ID: 1188595241

View in Genome Browser
Species Human (GRCh38)
Location X:31892332-31892354
Sequence TGATGGGCATAGAACTTCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188595237_1188595241 -2 Left 1188595237 X:31892311-31892333 CCTGTAAATTACGTGTAGCCTTG 0: 1
1: 0
2: 0
3: 2
4: 44
Right 1188595241 X:31892332-31892354 TGATGGGCATAGAACTTCACCGG 0: 1
1: 0
2: 1
3: 10
4: 109
1188595236_1188595241 -1 Left 1188595236 X:31892310-31892332 CCCTGTAAATTACGTGTAGCCTT 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1188595241 X:31892332-31892354 TGATGGGCATAGAACTTCACCGG 0: 1
1: 0
2: 1
3: 10
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188595241 Original CRISPR TGATGGGCATAGAACTTCAC CGG Intronic
904948148 1:34214382-34214404 TGATGTGCATAAATCTTCCCTGG - Intronic
906230726 1:44161299-44161321 GGATGGGCACAGAACTGCATAGG - Intergenic
906972811 1:50534681-50534703 TGATTGATATACAACTTCACGGG + Intronic
910189482 1:84581052-84581074 TGCTGGGGATAAAACTGCACCGG - Intergenic
911578487 1:99606493-99606515 TGATATGCATATAACATCACTGG + Intergenic
912004066 1:104873892-104873914 GGTTGGGCATAGAGCTTCAATGG + Intergenic
912113956 1:106380486-106380508 TCATGGGCAGAAACCTTCACAGG - Intergenic
915659415 1:157389759-157389781 TGATGAGCATAGAAAATCCCTGG + Intergenic
920399461 1:205668146-205668168 TTATGGGCTTGGAACTTCTCAGG - Intronic
1064350274 10:14569830-14569852 AGATGGACAGAGAGCTTCACAGG + Intronic
1065501903 10:26391651-26391673 GGATTGGGATAGAAGTTCACGGG - Intergenic
1066561580 10:36675588-36675610 TCATGGACATTGAACTCCACTGG + Intergenic
1071984650 10:91038171-91038193 CGGTGGGCATTGAACTCCACTGG - Intergenic
1074219274 10:111420471-111420493 TCATGGGCATAAACCTCCACAGG - Intergenic
1075161072 10:120024982-120025004 TCATGGCCATAAAACTTCCCTGG - Intergenic
1077663220 11:4087210-4087232 TGCTGGGCATAGGGGTTCACTGG + Intronic
1080351095 11:31386572-31386594 TGTTGGGCCTTGAACATCACTGG + Intronic
1083228372 11:61299212-61299234 TGATGGGCTTAGAAATTCACTGG - Intergenic
1085032105 11:73278486-73278508 TAATGGGCATAGAGTTTCAGTGG - Intronic
1085897952 11:80662419-80662441 TGATGAACATAGAACTTTCCTGG + Intergenic
1086514846 11:87599926-87599948 TGAGGTCCAAAGAACTTCACTGG + Intergenic
1090777137 11:129975560-129975582 TGGTGGGAATGGGACTTCACTGG + Intronic
1093066100 12:14659823-14659845 TCATGGGCATAGCATTGCACTGG + Intronic
1093450844 12:19311728-19311750 TGAGGGGTTTAGAACTTCAGTGG - Intronic
1098103420 12:67043151-67043173 TGATGGCCATAGAACTGCAAGGG - Intergenic
1101009715 12:100436985-100437007 TAATGGGGATAGAAAGTCACAGG - Intergenic
1106913714 13:34489445-34489467 TAATGGGCACAGAATTTCACTGG - Intergenic
1112807844 13:103182686-103182708 TGATGGGCTCAGCACCTCACAGG + Intergenic
1116361659 14:44005986-44006008 TAATGAGCATAGTACCTCACAGG + Intergenic
1120757068 14:88254385-88254407 TGAAGGGAATAGCATTTCACGGG - Intronic
1122076824 14:99241227-99241249 TGCTGGGCAGAGAACTTCCTGGG - Intronic
1126388796 15:48122712-48122734 TTCTGAGCATAGACCTTCACTGG + Intronic
1131137277 15:89947280-89947302 TCATGGCCATAAAACTTCCCTGG + Intergenic
1135422297 16:22313526-22313548 TGGTGGGCCTAGGCCTTCACGGG + Intronic
1137339682 16:47589039-47589061 AGATGGGTATAGAACATCATTGG + Exonic
1137507237 16:49064916-49064938 TCATGTGCAAAGCACTTCACAGG + Intergenic
1140629962 16:76839855-76839877 TGATGGGGAGAGAAATCCACAGG - Intergenic
1142673184 17:1496918-1496940 GGGTGGGCATGGAACTCCACTGG + Intronic
1153178264 18:2403881-2403903 TCATGGGGAGAGAAATTCACAGG - Intergenic
1155244411 18:23893649-23893671 TGATGGGCATACAATGTCAGTGG - Intronic
1156642524 18:39119618-39119640 TCCTGGGAATATAACTTCACTGG + Intergenic
1157312299 18:46561316-46561338 GGATGGGCATAGCACATAACTGG + Intronic
1161115172 19:2492794-2492816 TGGTGGGATTAGAACTGCACAGG + Intergenic
1162187431 19:8916870-8916892 TGGTGGGCATAGAGCTTCGATGG + Exonic
1163343161 19:16722963-16722985 TGCTGGCCATACAACTTCACTGG + Intronic
1167567197 19:50264153-50264175 TGTTGTCCACAGAACTTCACTGG - Intronic
927614984 2:24584538-24584560 TGAGGGGCTTAGAAATTAACAGG + Exonic
929019539 2:37538157-37538179 TGATGGGAAAAGAAATTCAGTGG - Intergenic
931943638 2:67281201-67281223 TGATCAGAATAGCACTTCACAGG - Intergenic
937182750 2:120011336-120011358 TGCTGGGCATAGCCCTTCATAGG + Intergenic
945196186 2:207239442-207239464 TCATGGGTAAAGAACTCCACTGG - Intergenic
1175317517 20:58059368-58059390 TGCAGGGCAGAGAACTTCAGAGG + Intergenic
1179059750 21:37968719-37968741 TGGTGGGCGTAGAACTTCCCAGG + Intronic
949936949 3:9123208-9123230 TAATGGGGATAGAATTTCAGTGG + Intronic
950755751 3:15170778-15170800 TGATCGTCAAAGAACATCACAGG + Intergenic
951172011 3:19553860-19553882 TGATGGTCATAGATGTTCATTGG + Intergenic
952759469 3:36901300-36901322 TCATGGCCATAAAACTTCCCTGG - Intronic
955538269 3:59947764-59947786 TGCTGGCCAAAGCACTTCACTGG + Intronic
955835680 3:63052179-63052201 TGAAGGGCTTGGAAGTTCACTGG + Intergenic
956746488 3:72314903-72314925 TGCTGGGCATAGGGCTTCAGTGG + Intergenic
957768071 3:84651598-84651620 AGATGAACATATAACTTCACTGG + Intergenic
960143285 3:114171928-114171950 TGTGGGGCAGAGAACTCCACAGG - Exonic
962066386 3:131985711-131985733 TGATGGGCATATGACTTAATTGG - Intronic
965477383 3:169173827-169173849 TGAAGGCCAAGGAACTTCACAGG + Intronic
967379393 3:188840774-188840796 TGATGGGCAAGCCACTTCACTGG - Intronic
967722219 3:192827801-192827823 ATATGTGCATAGAAGTTCACTGG + Intronic
968754659 4:2409109-2409131 TGATGGCCATGCAACTCCACGGG - Intronic
969871320 4:10106901-10106923 TGATGGGGACAGAGCCTCACAGG - Intronic
972863269 4:43199014-43199036 TGATGGGGATACAACTTAAAAGG + Intergenic
974368999 4:60989399-60989421 TAAGGGGCAGAGAACCTCACAGG + Intergenic
975852878 4:78590617-78590639 TGATGGGCACTGCACATCACAGG + Intronic
990804091 5:59638421-59638443 TGTTAGGCATAGAACTGCTCAGG - Intronic
993685589 5:90933702-90933724 TGGAGGGCAGAGAACTTCCCGGG - Intronic
994895130 5:105693363-105693385 TCATGGCCATAAAACTTCCCTGG - Intergenic
999713538 5:154340152-154340174 TGATGGGAATAGGACTTGGCTGG - Intronic
1005183136 6:23130104-23130126 TAATGGTTATAGAAATTCACTGG + Intergenic
1007940667 6:45778105-45778127 TGATGTGCATAGAATTTTACTGG + Intergenic
1008376060 6:50793650-50793672 TGATGCCCAAAGAACTTCAGAGG + Intergenic
1014391240 6:120868088-120868110 TGATGGGCATAAAACATTACTGG + Intergenic
1015176053 6:130310695-130310717 TGTAGGGCATAGAAATACACAGG - Intronic
1015496066 6:133884565-133884587 TGATGGGCATAAAACAATACAGG - Intergenic
1015674695 6:135732134-135732156 TGATGGGCATAAAAGAACACTGG - Intergenic
1016062168 6:139642404-139642426 TGATGGGCAATGATCATCACTGG - Intergenic
1018067731 6:160135385-160135407 TGAAGGGCAAAGAACTCCACAGG + Intronic
1018799552 6:167211287-167211309 GGATGGGAATAGAACATCCCTGG - Intergenic
1021530102 7:21634701-21634723 TAATGGGCATAGTACCTGACAGG - Intronic
1026465565 7:70650725-70650747 TAATGGTCACAGAAGTTCACTGG - Intronic
1032495403 7:132357835-132357857 TGGTGGTCTTAGAACTCCACAGG + Intronic
1034093679 7:148387007-148387029 TCATGGCCATAAAACTTCCCTGG + Intronic
1034255307 7:149721513-149721535 TGATGGGGAGAGGACTTCCCTGG - Exonic
1039279452 8:35967771-35967793 CAATGGGCAAAGATCTTCACAGG + Intergenic
1039387487 8:37148959-37148981 TCATGGGCACAGAACTTACCTGG - Intergenic
1039615391 8:38951216-38951238 TGTTCGGCACAGAACTGCACAGG - Intronic
1041642282 8:60216231-60216253 TGCTGCTCATAGAATTTCACAGG - Intronic
1042386304 8:68178855-68178877 TGATTGCAATACAACTTCACTGG - Intronic
1045427362 8:102080489-102080511 AGCTGGTCATAGAACTTCAGGGG + Intronic
1047608608 8:126498676-126498698 AGAGGGGCATAGCACTTCAAGGG + Intergenic
1047901881 8:129431815-129431837 TGGTGGGAACATAACTTCACTGG - Intergenic
1048930446 8:139311213-139311235 TAATGGTAAGAGAACTTCACTGG - Intergenic
1048974444 8:139663033-139663055 TGAGGGGCTTAGAACAGCACTGG - Intronic
1050406169 9:5310463-5310485 TGATAGGAATGGAACTTCAATGG - Intergenic
1050439487 9:5646232-5646254 CAATGGGCAAAGAACTTCAACGG - Intronic
1052317940 9:27135791-27135813 AGATAGGCATAGCACTGCACAGG + Intronic
1052378611 9:27745090-27745112 TGAAGAGCAGAGAACTTCACTGG - Intergenic
1055648571 9:78384535-78384557 TGATGGGCATAGCACCATACCGG + Intergenic
1060533675 9:124365464-124365486 TGATTGCCAGAGAACCTCACAGG + Intronic
1186975906 X:14904706-14904728 TGTTGAGCATATTACTTCACTGG + Intronic
1187356544 X:18578387-18578409 TGATAGGTATACAACTTGACTGG + Intronic
1188595241 X:31892332-31892354 TGATGGGCATAGAACTTCACCGG + Intronic
1188755983 X:33964293-33964315 TAATGAGCATAGTACTCCACTGG + Intergenic
1188821218 X:34777447-34777469 TGGGGGGCTTAGAACTTCAAGGG + Intergenic
1189969806 X:46406544-46406566 TGAAGGGCTATGAACTTCACTGG + Intergenic
1190187841 X:48251395-48251417 TGATAGGCTTAGAATTTCCCTGG - Intronic
1193062020 X:77216963-77216985 TGAAGGGCAGAGAACTTTTCAGG + Intergenic
1193742888 X:85240144-85240166 AGATGGGCAAAGAACTTAAATGG + Intergenic
1197912419 X:131497722-131497744 TGATGGGGATAGCACATCACTGG + Intergenic
1198667068 X:139036504-139036526 AGATGAGCATAGAGCTTCTCTGG + Intronic
1199786943 X:151114334-151114356 TGCTGGCCAAAGTACTTCACTGG + Intergenic
1200235082 X:154464251-154464273 TGAGGGGCAGAGCAGTTCACCGG - Exonic
1200448250 Y:3291452-3291474 TGATGGGCACTGAAATACACAGG - Intergenic
1200665128 Y:6012720-6012742 TGATGGCCAAAGAGCTTCACTGG + Intergenic