ID: 1188596011

View in Genome Browser
Species Human (GRCh38)
Location X:31900967-31900989
Sequence TTGTATGTGCATATGGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 305}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188596005_1188596011 4 Left 1188596005 X:31900940-31900962 CCCCTGTGAGTGGATTATCAGTA 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1188596011 X:31900967-31900989 TTGTATGTGCATATGGGGAAAGG 0: 1
1: 0
2: 3
3: 23
4: 305
1188596007_1188596011 2 Left 1188596007 X:31900942-31900964 CCTGTGAGTGGATTATCAGTATT 0: 1
1: 0
2: 0
3: 13
4: 135
Right 1188596011 X:31900967-31900989 TTGTATGTGCATATGGGGAAAGG 0: 1
1: 0
2: 3
3: 23
4: 305
1188596006_1188596011 3 Left 1188596006 X:31900941-31900963 CCCTGTGAGTGGATTATCAGTAT 0: 1
1: 0
2: 1
3: 16
4: 131
Right 1188596011 X:31900967-31900989 TTGTATGTGCATATGGGGAAAGG 0: 1
1: 0
2: 3
3: 23
4: 305
1188596004_1188596011 7 Left 1188596004 X:31900937-31900959 CCTCCCCTGTGAGTGGATTATCA 0: 1
1: 0
2: 1
3: 8
4: 134
Right 1188596011 X:31900967-31900989 TTGTATGTGCATATGGGGAAAGG 0: 1
1: 0
2: 3
3: 23
4: 305
1188596003_1188596011 8 Left 1188596003 X:31900936-31900958 CCCTCCCCTGTGAGTGGATTATC 0: 1
1: 0
2: 0
3: 7
4: 127
Right 1188596011 X:31900967-31900989 TTGTATGTGCATATGGGGAAAGG 0: 1
1: 0
2: 3
3: 23
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188596011 Original CRISPR TTGTATGTGCATATGGGGAA AGG Intronic
903053012 1:20615572-20615594 TTATATGTACGTTTGGGGAAAGG + Intronic
904770442 1:32878268-32878290 TTGGATGTGCATGTGTGCAAAGG + Intergenic
906360426 1:45152577-45152599 TTATTTTTGCATATGGTGAAAGG - Intronic
906726190 1:48046185-48046207 GTGTATGTGCATATAGGGTGTGG + Intergenic
906754273 1:48293811-48293833 TTGTGTGTGTATATGGGGGTTGG - Intergenic
906978361 1:50600506-50600528 TTGTGTGTGTATATGTGGCAAGG - Intronic
908069696 1:60444871-60444893 TTGTTTGTGCATCTGTGAAATGG - Intergenic
908382877 1:63613090-63613112 TTGTTTGTGTATATGGAGCATGG + Intronic
911009194 1:93261721-93261743 TAATATGTGAATATGGGGGATGG - Intronic
912604623 1:110976544-110976566 TTGTATGTGTATATGTAAAAGGG + Intergenic
913466362 1:119147245-119147267 TGTTCTGTGCATCTGGGGAAGGG - Intergenic
914990597 1:152496546-152496568 TTGTATGTTCCTATGTGGCAGGG + Intergenic
915329092 1:155098433-155098455 CAGTATATGCATATGAGGAAAGG - Intergenic
915351433 1:155229037-155229059 TGGAATGTGCAAATGGGTAATGG + Intergenic
915354216 1:155246217-155246239 TGGAATGTGCAAATGGGTAATGG + Intergenic
916348118 1:163817459-163817481 TTATATGTTTATATGGGAAATGG - Intergenic
916475763 1:165167377-165167399 TTGTATGTGGATATGTGTAATGG - Intergenic
919033365 1:192274367-192274389 ATGTGTGTGCATGTGGGCAAAGG - Intergenic
919517919 1:198550306-198550328 TTTTATGGGTATATGGGAAAGGG + Intergenic
920904204 1:210145684-210145706 TGGCATGTGTATATGGGGAGGGG - Intronic
922879160 1:228966695-228966717 TTGTTTATGCATTTGGGGAGGGG + Intergenic
923900404 1:238320192-238320214 CTGTATGTGCACTGGGGGAATGG + Intergenic
924327661 1:242911875-242911897 TTGTATCTGCAGATGGAGGAAGG - Intergenic
924903656 1:248429289-248429311 TTGTTTGTTCATATGGGGAATGG - Intergenic
924924212 1:248662706-248662728 TTGTTTGTTCATATGGGGAATGG + Intergenic
1062772525 10:114229-114251 ATGTGTGTGCATATAGGGATGGG + Intergenic
1064817302 10:19280608-19280630 TTGTATGTGCATTTTGGCAATGG - Intronic
1065425902 10:25603379-25603401 TGGTATGAGCAGATGGGAAAAGG - Intergenic
1065560240 10:26956798-26956820 TTCTATTTGCATAAGGGAAATGG - Intergenic
1066495476 10:35937910-35937932 TTTTATGTGGACATGGAGAAAGG - Intergenic
1069215609 10:65815217-65815239 TTGTGTGTGCTGCTGGGGAAAGG + Intergenic
1071133364 10:82422229-82422251 TTATATGTGTGTTTGGGGAAAGG + Intronic
1073843420 10:107524904-107524926 TTGAATGGGCATAAGGGAAAAGG + Intergenic
1074957593 10:118407622-118407644 TGTTATGTGTATATGGGGAAGGG - Intergenic
1076600837 10:131656048-131656070 TTCTATGGGTATATGAGGAAAGG - Intergenic
1078307595 11:10205719-10205741 TGGTATCTGCCTTTGGGGAAAGG - Intronic
1078752241 11:14176218-14176240 GTGTGTTTGCATATGTGGAAGGG - Intronic
1080108121 11:28533561-28533583 TGGTATGAGCATATTGAGAAAGG - Intergenic
1082665080 11:55965902-55965924 TTACATGTGCATATTAGGAATGG - Intergenic
1084609061 11:70189853-70189875 TTGTATTTGCATATGGGTGCAGG + Intergenic
1088809899 11:113385207-113385229 TTGTAGGTAGATATGGGTAAAGG + Intergenic
1090380670 11:126325409-126325431 ATGTGTGTGCATTTGGTGAAGGG + Intronic
1091645469 12:2269321-2269343 GTGTATGTGCTTAAGGGGATGGG + Intronic
1092810310 12:12266603-12266625 TTGTATGTGTCTAGGGGGAGGGG - Intronic
1093787142 12:23206047-23206069 TTATATGTGCATTTGGGGTATGG - Intergenic
1093791953 12:23262097-23262119 TTGTGTGTGTATATGGGGAAGGG + Intergenic
1094163045 12:27412017-27412039 TAGTTTGTGTATATGGGGTAAGG + Intronic
1094667917 12:32539726-32539748 TTTTAACTGCATTTGGGGAAGGG - Intronic
1096089067 12:48886410-48886432 ATGTGTATGCATATAGGGAAGGG + Intergenic
1097445117 12:59661120-59661142 TGGTATGTGAATGTTGGGAAGGG + Intronic
1098901647 12:76117410-76117432 TTGTGTGTGCGTATGTGAAATGG - Intergenic
1100624085 12:96311979-96312001 GTATATGTGTATATGGGGGAGGG + Intronic
1101915870 12:108895489-108895511 GTGTATGTGCATATGTGTGATGG + Intronic
1102597347 12:114002953-114002975 TTGTATTTGGAGATGGGGGAGGG - Intergenic
1104105946 12:125659413-125659435 TTGTATATGTATCTGGGGCAGGG + Exonic
1104139739 12:125975773-125975795 TTGTGTGTGCCGACGGGGAAAGG + Intergenic
1106332053 13:28748396-28748418 GTATATGTGCACATGGGGAAAGG - Intergenic
1106357830 13:29001037-29001059 AAGCATGTGCATATGGGCAAGGG - Intronic
1106529453 13:30576107-30576129 TTGTATATGCATTTGGGGAGAGG - Intronic
1107797256 13:44065346-44065368 TGATATGTGCATTTGGGAAATGG + Intergenic
1108020123 13:46119860-46119882 TTGTATGTACAAATAGAGAATGG + Intergenic
1108127876 13:47264171-47264193 TTGTAGGTGAGGATGGGGAAGGG + Intergenic
1108460109 13:50657278-50657300 TCATATGTGCAAATGTGGAAAGG + Intronic
1108549218 13:51526528-51526550 TTGTATGTGAATTTGAGGATAGG + Intergenic
1108600491 13:51989574-51989596 TTGTATGTACATATGTGGTGAGG - Intronic
1109277949 13:60322863-60322885 TTGTAGCTGCAGATGGGGACTGG + Intergenic
1110512819 13:76372564-76372586 TTGTATCTCCCTATGGAGAAAGG - Intergenic
1110570613 13:76998890-76998912 ATGTAGGTGGAAATGGGGAAAGG - Intronic
1110656379 13:78004977-78004999 GTGTCTGTGCATATTGGGGAGGG + Intergenic
1112123700 13:96441073-96441095 TTGAATCTGCATATGGTGGAGGG - Intronic
1112144619 13:96684529-96684551 CTGTATGCGCATATTGGTAAGGG + Intronic
1112636642 13:101224107-101224129 TTGTTTGTGTATGTGGTGAAGGG - Intronic
1112651598 13:101405133-101405155 GTAAATGTGCATATAGGGAAAGG - Intronic
1113009745 13:105750315-105750337 ATTTATGTGGATATGAGGAAAGG + Intergenic
1113607220 13:111618061-111618083 GTTTCTGTGCATATGGTGAAGGG - Intronic
1113978486 13:114250938-114250960 TTGCATGAGCATGTGAGGAAGGG - Intronic
1115859598 14:37669265-37669287 TTGGAAGTGCATCTGGGGATGGG + Intronic
1115861715 14:37694063-37694085 TTGCCTGTGCTTATGGGGTATGG - Intronic
1117562535 14:56955943-56955965 TGGAATGTGCATATGGAGAGTGG - Intergenic
1117645263 14:57844938-57844960 TTGTATGTGCATGGGGGGGTGGG - Intronic
1119704494 14:76775445-76775467 TTGCATGTGGATATGGGGAGAGG + Intronic
1119827009 14:77665355-77665377 TTGTAAATGCATGGGGGGAAAGG - Intergenic
1121936664 14:98025899-98025921 GTGTGTGTGCATATGAGCAAGGG - Intergenic
1122014060 14:98778422-98778444 TTGTGTGTGCATGTGTGGCAAGG + Intergenic
1122329136 14:100901272-100901294 GCGTGTGTGCATATGGGGGATGG - Intergenic
1122455302 14:101845663-101845685 TTTTATTTGCATATGAAGAAAGG - Intronic
1125059011 15:35396473-35396495 TTGTATCAACACATGGGGAAGGG - Intronic
1127261963 15:57332943-57332965 TTTTCTGTGAATATGGGGATGGG - Intergenic
1128213534 15:65918250-65918272 ATTTATGTGCAAATGGAGAAGGG - Intronic
1128296527 15:66525471-66525493 TTGTATATGTATGGGGGGAAGGG - Intronic
1128437247 15:67665437-67665459 CTGTATGTACATTTGGGGAATGG + Intronic
1129343350 15:74900626-74900648 TGGTCTCTGCAGATGGGGAAGGG + Exonic
1129478777 15:75806840-75806862 TTATAAGTGGATGTGGGGAAAGG + Intergenic
1130775149 15:86971486-86971508 AAGTATGTGGATATGGGGAGAGG + Intronic
1131568903 15:93512483-93512505 ATGTATATGCATTTGTGGAAAGG + Intergenic
1132002951 15:98198192-98198214 TTGTGTGTGCATATGTGCACAGG - Intergenic
1132179275 15:99739849-99739871 TTGGCTGTGCACGTGGGGAAAGG + Intergenic
1134888587 16:17818104-17818126 TTGTAAATGCATATGGGGTTAGG + Intergenic
1136396857 16:29997326-29997348 ATGTATTTGCCTATGGGGTACGG - Intronic
1137559520 16:49493741-49493763 TAGGATGTGGATATGTGGAAAGG + Intronic
1137882175 16:52061375-52061397 TTCTATGTGCACATAGAGAATGG + Intronic
1138330150 16:56207002-56207024 TTGTATGTGCCCATGGGAGATGG + Intronic
1138800516 16:60021911-60021933 TGGTATGTGCATATGCTGAGAGG - Intergenic
1144365819 17:14543218-14543240 TTGGATGTGAGTATGGGGCAGGG + Intergenic
1144861364 17:18305026-18305048 TTATATGTGCACATGGGCCACGG - Intronic
1149119935 17:53150746-53150768 ATATATGTGAGTATGGGGAATGG + Intergenic
1149437005 17:56641574-56641596 ATTTATGTGCATTTGGGGTATGG - Intergenic
1149877413 17:60249786-60249808 TTTTAAGTGCTTTTGGGGAAAGG + Intronic
1151888489 17:76938230-76938252 GGGTATGTCCATATGTGGAAGGG - Intronic
1153032066 18:723506-723528 TTATATGTCCTTATGGGGATGGG - Exonic
1155806017 18:30172952-30172974 TTGTATGGCCACATGGTGAAGGG + Intergenic
1155934193 18:31738370-31738392 TTTTTTGTGCATCTGAGGAAAGG + Intergenic
1156159050 18:34337238-34337260 TAATATGTGCATATGGTTAATGG - Intergenic
1165127315 19:33608182-33608204 CTGTATGTGCCTATGGGAAGGGG + Intergenic
1167414217 19:49361867-49361889 TTGTCTGGCCACATGGGGAAGGG - Intronic
926545128 2:14230567-14230589 TTGTATGTGGCTATAGTGAATGG + Intergenic
926846448 2:17146505-17146527 GTGCATATGCATGTGGGGAATGG + Intergenic
927346628 2:22051581-22051603 TTGGTTTTGAATATGGGGAAGGG - Intergenic
928811093 2:35227365-35227387 GTGTATGTGCATGTGAGAAATGG - Intergenic
928885349 2:36142183-36142205 TTGTACATGCATATGGAGGAAGG - Intergenic
929048262 2:37811991-37812013 GTGTAAGTGCATGTGGGGCAGGG + Intergenic
929934570 2:46285475-46285497 GTGTATGTGCAGATGGGGTCTGG - Intergenic
930918363 2:56721313-56721335 CCGTATGTGGAAATGGGGAAAGG + Intergenic
931176453 2:59859616-59859638 TTGTGTGTGCATATGTGTGAAGG - Intergenic
931495508 2:62802482-62802504 AAGTATGTGTGTATGGGGAAGGG - Intronic
931857136 2:66314748-66314770 GGGCATGTGCAGATGGGGAAAGG - Intergenic
932067459 2:68580819-68580841 TGGTGTGTGCATGTGGGGGAGGG + Intronic
932636408 2:73392520-73392542 TAATAGTTGCATATGGGGAATGG - Intronic
934500119 2:94853094-94853116 TTGTATTTGCATTCAGGGAATGG + Intergenic
934857262 2:97737135-97737157 ATGTGTGTGCACATGGGGATGGG + Intronic
935440131 2:103083731-103083753 TTATATGTGCTTATGAGAAATGG + Intergenic
936109434 2:109652891-109652913 TTGACTGTGCATCTGGGAAAGGG - Intergenic
937804945 2:126128569-126128591 TCATATGTGCATATGGATAACGG - Intergenic
939733754 2:145818142-145818164 TTCTTGGTGCAAATGGGGAAAGG + Intergenic
939741972 2:145919082-145919104 TTGTGTCTGCATATGTGAAAGGG - Intergenic
940354995 2:152730917-152730939 TTATGTGTGTAAATGGGGAAAGG - Intronic
940735349 2:157444835-157444857 CTGCATGTGCATATGGGTCAAGG + Intronic
940893076 2:159054248-159054270 TTGTCTGTGCCTTTGTGGAATGG + Intronic
940898869 2:159108165-159108187 TTTTCTCTGGATATGGGGAAAGG - Intronic
941153710 2:161948166-161948188 TTGCATCTGCATATTTGGAAAGG + Intronic
943191868 2:184687188-184687210 TAGTTTTTGCATATGGTGAAAGG + Intronic
943758606 2:191584845-191584867 GTGTGTTTGCATATGTGGAAGGG + Intergenic
944415099 2:199471878-199471900 TTATATATGGATATGGGCAAAGG - Intergenic
946642925 2:221803534-221803556 CTGTATGTGTATATGAGAAAGGG - Intergenic
946686338 2:222274932-222274954 TTGTCTGTGGATATGGAAAAGGG + Intronic
946738262 2:222776086-222776108 GTGTGTGTGTGTATGGGGAAGGG - Intergenic
947508512 2:230728906-230728928 CTGTATGTGCATCTGGGGCCGGG - Intronic
948513195 2:238487105-238487127 TTGGATGTGCTTGTGAGGAATGG - Intergenic
948692612 2:239716253-239716275 TTGTGTGTGCATATGTGTGAGGG + Intergenic
948748074 2:240110121-240110143 TTCCATGTGCACCTGGGGAAGGG - Intergenic
1169138638 20:3213618-3213640 TTGTCTGAGCATTTGGGGGAAGG - Intronic
1169404599 20:5313301-5313323 TTGTTTGTGCAAAAGAGGAAAGG - Intronic
1169461531 20:5799680-5799702 TGGCATGTGCATATAGGGAATGG + Intronic
1171569247 20:26232520-26232542 TTGTATGTTCAACTTGGGAAAGG - Intergenic
1172803734 20:37596671-37596693 TTTTATGTGGAGATGGGGCACGG - Intergenic
1175754008 20:61517905-61517927 GTGTCTGTGCATTTGGGGGAGGG - Intronic
1177587946 21:23123257-23123279 TAGTAAGTTAATATGGGGAATGG + Intergenic
1179193179 21:39140692-39140714 TTTTCTCTGCAGATGGGGAAGGG - Intergenic
1180281650 22:10701664-10701686 TTGTATGTTCAACTTGGGAAAGG + Intergenic
1181924298 22:26345737-26345759 TCTTATGTGCTTCTGGGGAAAGG - Intronic
1183857170 22:40642663-40642685 TTGCATGTGTATATGGAGACAGG + Intergenic
1184313812 22:43666630-43666652 TTGCATGTGCTTATGGGAACTGG - Intronic
1185200609 22:49501834-49501856 GTGGAGGAGCATATGGGGAAAGG + Intronic
1203238892 22_KI270732v1_random:33801-33823 TTGTATGTTCAACTTGGGAAAGG + Intergenic
1203245841 22_KI270733v1_random:68381-68403 TTGTATGTGCACAAGTGAAAGGG - Intergenic
950893345 3:16425243-16425265 TTGTATGTACATGTGGGAAGAGG + Intronic
951305131 3:21050901-21050923 TTGGATGTGGATAGGGAGAAGGG - Intergenic
951858356 3:27223421-27223443 TTGGATGTGCAGATGGACAATGG - Intronic
951863098 3:27275953-27275975 TTGCATGCGCACATGGGCAAAGG - Intronic
952164279 3:30729400-30729422 TCCTATGTGAATATGTGGAAAGG + Intronic
952233778 3:31458263-31458285 TAGTAGGTGTATATGGGGACAGG - Intergenic
952265137 3:31778071-31778093 CAGTATGGGCAGATGGGGAAGGG + Intronic
952952278 3:38534364-38534386 CTGTATGTGTCTGTGGGGAAGGG + Intronic
953612786 3:44461426-44461448 TTGCATGTGTTTATGTGGAAGGG + Intronic
953725865 3:45398388-45398410 TTTTATGTACATATGTGGGATGG - Intronic
954638528 3:52084724-52084746 CAGGATGTGGATATGGGGAAGGG - Intronic
955023342 3:55142830-55142852 ATGTTTGTGTATATGGAGAATGG + Intergenic
955216874 3:56991265-56991287 ATGAATGAGCAAATGGGGAAAGG - Intronic
956478754 3:69651792-69651814 GTGTGTGTGCATTTGCGGAATGG + Intergenic
956815634 3:72905763-72905785 TTTCATGTGGATATGGGGCAGGG - Intronic
957109575 3:75935609-75935631 TTGTATGTTCAACTTGGGAAAGG + Intronic
957479477 3:80772795-80772817 TTGTATGTGCATTAGGCAAAGGG + Intergenic
959241826 3:103806921-103806943 TTGTATGTGTATATGATGAAAGG + Intergenic
959496870 3:107061771-107061793 TTGTATGTGCACATGATGGAAGG - Intergenic
959819620 3:110717612-110717634 GTGTGTGTGCAGTTGGGGAAGGG + Intergenic
961546856 3:127640259-127640281 TTGTGTGTGCACATGGGGCAAGG + Intronic
962242242 3:133759536-133759558 TTGTATGAGTGTATGGTGAAAGG + Intronic
963777519 3:149453897-149453919 ATGTATGTGCACAAAGGGAAGGG + Intergenic
964024590 3:152057488-152057510 TTTCATGTGCATATGGGACATGG - Intergenic
964222421 3:154362657-154362679 TTGTAAGTGTATCTGGGAAATGG + Intronic
964330691 3:155599018-155599040 CTGTATCTTCATATGGGGAGGGG - Intronic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
964837032 3:160950452-160950474 TTGTATGTGTAGTTGGGGTATGG - Intronic
965168602 3:165229941-165229963 CTGTATTTGCTTATGGGAAATGG - Intergenic
965507520 3:169532754-169532776 TTGTGTGTGCATGTGGGGTAGGG - Intronic
966828032 3:183981689-183981711 TTGTATGTGCATGTGGTAGAAGG - Intronic
966968214 3:185017460-185017482 CCGTATGTGGAAATGGGGAAAGG - Intronic
967263723 3:187671419-187671441 TTGTATATCTATATGTGGAAAGG + Intergenic
967295504 3:187960399-187960421 TAGTATGTTCATATGTGAAATGG - Intergenic
970234291 4:13943306-13943328 TTTTATGTGTAGTTGGGGAAAGG + Intergenic
971075329 4:23141401-23141423 TTGTATGTGTCTGGGGGGAAGGG + Intergenic
971810939 4:31425960-31425982 TTGTGTGTGCATATGTAGGATGG + Intergenic
971929094 4:33055306-33055328 TTCTTTGGGCAAATGGGGAAGGG + Intergenic
972246749 4:37252942-37252964 AAGTATGTGCATACAGGGAAAGG + Intronic
972625535 4:40795013-40795035 TCCTGTGTGCATATGTGGAAAGG - Intronic
972867064 4:43245782-43245804 TAATATTTGCATATGGTGAAAGG - Intergenic
973090960 4:46135789-46135811 TTGATTTTGCATATGGTGAAAGG - Intergenic
973237867 4:47925286-47925308 GTTTATGTGGATGTGGGGAAAGG + Intronic
974036229 4:56820903-56820925 TTCTATGTGCTTTTGGGGAGAGG - Intronic
974272178 4:59664668-59664690 TTGTGTGTGCTTATGAGCAAGGG + Intergenic
974299353 4:60043007-60043029 GTGTCTGTGCATTTGGGGGAGGG - Intergenic
974703304 4:65479496-65479518 TTGTATAGGGAAATGGGGAAAGG + Intronic
975144568 4:70953467-70953489 ATGTATGTGGAAATGAGGAACGG + Intronic
977803195 4:101263649-101263671 TTGTGTGTGCATATGGGTGGGGG - Intronic
977976902 4:103276519-103276541 CTGTATGTCCCTTTGGGGAAGGG + Intergenic
980148401 4:129017206-129017228 TTGTATGTGTGTATGTGGTAGGG + Intronic
980838048 4:138221718-138221740 TTATATATGTATATGAGGAAGGG - Intronic
980860076 4:138488500-138488522 GTATCTGTGCAGATGGGGAAAGG - Intergenic
983076855 4:163337124-163337146 ATGTATTTGTATCTGGGGAAAGG - Intronic
984435051 4:179699157-179699179 TTGCATGTTCATATGGATAAGGG + Intergenic
984464574 4:180081697-180081719 TTATATGTGCAAAAGAGGAAAGG - Intergenic
986942634 5:12973769-12973791 ATATATATGCACATGGGGAACGG - Intergenic
988171349 5:27660625-27660647 ATATATGTGCAAATGGGGAGGGG + Intergenic
988936827 5:36092216-36092238 TTCTCAGTGCAGATGGGGAAAGG + Intergenic
989068541 5:37487215-37487237 TTATATTTGCATCTGGGAAATGG - Intronic
989944942 5:50212101-50212123 TTGATTGTGCATTTTGGGAACGG - Intergenic
990171123 5:53050821-53050843 CTATATGTGCATATGGGGCAGGG - Intronic
994742229 5:103634382-103634404 TTGGACGTGCATATGTGGAGTGG - Intergenic
995283526 5:110361237-110361259 CTGTTTCTGCATATGGTGAAAGG - Intronic
997893420 5:137695020-137695042 TTGTATATGCGTATGGGGTTGGG - Intronic
999970218 5:156851998-156852020 TTGTGTGTGTATGTGTGGAAAGG - Intergenic
1000927596 5:167212840-167212862 TCCTATGTGCATATGGAGTAGGG - Intergenic
1001400268 5:171442203-171442225 TGGTGTGTCCATATGGAGAAAGG + Intronic
1001420714 5:171584915-171584937 GTGCATGTGGATATGGGGAGAGG + Intergenic
1002953759 6:1842051-1842073 GAGTATGTGAATATGGAGAATGG - Intronic
1003347300 6:5282465-5282487 TAGCCGGTGCATATGGGGAAGGG + Intronic
1004242362 6:13936290-13936312 TTGTCTGTACAGATAGGGAAAGG - Intronic
1004510852 6:16283532-16283554 TTGTATGTGCACTTGTGAAATGG - Intronic
1004710117 6:18161845-18161867 CTGTATGTGCGTATGGGAAGAGG - Intronic
1006278479 6:33026936-33026958 TTGTATTTGCATATGGTGTCAGG + Intergenic
1008351510 6:50497054-50497076 ATGTAGGTACATATAGGGAAAGG - Intergenic
1009866665 6:69406558-69406580 TTGTATGTACCTATGGGCAAAGG - Intergenic
1010469061 6:76204219-76204241 TTGTATTTGTATATGGGCAATGG - Intergenic
1011220339 6:85048452-85048474 TGGCATGTGCATATGGGGATGGG - Intergenic
1011304903 6:85915170-85915192 GTGTATGTGTATGTGGTGAAGGG + Intergenic
1012173302 6:96046638-96046660 TTGTATGTTCACATGTGGGAAGG - Intronic
1012652476 6:101773054-101773076 GTGTATGTTCATATGGGGCAGGG + Intronic
1012942320 6:105428283-105428305 ATGTATTTGCATAAGGGAAATGG - Intergenic
1013535669 6:111061051-111061073 GTGCATGTGCATGTGGGGAGGGG - Intergenic
1013742305 6:113301509-113301531 TTATGTGTGCTTATGGGGAAAGG - Intergenic
1014060300 6:117064030-117064052 CTCTATGTGCACATGGGGTAGGG - Intergenic
1017623148 6:156319191-156319213 CTGTGTGTGTATATGGGGACAGG - Intergenic
1017799007 6:157875265-157875287 TTGTTTTTGCTTTTGGGGAATGG - Intronic
1019116476 6:169767819-169767841 GTGTATGTGCATATGTGGTGTGG - Intronic
1020803058 7:12756034-12756056 TTGTCTGTGCTTATGGGGAGTGG + Intergenic
1021384837 7:20016626-20016648 ATGTAAGTGCATAAGGGCAAAGG - Intergenic
1023072789 7:36454000-36454022 TTGGATGTGCATTTGAGGATAGG + Intergenic
1023080726 7:36523811-36523833 TTGGATGTTCAGATTGGGAATGG - Intronic
1023487138 7:40699346-40699368 TTGTGTGTGCAGATGGGACAAGG + Intronic
1024502478 7:50125967-50125989 GTGTATGTGCATATGTGGTGAGG - Intronic
1025718791 7:63989996-63990018 TTGATTGTGCATGTGGGGAGAGG - Intergenic
1026399043 7:69990296-69990318 TTGTATGTGCCCAGAGGGAAGGG + Intronic
1027002866 7:74666431-74666453 TATTATGTCCATATGAGGAAAGG + Intronic
1027548842 7:79565060-79565082 GTGTATGTGTATGTTGGGAAGGG + Intergenic
1028103481 7:86849598-86849620 TAGCATGTGCCTAAGGGGAAAGG + Intronic
1030549391 7:110938967-110938989 TTGTATGTTCATATGTGAAGTGG - Intronic
1030994340 7:116340163-116340185 TAATATGTGCATATATGGAAGGG - Intronic
1033793554 7:144820676-144820698 TTGTATGTGTATATGTGGTATGG - Intronic
1034213313 7:149383703-149383725 TTGTCTGTGCTCATGGGGAGGGG + Intergenic
1034367490 7:150563878-150563900 TTGTAGCTGCATATAGGGAGTGG + Intergenic
1035040429 7:155922574-155922596 TGGCAGGTGCTTATGGGGAATGG + Intergenic
1036535339 8:9644819-9644841 TTGTATGGGCATCTGAAGAATGG - Intronic
1038519938 8:28222608-28222630 TTGTCTGTGACTATGGTGAATGG + Intergenic
1038958207 8:32489932-32489954 TTGTATGTCCCTGTGGGGAATGG + Intronic
1041925457 8:63231318-63231340 TTGTATCCTCATATGGTGAAAGG + Intergenic
1042158981 8:65873184-65873206 TTGTATGTCCATATGTGTAATGG + Intergenic
1042255018 8:66793920-66793942 AGGTATGTGGAGATGGGGAAGGG - Intronic
1042924144 8:73949987-73950009 TTGTGTGTGTATATGAGGAGTGG + Intronic
1044975352 8:97659277-97659299 TTATTTATGCATATGGGGGAAGG - Intronic
1045790644 8:105978941-105978963 CTGGATGGGCAAATGGGGAAGGG + Intergenic
1046158045 8:110319715-110319737 AAGAATGTGCATATTGGGAAAGG + Intergenic
1046656824 8:116904078-116904100 TGGTATGTGCACAGGGGTAAGGG - Intergenic
1047117138 8:121856001-121856023 TTGTATGTGGTAATGGGTAAAGG - Intergenic
1047288350 8:123507477-123507499 GTGTACGTGCACATTGGGAATGG + Intronic
1048071362 8:131024944-131024966 ATGAATGTGCATGTGGGGATTGG - Intronic
1048183138 8:132214566-132214588 GTATTTGTGCATATGGAGAAGGG - Intronic
1048968046 8:139628282-139628304 TTGTTTGTGCATCTGTGAAATGG - Intronic
1049398582 8:142413300-142413322 GTGTGTGTGCATGTGGGGCAGGG - Intergenic
1049632661 8:143666978-143667000 ATGTATGTGCACATGGAGGAAGG - Intergenic
1050270775 9:3942379-3942401 TTGTATGTGGAGATGGGAACTGG - Intronic
1050335022 9:4582504-4582526 TTGTAGGGGCAGATGGGCAAGGG - Intronic
1052497620 9:29247330-29247352 TTGTCTGTGCATAGGGTGATGGG - Intergenic
1053545151 9:39015113-39015135 TTGTAGGTGCAGAAGAGGAAAGG - Intergenic
1053657052 9:40227443-40227465 TTGTATTTGCATTCAGGGAATGG - Intronic
1053809551 9:41838306-41838328 TTGTAGGTGCAGAGGAGGAAAGG - Intergenic
1053907418 9:42856734-42856756 TTGTATTTGCATTCAGGGAATGG - Intergenic
1054369171 9:64373723-64373745 TTGTATTTGCATTCAGGGAATGG - Intronic
1054527545 9:66148781-66148803 TTGTATTTGCATTCAGGGAATGG + Intronic
1054621041 9:67349122-67349144 TTGTAGGTGCAGAGGAGGAAAGG + Intergenic
1054676801 9:67863477-67863499 TTGTATTTGCATTCAGGGAATGG - Intronic
1054849771 9:69835836-69835858 TTGTATGTTTATGTGGGGCAAGG - Intronic
1054868790 9:70029649-70029671 TTGTCTGTGCTTGTGGGGTATGG + Intergenic
1056655384 9:88504444-88504466 TGGTATGTGTATATGTGGCATGG + Intergenic
1056668917 9:88606617-88606639 TTTAATGTGCACATGGAGAAAGG - Intergenic
1056996145 9:91461370-91461392 TTGTGTGTGTATGTGGGGTAAGG + Intergenic
1058201453 9:102047114-102047136 TTATTTTTGCATATGGTGAAAGG + Intergenic
1058622640 9:106899488-106899510 GTGTCTGTGCAGATGAGGAAGGG + Intronic
1059476503 9:114551849-114551871 TTGTAGGTGAAGATGGAGAATGG - Intergenic
1060022622 9:120145359-120145381 TTCTATGTGCATTGGTGGAAAGG + Intergenic
1062664870 9:137664704-137664726 TTCTTTGTCCATATGGGGGAGGG + Intronic
1203462178 Un_GL000220v1:51452-51474 TTGTATGTGCACAAGTGAAAGGG - Intergenic
1187845844 X:23536243-23536265 TTGTATGTGTCTATTGTGAATGG - Intergenic
1188596011 X:31900967-31900989 TTGTATGTGCATATGGGGAAAGG + Intronic
1188880581 X:35486905-35486927 TTGTAGGTGCATATGGGCATTGG - Intergenic
1190072079 X:47287871-47287893 TTGTTTGAGCATGTGGTGAAGGG + Intergenic
1192075275 X:67988807-67988829 ATGTATGTGTATATGGAGAGAGG + Intergenic
1193834809 X:86329054-86329076 GTGTATGTGCGGATGGGGAGGGG + Intronic
1194078708 X:89431084-89431106 ATGTATGTGATTATTGGGAATGG + Intergenic
1195150335 X:102061438-102061460 TTGTGTGTGTGTATGGGGCAGGG - Intergenic
1195488599 X:105439724-105439746 TTGTATGTGTATGTCTGGAAAGG + Intronic
1195603346 X:106773597-106773619 CTGTATTTGCATGTGGGGATGGG + Intronic
1196027151 X:111053316-111053338 GTGTCAGTGCAAATGGGGAAAGG + Intronic
1196774891 X:119329206-119329228 ATGTTTGTGCATATGTGCAAGGG - Intergenic
1197189861 X:123634167-123634189 TTGTATATAAATATGGGGGAAGG + Intronic
1197725620 X:129774411-129774433 TTGTATGTGGGCATGAGGAATGG + Intergenic
1198221373 X:134605436-134605458 TTTTATTTGCCCATGGGGAAAGG + Intronic
1198318180 X:135490591-135490613 TTGTGTGTGTATCTGGGGTAAGG - Intergenic
1198699718 X:139383481-139383503 TTGTATGTGTAGATGGGGGTGGG + Intergenic
1199072202 X:143490135-143490157 TTGAAGGTGAATATTGGGAAAGG + Intergenic
1199677717 X:150201652-150201674 CTGTGTGTGCACATGAGGAAGGG + Intergenic
1200431315 Y:3086206-3086228 ATGTATGTGATTATTGGGAATGG + Intergenic
1201225074 Y:11810788-11810810 TTGTATCTGCAGATGGAGGAAGG - Intergenic