554304 20:26069237-26069259 AAACGGAGGCCCACAGGGTGGGG + Intergenic
1172050007 20:32110031-32110053 AAAATGGGGCTCACAGTGGGCGG - Intronic
1172178597 20:32987247-32987269 AAACTGAGGCTCAAAGAGCCAGG - Intronic
1172354056 20:34266913-34266935 AAACTGAGGCACACTAAGACAGG - Intronic
1172441769 20:34971195-34971217 AAACTGAGCCGCAAAGAGAGAGG - Intergenic
1172519196 20:35556389-35556411 AGACTGAGGCACAGAGAGGGTGG + Intronic
1172619754 20:36311184-36311206 AAACTGAGGCTCAGAGTGGTTGG + Intronic
1172633422 20:36393788-36393810 GAACTGAGGCTCAGAGAGGGAGG + Intronic
1172705386 20:36878819-36878841 AAACTGAGGCCCAGGGAGGGTGG - Intronic
1172805997 20:37612226-37612248 AAATTGAGGCCCAGAGAGAGAGG - Intergenic
1173078926 20:39847467-39847489 AAACTGAGTCTTACGTAGAGGGG + Intergenic
1173108646 20:40163273-40163295 AAATTGAGGCTCAGAGACATCGG - Intergenic
1173224456 20:41154120-41154142 AAAATGAGGCTCAGAGAGATGGG + Intronic
1173448131 20:43138442-43138464 AAACTGAGGCTCATGGAGACAGG - Intronic
1173450506 20:43159417-43159439 AAACTGAGGCTCAGAGAAGCTGG - Intronic
1173841545 20:46160679-46160701 AAACTGAGGCTCAGAGAGGTGGG - Intergenic
1174059947 20:47825819-47825841 AAACTGAGGCTCAGAGGCACTGG + Intergenic
1174071924 20:47905451-47905473 AAACTGAGGCTCAGAGGCACTGG - Intergenic
1174082431 20:47979933-47979955 AAACTGAGGCTCAGAGAGGCAGG + Intergenic
1174097695 20:48102390-48102412 AAACGGAGGCACACACAGAGAGG - Intergenic
1174152124 20:48493218-48493240 AAACTGAGGCTCAGAGGCACTGG + Intergenic
1174277019 20:49411246-49411268 AAACGGAGTCTCAGAGAGACTGG + Intronic
1174362346 20:50036960-50036982 AAACTGCAGCTCAGAGAGGGTGG - Intergenic
1174451216 20:50621670-50621692 AAACTGGGGCCAACACAGAGAGG + Intronic
1174453734 20:50635708-50635730 AAACCGAGGCTCAGAGAGGACGG + Intronic
1174524136 20:51157793-51157815 ACACTGAGGCTCAGAGAGGGAGG + Intergenic
1174537759 20:51265694-51265716 AAACTTAGGCTCATAGAGTGGGG + Intergenic
1175063523 20:56265563-56265585 ATACTGAGGCTCAGAGAGGCAGG + Intergenic
1175161734 20:57012881-57012903 AAACTGAGGCTCAGAGAGGTGGG + Intergenic
1175223300 20:57430163-57430185 ACACTGAGGTGAACAGAGAGGGG + Intergenic
1175277857 20:57784006-57784028 AAACAGTGGCTCAGAGAGAGTGG + Intergenic
1175411984 20:58776468-58776490 ATACTGAGGCTCAGAGAGGTGGG - Intergenic
1175420342 20:58828515-58828537 AAACTGAGGCTTAGAGAGGTGGG - Intergenic
1175492179 20:59386747-59386769 AAACTGAGGCACAGAGGGAGGGG - Intergenic
1175502044 20:59457357-59457379 AAACTGAGGTTCAGAAAGAGTGG + Intergenic
1175537855 20:59727624-59727646 AAAGTGAGGCTCAGAGGGAGAGG - Intronic
1175868920 20:62198093-62198115 AAACGGAGGCTGGCAGACAGCGG + Intronic
1176121025 20:63454680-63454702 AAACTGAGGCTCACTGAGGCAGG + Intronic
1176597020 21:8757115-8757137 AGACTGAGGCCCACCAAGAGAGG + Intergenic
1176630434 21:9131679-9131701 AGACTGGGGCCCACAAAGAGAGG - Intergenic
1176642835 21:9323060-9323082 AGACTGAGGCCCACCAAGAGAGG + Intergenic
1177866644 21:26520267-26520289 AAACTCATGGACACAGAGAGGGG - Intronic
1178174745 21:30083632-30083654 AAACTGGGGCTTAGAGAGGGAGG - Intergenic
1178587909 21:33885364-33885386 ATTGTGAGGCTCACAGAGATGGG + Intronic
1178753816 21:35328787-35328809 AAACTGGAGCTCAGAGAGATGGG - Intronic
1178826628 21:36022726-36022748 AAACTGAGGCCCAGAGAGCAGGG - Intergenic
1179105328 21:38395257-38395279 CAACTCAGGCTCACTGAGATGGG + Intronic
1179249917 21:39664108-39664130 AAACTGAGGCAGAGAGAGAGAGG + Exonic
1179528347 21:41999492-41999514 AAACTGAGGCTCAAAGAGGTTGG - Intronic
1179551875 21:42148603-42148625 AAACAGGGGCTCAGAGAGATTGG - Intergenic
1179633328 21:42692016-42692038 AGACTGAGGCGCACACTGAGGGG - Intronic
1180105895 21:45617854-45617876 AAACGGAGGCCCAGAGACAGTGG + Intergenic
1180421421 22:12817717-12817739 AGACTGAGGCCCACCAAGAGAGG - Intergenic
1180765965 22:18346058-18346080 ACACTGAGGCCCAGAGAGTGGGG - Intergenic
1180780348 22:18516320-18516342 ACACTGAGGCCCAGAGAGTGGGG + Intergenic
1180813064 22:18773641-18773663 ACACTGAGGCCCAGAGAGTGGGG + Intergenic
1181199241 22:21207957-21207979 ACACTGAGGCCCAGAGAGTGGGG + Exonic
1181400524 22:22647900-22647922 ACACTGAGGCCCAGAGAGTGGGG - Intronic
1181431239 22:22882983-22883005 AAACAGAGGCAGAGAGAGAGAGG - Intronic
1181468153 22:23121506-23121528 AAACTGAGGCACAGAGAGGCAGG - Intronic
1181477726 22:23179261-23179283 AAACTGAGGCAGAGAGGGAGAGG + Intergenic
1181571794 22:23771930-23771952 AAACTGAGGCTCCAAGAGGGAGG - Intronic
1181702504 22:24628998-24629020 ACACTGAGGCCCAGAGAGTGGGG - Exonic
1181787255 22:25236147-25236169 AAACTGAGGCTCAGAGGGCCTGG + Intergenic
1181915443 22:26276054-26276076 AAACTGGGGCTCTGAGAGAGAGG - Intronic
1181987834 22:26813367-26813389 AAACTGACACACACAGAGAGAGG + Intergenic
1181991155 22:26837988-26838010 AAACTGAGGTTCAGAGAGGTTGG + Intergenic
1182051184 22:27314040-27314062 AAACTGAGGCTCAGAGGCAAGGG - Intergenic
1182053492 22:27331276-27331298 AAACTGAGGCTCAAAGAACTTGG - Intergenic
1182102930 22:27670534-27670556 AAACTGAGGCTCAGAGAGGAGGG + Intergenic
1182315609 22:29444900-29444922 AAACTGAGACTCAGGGAGGGAGG + Intergenic
1182497380 22:30719200-30719222 AAACTAAGGCTGAAAGAGAAGGG - Intronic
1182508049 22:30799518-30799540 AAACTGAGGCCCAAAGACAAAGG + Intronic
1182549250 22:31092153-31092175 AAACTGAGGCTCAGAGAGGGTGG + Intronic
1182549660 22:31093950-31093972 AAACTGAGGCTCAGAGAAGGTGG - Intronic
1182558439 22:31141361-31141383 AAACTGAGGCTCAGTGAGGGTGG + Intergenic
1182586791 22:31348000-31348022 AAGCTGTGGCTCAGAGAGGGAGG - Intergenic
1182597654 22:31434560-31434582 AAACTGAGGCTCATAAAGGTTGG - Intronic
1182667409 22:31970066-31970088 AAAGAGAGGCTCACAGGGAGAGG - Intergenic
1182857696 22:33532567-33532589 AAACTAAGGCTAACAGAGGCTGG + Intronic
1183036380 22:35143910-35143932 AAACTGAGGCCCAGAGAAGGGGG - Intergenic
1183073878 22:35414268-35414290 AAACTGACGCTCAGGGAGATTGG - Intronic
1183084298 22:35477170-35477192 AAACTGAGGCCCAGAGAGTGGGG + Intergenic
1183164811 22:36139663-36139685 AAACTGAGGCTCAGAGAGGCGGG + Intergenic
1183171092 22:36188787-36188809 AAACTGAGGCTCAGAGAGATGGG + Intergenic
1183228566 22:36566540-36566562 AGACTGAGGCACACAGAGGCAGG + Intronic
1183257040 22:36769263-36769285 AGACTGAGGCTCAGAGAGGCTGG + Intronic
1183296174 22:37030805-37030827 AAACTGAGGCTCCGAGAGGTTGG - Intergenic
1183394031 22:37561290-37561312 AAACTGAGGCTTAGAGAGTAGGG + Intronic
1183474630 22:38029283-38029305 AAACTGAGGCCCAAGGATAGTGG + Intronic
1183506428 22:38211659-38211681 AAAGTGAGGCACAGAAAGAGTGG + Intronic
1183612163 22:38916485-38916507 AAACAGAGTCTCAAGGAGAGAGG + Intergenic
1184041937 22:41949549-41949571 AGACTGAGGCCCTTAGAGAGTGG + Intergenic
1184087125 22:42271633-42271655 AAACTGAGGCCCAAAGTGGGAGG - Intronic
1184239623 22:43205310-43205332 ACACTGGGGCTCAGAGAGGGCGG - Intronic
1184446316 22:44549224-44549246 TATCTGAGGATCACAGAGACAGG + Intergenic
1184526751 22:45028539-45028561 AAACTGAGGCACAGAGAGATTGG + Intergenic
1184604366 22:45563675-45563697 AAACTGAGGCCCAGAGAGAAGGG + Intronic
1184650596 22:45917895-45917917 AAACTGAGGCACAGAGAGTAAGG - Intergenic
1184690060 22:46113491-46113513 AAACTGAGGCCCAGAGAGCCAGG + Intronic
1203227584 22_KI270731v1_random:86949-86971 ACACTGAGGCCCAGAGAGTGGGG - Intergenic
949340609 3:3026520-3026542 AAACTAAGGCTCACAGGCATTGG + Intronic
949896475 3:8770571-8770593 AGACTGAGGCCCAAAGAGAAGGG - Intronic
950106291 3:10391197-10391219 AAACTGAGGCTCAGAGTGGAGGG + Intronic
950109769 3:10411558-10411580 GTACTGAGGCTCAGAGAGCGAGG - Intronic
950113745 3:10437206-10437228 AAGCTGAGGCCCAGAGAGGGAGG - Intronic
950120033 3:10475692-10475714 AAACTGAGACTCAGAAAGAAAGG + Intronic
950217383 3:11169156-11169178 AGACTGAGGCACAGAGAGAAGGG - Intronic
950517130 3:13474734-13474756 AAACTGAGGCCCAGAGAGGGAGG - Intergenic
950560625 3:13719538-13719560 AAACTGAGGCTCAGAAAGGGTGG + Intergenic
950583331 3:13877269-13877291 AAATTGAGGCTCACAGAGGTTGG + Intronic
950637279 3:14323977-14323999 AAACTGACGCTCAGAGAGGCAGG + Intergenic
950655752 3:14435226-14435248 AGACTGAGGCTCAGAGAAGGGGG - Intronic
950675042 3:14549619-14549641 AAACTGAGGCTCAGAGAAAATGG + Intergenic
950720386 3:14878235-14878257 ACACTGAGGCTCAGAGATAAGGG + Intronic
950743690 3:15069750-15069772 AAACTGAGGCTCAGAGATTGAGG - Intergenic
950935392 3:16834271-16834293 AAACTAAGGATCATGGAGAGAGG + Intronic
952007555 3:28859323-28859345 AAACTAGGGCTCACTGAGAAAGG + Intergenic
952306872 3:32154590-32154612 AAACTGAAGCACACAGAGTAAGG - Intronic
952859570 3:37801829-37801851 AAACTGAGGCTCAGAAACTGTGG + Intronic
953151517 3:40329425-40329447 AAACTGAGGCTGTGAGAGACTGG - Intergenic
953214050 3:40901377-40901399 ACACTGAAGCTCAGGGAGAGAGG + Intergenic
953405172 3:42656383-42656405 AAACCGAGGCTCAGAATGAGAGG - Intronic
954708668 3:52494338-52494360 AAACTGAGGCTCAGAGGGGCTGG - Intergenic
954789664 3:53122776-53122798 AAACTGAGGCTGACAGGCACTGG + Intronic
954849174 3:53585865-53585887 AAACTGAAGCTCACACAGGCAGG + Intronic
954861775 3:53696394-53696416 ACACTGAGGCTCACAGCACGTGG - Intronic
954906170 3:54064859-54064881 AAACTGAGGTTCAGAGAGGTTGG - Intergenic
955169579 3:56550255-56550277 AAACAGAAGTTCAGAGAGAGAGG - Intergenic
955327787 3:58022690-58022712 AAACTGAGGCACACCCAGATTGG + Intronic
955526459 3:59825337-59825359 ACACTGAGGCTCATAGGAAGTGG - Intronic
956327781 3:68072173-68072195 GAACTGAGGCTTACAGGGTGAGG + Intronic
956770969 3:72525707-72525729 AAACTGAGGCTCTCATAGCTTGG - Intergenic
956871368 3:73421374-73421396 CAACTGAGGCTCTGAGGGAGAGG + Intronic
957097248 3:75787508-75787530 AGACTGAGGCCCACCAAGAGAGG - Intergenic
957154859 3:76534575-76534597 AAGCTGAGGCTGGCAAAGAGAGG + Intronic
958075430 3:88670480-88670502 AAACTGAGCCACAGAGAGATGGG - Intergenic
958717721 3:97806512-97806534 AATTGGAGGCTCACAGAGATAGG + Intergenic
958925123 3:100149275-100149297 AACCAGAGGCTCAGAGAGATGGG + Intronic
959554277 3:107698907-107698929 AAACAGAGGGTCACAGAGCAGGG + Intronic
960268674 3:115650478-115650500 GAAAGGGGGCTCACAGAGAGAGG - Intronic
960946306 3:122969171-122969193 AAACTGAGGCTCAGAGAGGTTGG + Intronic
960960021 3:123064184-123064206 AAACAGAGACCCACAGAGAGGGG + Intergenic
961149643 3:124626883-124626905 AAACTGAGGCTCATAGTGACTGG - Intronic
961357255 3:126346875-126346897 AAACTGAGGCTCAGGGAGCTTGG - Intronic
961623881 3:128245733-128245755 AAACGGAGACTCACAGACATGGG - Intronic
961800175 3:129441493-129441515 AAACTGAAGCCCAGAGAGGGTGG + Intronic
962355090 3:134686827-134686849 AAACTGAGGCCCAAAGAGATGGG + Intronic
962422376 3:135239934-135239956 AAACTGAGGCACAGAGAGGTAGG + Intronic
962606426 3:137036186-137036208 ACACTGAGGCCCAGAGAGATGGG + Intergenic
962646026 3:137441146-137441168 AAACTGAGGATCAGAGAGGTTGG + Intergenic
962917385 3:139917062-139917084 AAACTGAGAGCCTCAGAGAGAGG + Intergenic
962985911 3:140535747-140535769 AAACTGAGGCTCAGAGATGAAGG + Intronic
963311224 3:143712346-143712368 AAACTGAGGTTCAGAGGAAGAGG + Intronic
963783460 3:149509915-149509937 AAACTGAGGCCCAAAGAAATGGG - Intergenic
964245178 3:154643418-154643440 TAAGTCAGGCTCACACAGAGAGG + Intergenic
964708827 3:159649258-159649280 AAATGGAGACTGACAGAGAGAGG - Intronic
965374082 3:167900121-167900143 AAATTTAGGCACAGAGAGAGAGG - Intergenic
967088378 3:186114314-186114336 AAACTGAGTTTCAAAGTGAGAGG + Intronic
967390762 3:188951687-188951709 AAACTGAAGCTCAGACAGAGGGG - Intronic
967478121 3:189944137-189944159 AAACTGAGGCTCAGAGAAGTTGG - Intergenic
967617153 3:191583759-191583781 AAAATGAGTCTGACAGAGAACGG + Intergenic
967833379 3:193941337-193941359 AAACTGAGGCTCAGAGAGGTTGG - Intergenic
968283784 3:197496365-197496387 AAACTGAGACTCAGGGAGTGGGG - Intergenic
1202744050 3_GL000221v1_random:81953-81975 AGACTGAGGCCCACCAAGAGAGG - Intergenic
968474242 4:795602-795624 AAGCTGAGGCTCAGAGAACGAGG - Intronic
969150459 4:5164694-5164716 AGAATGAGGCTCAGAGAGGGTGG + Intronic
969175854 4:5398574-5398596 ACACTGAGGCTCAGAGAGGTGGG - Intronic
969268416 4:6081347-6081369 AAACAGAGGCTCAGAGAGAATGG + Intronic
969506370 4:7590624-7590646 AAACTGAGGCCCAGAGACAAAGG + Intronic
969604506 4:8195820-8195842 AAACTGAGGCCCAGAGAAGGAGG + Intronic
969702010 4:8772942-8772964 AAACTGAGGCTCAGGAGGAGCGG - Intergenic
970362810 4:15326944-15326966 ACACTGAGGCTCCCTGAGAAGGG - Intergenic
970445911 4:16123262-16123284 ACACTGAGGCTCAGAGAGGTTGG + Intergenic
970691091 4:18621511-18621533 AAAGTGAAGCTTACAGAGAGAGG + Intergenic
971366868 4:25984607-25984629 AAACTGAGGCACAGAGAGACTGG + Intergenic
971649962 4:29258742-29258764 ATTCTGAGGCTCACAGATGGGGG + Intergenic
972089856 4:35267888-35267910 AAAATCAGGATAACAGAGAGAGG - Intergenic
973238669 4:47933195-47933217 AAACTGAGTCTCACTGAGGGAGG - Intronic
973360318 4:49159337-49159359 AGACTGAGGCCCACCAAGAGAGG + Intergenic
973570540 4:52234394-52234416 AAACAGAGGCTTAGAGAAAGAGG - Intergenic
974252347 4:59403033-59403055 ACACTGAGGCTACCAGAGGGTGG + Intergenic
974455419 4:62124153-62124175 AAGGTGAGGCTCAGAGAGAAAGG - Intergenic
975787820 4:77911577-77911599 AAATTGAGGCTCAGAGAGCAAGG - Intronic
976828467 4:89285727-89285749 AAACTGAAACTGACAGAGATGGG + Intronic
977077642 4:92476442-92476464 AAACTGTGGCACACAGGGTGAGG + Intronic
978047614 4:104151157-104151179 AAACTGAGAGACAAAGAGAGAGG - Intergenic
978431557 4:108638489-108638511 AAACTGAGGCTCATAGAAATTGG - Intergenic
979201602 4:117985575-117985597 ACACTGAGGCTCATAGTCAGAGG + Intergenic
979336781 4:119472397-119472419 AAATTGAAGGGCACAGAGAGTGG - Intergenic
979339325 4:119502108-119502130 AAGCTGTGGCTGACAGAGAAAGG - Intronic
979854680 4:125617379-125617401 AGACTAAGGCCCACAGTGAGAGG - Intergenic
981328840 4:143484465-143484487 AATCAGAGGCTCACAAAAAGGGG + Intergenic
981812340 4:148789948-148789970 AAACGGAGATTCACACAGAGGGG - Intergenic
982073217 4:151713886-151713908 AAACTGAGGCTTAGAGAGGTGGG - Intronic
982113173 4:152074502-152074524 AAACTGAGGCTCAGAGAAACTGG - Intergenic
982474964 4:155839251-155839273 AAACTAAGCCTCAGAAAGAGTGG + Intronic
983503634 4:168528596-168528618 AAACTGAGACTCAGAGAGGTAGG + Intronic
983534873 4:168846746-168846768 AAGCTGAGGCTCTCAAAGTGTGG + Intronic
984915484 4:184719423-184719445 AAACTGATGCCCACACACAGAGG + Intronic
1202757751 4_GL000008v2_random:81422-81444 AGACTGAGGACCACAAAGAGAGG + Intergenic
985708114 5:1413430-1413452 CACCTGAGTCTCACAGAGTGGGG - Intronic
987055620 5:14188343-14188365 AAACTGAGGTACAGAGAGATTGG + Intronic
987191199 5:15480143-15480165 AAAGTGAGGCCCACAGAAATTGG - Intergenic
987247161 5:16060504-16060526 ATACAGAGGCGCAGAGAGAGAGG - Intergenic
988794038 5:34635820-34635842 AAACTGAGGCTAACAGACAAAGG - Intergenic
989998616 5:50865466-50865488 GAAGTGAGTTTCACAGAGAGTGG + Intergenic
990174014 5:53087056-53087078 ACCCTGAGGCTCACAGGGAAGGG - Intronic
990544861 5:56813577-56813599 AAACTGGGGATCAAAGGGAGAGG - Intergenic
991302024 5:65138004-65138026 AAACTGAGGCTAAGAGATTGAGG - Intergenic
991593963 5:68283709-68283731 AAACCGAGGCCCACAGATAGAGG + Intronic
992124809 5:73628891-73628913 GAACTAAGGGTCACAGAGACTGG - Intronic
994608527 5:102004534-102004556 AAAAGGAGGATGACAGAGAGGGG + Intergenic
995511004 5:112909204-112909226 AAACTAAGGCTCAGAGAGATTGG - Intronic
997036024 5:130192845-130192867 AAAATGAGACTCACAGATAGTGG + Intergenic
998134177 5:139666096-139666118 CCACTGAGGCTCAGAGAGGGTGG + Intronic
998152950 5:139767618-139767640 AAACTGATGCTTACAAAGACAGG - Intergenic
998300838 5:141018069-141018091 AAATTGAGGCTCACAGAAAGGGG + Intergenic
998931789 5:147189241-147189263 AAAATGAGTCTCAGAGAGATGGG - Intergenic
999119598 5:149198856-149198878 AAACTGAGGCTTACAGAGGTGGG - Intronic
999250152 5:150177735-150177757 AAAATGAGGCTCAGAGAGGTGGG + Intronic
999317652 5:150594559-150594581 AAACTGAGGCCCAGGGAGAGGGG - Intergenic
999324809 5:150637305-150637327 AAACTGAGCCTCAAAAAGAAAGG - Intronic
999651123 5:153768375-153768397 AAACTAAGGCCCAAAGAGAAGGG + Intronic
999673400 5:153976605-153976627 AAACTGAGGTCCACAGAAGGAGG + Intergenic
999718106 5:154378457-154378479 AAACTGAGAGGCACAGAGTGAGG + Intronic
999743642 5:154575562-154575584 AAACTGATGCTCAGAGAGTTTGG + Intergenic
999937978 5:156508613-156508635 AACCTGAGGATCACAGAAAAAGG + Exonic
1000018229 5:157297134-157297156 GAGCTGAGACTCAGAGAGAGAGG + Intronic
1000068393 5:157716882-157716904 AAACAGAGACACACACAGAGAGG - Intergenic
1000253290 5:159515002-159515024 AAACTGAGCCTCAGAGAGTTAGG - Intergenic
1000279752 5:159772483-159772505 AAACAGAGGCTCACAGAAGTTGG - Intergenic
1000334470 5:160231890-160231912 AGACTGAAGCTCAGAGAGATAGG + Intronic
1001546255 5:172572333-172572355 GAACTGAGGCACAGAGAGGGAGG + Intergenic
1001672244 5:173483490-173483512 ATACTGAGGCTTAGAGAGGGAGG + Intergenic
1001772635 5:174307700-174307722 AAACTGAGGCTCAAAGAGGTGGG + Intergenic
1001874866 5:175191188-175191210 AAACTGAGGCTCAGAGAAGTAGG - Intergenic
1002302949 5:178267925-178267947 AAACTGAGGCCCACACAGCCCGG + Intronic
1002576068 5:180174837-180174859 AAACCGAGGCTCAGAGAGAGGGG + Intronic
1003662258 6:8073482-8073504 AAGCTGAGGCACACAGAGGTAGG - Intronic
1004181393 6:13383461-13383483 AAACTCAGCTTCACAGAGATAGG - Intronic
1004376788 6:15097436-15097458 AAACTGAGGCTTAGAGAGTTAGG - Intergenic
1004885313 6:20045383-20045405 AAACCGGGGCCCACAGAAAGAGG + Intergenic
1004890628 6:20097231-20097253 AAACTGAGGCTCAGGGTGGGTGG - Intergenic
1005360739 6:25028646-25028668 AAACTGAAGCTCAGAGAGAAAGG - Intronic
1006101515 6:31688868-31688890 AAACTGAGGCCCCCAGACAAAGG + Intronic
1006433819 6:34015501-34015523 AAACTGAGGCCCAGAGAGTCAGG - Intergenic
1006959929 6:37918628-37918650 TAATTCAGGCTTACAGAGAGAGG - Intronic
1007210742 6:40191887-40191909 AGACTGGGGCTCCCTGAGAGTGG - Intergenic
1007549755 6:42720314-42720336 GAGCAGAGGCTCACAGAGAAGGG - Intronic
1007736932 6:43987662-43987684 AGACTGAGGCTCACTGAGGATGG - Intergenic
1007818621 6:44543105-44543127 AGACAGAGGCACACACAGAGGGG - Intergenic
1007855656 6:44853658-44853680 AAAATGAGGCTCAAGGAGATGGG + Intronic
1007926674 6:45655258-45655280 AAGCTGAGGCTCACAGAATTTGG - Intronic
1008458333 6:51738311-51738333 AAACTGTGGTTAACAGAGACAGG + Intronic
1008509408 6:52262305-52262327 AAACTGAGGCACAGAGTGGGGGG - Intergenic
1008571180 6:52818524-52818546 AGAGTGAACCTCACAGAGAGTGG + Intergenic
1009059947 6:58386998-58387020 AGACTGTGGCTCTCACAGAGAGG + Intergenic
1010033177 6:71290200-71290222 AAACTGAGGCTTAGAGAGAAAGG + Intronic
1011525692 6:88262252-88262274 AAACTGAGGCTCAATGAGTTTGG + Intergenic
1012377174 6:98576474-98576496 AAACTGGGGCAGAGAGAGAGAGG + Intergenic
1012509919 6:99991430-99991452 AAACTGAGGCTCAGACAGGTTGG - Intronic
1013065600 6:106682174-106682196 AAACTGAGGCTCACAGGGGCTGG - Intergenic
1013327518 6:109062355-109062377 AGTCTGAGGCGCACAGAGCGAGG + Intronic
1013474526 6:110495338-110495360 AAAATGAGACTCAGAGAGAATGG + Intergenic
1014469778 6:121800047-121800069 AAACTGAGACACACATTGAGAGG + Intergenic
1014879845 6:126710201-126710223 AGACTGAGACTCTCAGAAAGAGG + Intergenic
1015521081 6:134131895-134131917 AAACTCAGGCTCACAGAGAGTGG + Intergenic
1016379274 6:143457627-143457649 ATACTGGGGGTCACAGACAGTGG + Intronic
1016517448 6:144910598-144910620 AAATTGAGTCTCAGAGAGAGGGG + Intergenic
1017133172 6:151125375-151125397 AAACTGAAGTTCAAAGAGATGGG - Intergenic
1017348067 6:153407345-153407367 AAAATGATGGTAACAGAGAGTGG - Intergenic
1017441164 6:154465511-154465533 GAACTGAGGCACCCAGAGGGAGG + Intronic
1017581457 6:155869106-155869128 AAACTGAGTCTCTGAGAGTGAGG + Intergenic
1017768661 6:157627733-157627755 AAACTGAGGCTTACAGAGATGGG - Intronic
1018782113 6:167077482-167077504 AAACTGAGACTCGGAGAGAGTGG - Intergenic
1019279084 7:191400-191422 AAACTGAGGCTCAGAGAGGGCGG + Intergenic
1019371429 7:663968-663990 ACCCTGAGGCTCAGAGACAGCGG - Intronic
1019552750 7:1611279-1611301 AAACAGAGGCCCACAGAGGTGGG + Intergenic
1019703881 7:2488269-2488291 AAACTGAGGCTCAGAGAGACGGG + Intergenic
1019777991 7:2923727-2923749 AAACCGAGGCCCACAGAGGAAGG - Intronic
1019906383 7:4068327-4068349 AAACTGAGGCCCCGAGAGGGTGG + Intronic
1020091664 7:5345464-5345486 AAACTGAGGCTCAGAGATGCAGG - Intronic
1020189165 7:5981778-5981800 AAACTGAGGCACATGCAGAGAGG - Intronic
1020293751 7:6742879-6742901 AAACTGAGGCACATGCAGAGAGG + Intergenic
1020678001 7:11203104-11203126 AAACTGGGGGTCACAAAGAATGG - Intergenic
1021229435 7:18067906-18067928 AATGTGAGGCTCAGAAAGAGAGG - Intergenic
1022130834 7:27402947-27402969 AAACTGAGGCACAAAGAAATTGG + Intergenic
1022468480 7:30666887-30666909 AAACTGAGGCCCAGAGGGAGAGG + Intronic
1022474070 7:30699129-30699151 AAACTGAGGCTCAGAGTGGTAGG - Intronic
1022479052 7:30731193-30731215 AGACTGAGGCTCAGAGAGGGAGG - Intronic
1022593945 7:31693517-31693539 AAACTGAGGCTCAGAAAGCCAGG - Intronic
1022788926 7:33667217-33667239 AAACTGAGAATCAAAGAGACTGG - Intergenic
1023475512 7:40573751-40573773 AAACTGAGGCTCAGAGTTTGAGG + Intronic
1024559356 7:50630328-50630350 AAACTGAGGCACAGAGAGGCTGG - Intronic
1025234962 7:57228183-57228205 AAACTGAGGCTCAGAGGCACTGG - Intergenic
1025723718 7:64038538-64038560 AAACTCAGCCTCACAGAGAAGGG + Intronic
1025932595 7:66008486-66008508 AAATTGAGGCTCAGGGAGAGTGG - Intergenic
1025950801 7:66143937-66143959 AAACTGAGGCTCAGGGAGAGTGG + Intronic
1026100432 7:67379593-67379615 AAACTGAGGCCCAGAGATGGAGG + Intergenic
1026363898 7:69628264-69628286 TAATTTAGACTCACAGAGAGAGG + Intronic
1026776495 7:73234468-73234490 AAACTGAGGCCCACAGAGGCAGG + Intergenic
1026953885 7:74364717-74364739 AAACTGAGGCTCAGAGACCAAGG + Intronic
1027017346 7:74787838-74787860 AAACTGAGGCCCACAGAGGCAGG + Intronic
1027070676 7:75158094-75158116 AAACTGAGGCCCACAGAGGCAGG - Intergenic
1027207478 7:76113004-76113026 ATTGTGAGTCTCACAGAGAGAGG + Intergenic
1027535970 7:79402340-79402362 AAACTGAAGTTCAGAGACAGAGG + Intronic
1027754735 7:82198357-82198379 ATAATGAGACTCAGAGAGAGGGG - Intronic
1027873470 7:83739810-83739832 AAACTGAAACCCACAGAGGGAGG + Intergenic
1027907570 7:84205877-84205899 AAACTGAGTCTATCAGAAAGTGG + Intronic
1028957917 7:96714287-96714309 GAACTGAGACTCAGAGAGATTGG + Intergenic
1029483333 7:100825547-100825569 AAACGGAGGTGGACAGAGAGTGG - Intronic
1030589862 7:111467201-111467223 AAACTGAGGCACATAGAGATTGG - Intronic
1032486913 7:132294747-132294769 AAAATGAGGCTGATAGAGAGAGG + Intronic
1032520037 7:132536916-132536938 AAGCAGAGGCTGACACAGAGTGG - Intronic
1032535624 7:132661018-132661040 AAACTGAAGCTCAGAGGCAGAGG - Intronic
1033139932 7:138816939-138816961 AATCTGAAGCTAACAGAGGGTGG + Intronic
1033669876 7:143481627-143481649 AAACTGAGGCTCAGAGAGCAAGG + Intergenic
1033995657 7:147343460-147343482 AAAATGAGGCTCCAAGATAGTGG - Intronic
1034077534 7:148246980-148247002 AAACTGAGGCACACACAAAGAGG - Intronic
1034191229 7:149214913-149214935 ACACTGAAGCTCAAAGAGAAAGG + Intronic
1034282731 7:149865085-149865107 AAACTGAGGCACAAAGAGGAAGG - Exonic
1034491408 7:151395015-151395037 AAACTGAGGCCCACAGAGGCTGG + Intronic
1035106778 7:156447616-156447638 AACCTGAGGCTCAGAAAGACGGG - Intergenic
1035624434 8:1060493-1060515 ACACAGAGACCCACAGAGAGAGG - Intergenic
1035651694 8:1270787-1270809 ACACAGAGACACACAGAGAGAGG - Intergenic
1035684150 8:1510658-1510680 AAACTGAGGCACAGAGAGAGTGG + Intronic
1035870859 8:3134804-3134826 AAAATGAGGCTCAGAGAGGTTGG - Intronic
1035990586 8:4485407-4485429 AAACTGACTCTCACAGAGAGAGG + Intronic
1036086576 8:5618979-5619001 AAACAGAGGTCCACAGAGAGAGG - Intergenic
1036183530 8:6605076-6605098 CCACTGAGACTCACAGGGAGAGG - Intronic
1036213786 8:6863219-6863241 AAAGGGAGGCTTACGGAGAGTGG + Intergenic
1036437497 8:8748706-8748728 ACAAGGAGGCTCCCAGAGAGTGG + Intergenic
1037007742 8:13803530-13803552 AGACAGAGGCACACAGAGAGAGG - Intergenic
1037904470 8:22707430-22707452 AAACTGAGACCCAGAGAGAGTGG + Intergenic
1037920332 8:22801302-22801324 AGACTGGGGCTCACAGAGGCAGG + Intronic
1038245056 8:25847648-25847670 AAACTGAGGCTCTGAGATAATGG + Intronic
1039383538 8:37108695-37108717 CAACTAAAGCTCACAAAGAGTGG + Intergenic
1039709235 8:40039258-40039280 AGACTGAGGCTCACCGAGGTGGG - Intergenic
1039958612 8:42226951-42226973 AAAATTAGCCTCACAGATAGTGG + Intergenic
1040544074 8:48383374-48383396 AAACTGAGACTTAAAGAGAATGG + Intergenic
1041857316 8:62472388-62472410 AAACTGAGTCTCAGAAAGATTGG - Intronic
1043161377 8:76852038-76852060 AAACTGAGGCTGAAAGAATGCGG - Exonic
1043192067 8:77237896-77237918 AAAATGATGCTGAAAGAGAGGGG - Intergenic
1043741989 8:83825630-83825652 AAACTGGGGCTCAGAGAGATTGG + Intergenic
1043875274 8:85479062-85479084 CCACTGAGGCTTACAGGGAGAGG + Intronic
1043983404 8:86666466-86666488 AAACTGAGGTTTAGAGAGGGAGG - Intronic
1044594493 8:93944665-93944687 AAACTGTGACTCACACACAGAGG + Intergenic
1045597034 8:103668900-103668922 AAATGTAGACTCACAGAGAGAGG - Intronic
1045669575 8:104533985-104534007 AAATTGAGGCACAGAGAGATTGG - Intronic
1046092400 8:109519196-109519218 GAAGTGAGGGACACAGAGAGGGG - Intronic
1046388568 8:113537248-113537270 ACACTGGGGCTATCAGAGAGTGG - Intergenic
1046844771 8:118903515-118903537 AAAAGGAGGTTCACAGAGTGAGG + Intergenic
1047052656 8:121130110-121130132 AAACTGAGACTGTCAGAGGGAGG - Intergenic
1047336712 8:123943045-123943067 AAACTGAGCCACAGAGAGATTGG - Intronic
1047537019 8:125729289-125729311 AAACTGAGGCCCTGAGAGATAGG - Intergenic
1047748712 8:127864338-127864360 AGGCTGAGGCTCCCAGAGATTGG - Intergenic
1047825303 8:128567100-128567122 AAACTGAGGCTCAGAAAGTTTGG - Intergenic
1048254591 8:132896205-132896227 AAACTGAAGCTCAGAGAGGTTGG + Intronic
1048542058 8:135351351-135351373 AACCTGAAGCCCAGAGAGAGAGG + Intergenic
1048566913 8:135610317-135610339 AAACTGAGGCTCAGAGAAGTAGG + Intronic
1048916954 8:139194276-139194298 AAGCTGAGGCTCAGAGATGGAGG + Intergenic
1049207729 8:141371214-141371236 AAACTGAGGCCCAGAAAGGGAGG + Intergenic
1049661064 8:143819965-143819987 GAACAGAGGCTCCCAGAGAAGGG + Intronic
1049951980 9:654040-654062 AAACTGAGGCTGAAATTGAGTGG + Intronic
1050279668 9:4037067-4037089 AAACTGGTGCTCAGAGAGTGGGG - Intronic
1050510055 9:6384760-6384782 AAATTTAGGCTCACAGACTGAGG + Intergenic
1051038566 9:12778289-12778311 AGAATGAGGGCCACAGAGAGCGG - Intronic
1051135581 9:13916648-13916670 AAACTGAGGCACAGAGAATGAGG - Intergenic
1051352730 9:16213741-16213763 AAACTGAGACAGACAGAGGGTGG - Intronic
1051470982 9:17441791-17441813 AAAGTGAGTCTCATAGAGACAGG - Intronic
1051752777 9:20361065-20361087 AAACTGAGACTCAGAAAGACTGG + Intronic
1051866642 9:21690969-21690991 AAACTGAGGCTCAGAGGGATTGG - Intergenic
1052242145 9:26286715-26286737 AAACTAAGGCCCATACAGAGGGG - Intergenic
1052340839 9:27362736-27362758 AAAATCCAGCTCACAGAGAGTGG + Intronic
1052797845 9:32940317-32940339 GAACTGGGTCTCACAGAAAGAGG + Intergenic
1053262679 9:36683444-36683466 AAACTGAAGCACACAAAGAGTGG - Intergenic
1053373249 9:37580395-37580417 AAAAGTAGGCTCACACAGAGTGG + Intronic
1053422858 9:37991221-37991243 AAACTGAGGCTGAGACTGAGAGG + Intronic
1053451345 9:38196691-38196713 AAACTGAGGCCCAGAGAGGGTGG - Intergenic
1053572390 9:39322562-39322584 AAACTGACGTTCAAAGAGATTGG - Intergenic
1054093951 9:60881274-60881296 AAACTGACGTTCAAAGAGATTGG - Intergenic
1054115425 9:61157194-61157216 AAACTGACGTTCAAAGAGATTGG - Intergenic
1054124755 9:61296449-61296471 AAACTGACGTTCAAAGAGATTGG + Intergenic
1054592331 9:67025348-67025370 AAACTGACGTTCAAAGAGATTGG + Intergenic
1054827194 9:69585386-69585408 AGACTGAGGCTCAAGGAAAGGGG + Intronic
1055038117 9:71839702-71839724 AAAGTAAGGATCACAGTGAGAGG - Intergenic
1055574765 9:77649416-77649438 AAACTGAGGAGCACATTGAGTGG + Intergenic
1056040682 9:82663077-82663099 AATCAGAGGGTCACAGACAGGGG - Intergenic
1056117471 9:83454815-83454837 AAACAGAGCCTGACAGAGGGTGG - Intronic
1056181722 9:84090199-84090221 AAAGGGAGGCTCAAGGAGAGAGG + Intergenic
1056471098 9:86904987-86905009 CAACTCAGGAGCACAGAGAGAGG + Intergenic
1056710558 9:88989555-88989577 AAACGGAGCCTCACTGAAAGAGG + Intergenic
1057209751 9:93193269-93193291 AAACCGAGGCTCGCAGAAACAGG - Intronic
1057217128 9:93235257-93235279 AGACTGAGGCTCAGAGAGGCTGG + Intronic
1057334722 9:94146897-94146919 AAACTGAGGCACAGAGAGGTAGG - Intergenic
1057753300 9:97809656-97809678 AAACTGAGGCTCAGAGAGTAAGG - Intergenic
1057785232 9:98082376-98082398 AAACTGAGGCCCATACAGGGTGG - Intronic
1057847848 9:98539185-98539207 AAACTGAGGTTTGCAGAGGGTGG - Intronic
1057890477 9:98866342-98866364 AAACTGAGACTCAAAGAGAATGG + Intergenic
1058372667 9:104287942-104287964 AAACTGAGGCTCAGAGATATTGG - Intergenic
1058767129 9:108192478-108192500 AAACTGAGGCTCTGAGGGTGGGG - Intergenic
1059374116 9:113869009-113869031 AAACTGGGGCTCAGAGACAGTGG + Intergenic
1059391389 9:114001761-114001783 AAACTGAGGCCCAGAGATGGGGG + Intronic
1059699657 9:116762953-116762975 AAACTGAGGCTCAGAGAAATTGG + Intronic
1059712244 9:116879168-116879190 AATCTGAGGCCCATAGAGGGTGG - Intronic
1059723579 9:116985090-116985112 AAACTGAGCCCCAGAGAGGGAGG - Intronic
1059784089 9:117561850-117561872 CAACTGAGGATCAAAGAGACTGG + Intergenic
1059899500 9:118907489-118907511 TCACTGAGGCTCTCAGAGAGAGG + Intergenic
1060128527 9:121073890-121073912 AAACTGAGACACAGAGAGAGAGG + Intergenic
1060148444 9:121271006-121271028 AACCAGAGGCTCAGAGAGATAGG - Intronic
1060185908 9:121564063-121564085 AAACTGAGGCTCCAAAAGAAAGG - Intergenic
1060196208 9:121625138-121625160 AAGTAGAGGCTCAGAGAGAGAGG + Intronic
1060210086 9:121704847-121704869 AAACTGAGGCACACAGTCAAAGG + Intronic
1060521759 9:124298097-124298119 AAACCGAGGCTCAGAGGAAGAGG - Intronic
1060546442 9:124464432-124464454 AAACTGAGGCTCAGAAAGGAGGG - Intronic
1060740433 9:126094308-126094330 AAACTGAGGCTCAGAGTGGTTGG - Intergenic
1060952236 9:127611898-127611920 AAACGGAAGCTCCCAGAAAGAGG + Intergenic
1060971913 9:127743126-127743148 AAACTGAGGCTCGCTGAGAAAGG - Intronic
1060994461 9:127868212-127868234 AAACCAAGGCCCAGAGAGAGGGG + Intronic
1061159362 9:128884295-128884317 AAACTGAGGCACACACTGATGGG + Intronic
1061164498 9:128914432-128914454 AAACTGAGGCCCAGAGAGGGAGG + Intronic
1061211385 9:129195408-129195430 AAACTGAGGCCCAGAGAGGGGGG + Intergenic
1061217821 9:129231885-129231907 AAACTGAGGCTCACAGAGGTGGG + Intergenic
1061258579 9:129466970-129466992 AAAGTGAGGGTCAAAGAGGGTGG + Intergenic
1061430166 9:130525993-130526015 AGACTGAGGCCCATAGAGAAGGG + Intergenic
1061766196 9:132882923-132882945 AAAGTGAGGCTCAGAGGGAAAGG - Intronic
1061856395 9:133443993-133444015 AAACTGAAGCCCACAGAGGAGGG - Intronic
1061885790 9:133590505-133590527 AAACGGAGGCACAAAGAGGGAGG + Intergenic
1062026346 9:134342444-134342466 AAACTGAGGCACAGAGAGCAGGG + Intronic
1062055731 9:134468934-134468956 AAACTGAGGCCCAGAGACAGGGG - Intergenic
1062190618 9:135246081-135246103 AAACTGAGGCCCGGGGAGAGAGG + Intergenic
1062195830 9:135273442-135273464 AAGCTGAGGCTCAGAGAGGCAGG + Intergenic
1062196895 9:135279407-135279429 AAGCTGAGGCTCAGAGAGGTGGG + Intergenic
1062384423 9:136303521-136303543 AAACTGAGTCTCAGAGAGGCCGG + Intronic
1062735485 9:138135064-138135086 AAACTGAGGCTCAGAGACCTGGG - Intergenic
1203753263 Un_GL000218v1:99364-99386 AGACTGGGGCCCACAAAGAGAGG - Intergenic
1203712682 Un_KI270742v1:111919-111941 AGACTGAGGCCCACCAAGAGAGG - Intergenic
1203556277 Un_KI270743v1:210238-210260 AGACTGAGGCCCACCAAGAGAGG - Intergenic
1186121994 X:6373405-6373427 AAACTGCGGGTCACAGGGTGTGG - Intergenic
1186163444 X:6802229-6802251 AAACTGAGGCTCGAAGAGGATGG + Intergenic
1186519225 X:10190956-10190978 GAGGTGAGGCTTACAGAGAGAGG - Intronic
1186573937 X:10745342-10745364 TAACTGAGCCCCACAGAAAGTGG + Intronic
1186661266 X:11669643-11669665 AAAATTAGGCACACAGAGTGGGG - Intergenic
1186676564 X:11823426-11823448 AACCTGAGGCTCACAGACATTGG + Intergenic
1186712412 X:12213114-12213136 AAACTGAGGCTCAGAAACACAGG - Intronic
1186980257 X:14950981-14951003 AAACTGAGGCTCACAGAGGTCGG + Intergenic
1187233112 X:17441281-17441303 AGACTGAGGCTCAGAGAGGTTGG + Intronic
1187657584 X:21495251-21495273 AAACTGAGGCACAGAGAGGCTGG - Intronic
1188593754 X:31871464-31871486 AAACTGAGGCTCACAGAGAGAGG + Intronic
1188845785 X:35070403-35070425 GAACACATGCTCACAGAGAGGGG - Intergenic
1188937289 X:36192498-36192520 AAACCCAGGATCACACAGAGTGG - Intergenic
1190630746 X:52383179-52383201 AAACTGAGGCTTAGAGATTGAGG + Intergenic
1190633202 X:52409493-52409515 AAACTGAGGCTTAGAGATTGAGG - Intergenic
1190679660 X:52814028-52814050 AAACTGAGGCTCAGAGATAGAGG + Intronic
1190878858 X:54478597-54478619 AAACTGAGGCTCAGGTAGATGGG - Intronic
1190907279 X:54739391-54739413 ACACTGGGGCTCACAAAGAGTGG - Intergenic
1191786433 X:64921594-64921616 AAAATGAGGCCCAGAGAGAAGGG + Intronic
1191801969 X:65091679-65091701 AAACTGAGGTTCAGAGTAAGTGG + Intergenic
1192180242 X:68911853-68911875 AAACTGAGGCCCAGAGAGAAAGG + Intergenic
1192192044 X:68996773-68996795 AAACTGAGGTTCAGAGAGGCAGG + Intergenic
1193611354 X:83635046-83635068 TAGCTGAGGCTGAGAGAGAGAGG + Intergenic
1195152221 X:102083697-102083719 ACACTGAAGCTCACATAGAATGG + Intergenic
1195596983 X:106703420-106703442 AAACTGAGACACAGAGAGATTGG + Intronic
1196068441 X:111491863-111491885 AAACCAAGGCTCACAGGGTGTGG - Intergenic
1196371351 X:114983042-114983064 CAACTGAGGGTGATAGAGAGAGG + Intergenic
1196710173 X:118754197-118754219 AAACTAAGGCTGAGAGAGAAGGG - Intronic
1197063931 X:122216470-122216492 AAACTGAGGCTCAGAGAAAAAGG + Intergenic
1197761831 X:130033466-130033488 AAAGTGGGGCTCAGAGAGGGAGG + Intronic
1198103299 X:133440265-133440287 AAACAGAGGCACCCTGAGAGGGG + Intergenic
1198482608 X:137054521-137054543 AAACTGAGGCTCTGAGTCAGAGG - Intergenic
1198822363 X:140662235-140662257 AAAGTAAGGCTCAAAGAGAAGGG + Intergenic
1198965160 X:142220448-142220470 AAACTGAGGCACAGAGAGACTGG - Intergenic
1199473496 X:148220937-148220959 AAAATGAGGCTCAATGAGATTGG + Intergenic
1200116305 X:153771176-153771198 AGACTGGGGCCCACAGACAGAGG - Intronic
1200397705 X:156000917-156000939 AAACTGAGGCTCAGAGACCTGGG - Intronic
1201166909 Y:11216933-11216955 AGACTGGGGCCCACAAAGAGAGG - Intergenic
1201584281 Y:15543720-15543742 AAACTAAGACTCAGAGAGATTGG - Intergenic
1201931158 Y:19350380-19350402 AAACACATGCACACAGAGAGGGG + Intergenic