ID: 1188596407

View in Genome Browser
Species Human (GRCh38)
Location X:31906751-31906773
Sequence GGAGCTGCTTAGTCTAGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 84}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188596407 Original CRISPR GGAGCTGCTTAGTCTAGTCA AGG (reversed) Intronic
902557194 1:17253948-17253970 GAAGCTGCTTTGTCAAATCAGGG - Intronic
903895372 1:26599824-26599846 GGAGCTTTTTATTCTAGTGAGGG + Intergenic
906242368 1:44249768-44249790 GGAGCCGCTGAGCCTGGTCAGGG + Intronic
911573584 1:99547550-99547572 GGAGATGCTTGGTTTAGTCCAGG - Intergenic
912905923 1:113707126-113707148 GGATAAGCTTAGTGTAGTCATGG + Intronic
913711007 1:121483392-121483414 GGAGCTGCTTCTGCTAGTAAAGG - Intergenic
919267158 1:195284392-195284414 GAAGCTGTTTAGTTTAGTTAAGG + Intergenic
921776881 1:219111811-219111833 AGAGCTGCTTAGTGAAGTGATGG + Intergenic
922989627 1:229895432-229895454 GTAGCTCCTTAGTCTACTCAGGG + Intergenic
1063756959 10:9022208-9022230 GGAACTGCTAAGTCTAGAGATGG + Intergenic
1066172344 10:32863179-32863201 GTAACTGCTTTGTCTATTCATGG - Intronic
1074937157 10:118192697-118192719 GCAGCTGCTTCTTCTAGACAAGG - Intergenic
1075104812 10:119531955-119531977 GGAGCTGCTTTTTATAGCCATGG + Intronic
1077988319 11:7377779-7377801 AGAGCTTCTTAGTCTATGCATGG + Intronic
1078532517 11:12148185-12148207 GGAGCTTCACAGTCTATTCAGGG - Intronic
1079919740 11:26418233-26418255 AGTACTGCTTAGACTAGTCAGGG + Intronic
1081876300 11:46410606-46410628 GGAGCCGGTTAGGCTTGTCAGGG - Intronic
1082175878 11:49058809-49058831 AGAGCTCCTTAGTCTCCTCATGG + Exonic
1083677001 11:64331906-64331928 TGAGCTGCTGAGTCAACTCAGGG + Intergenic
1083767374 11:64848256-64848278 GGAGCTGCTTCGGGCAGTCAGGG - Intergenic
1086698801 11:89875714-89875736 AGAGCTCCTTAGTCTCCTCATGG + Exonic
1086707369 11:89968785-89968807 AGAGCTCCTTAGTCTCCTCATGG - Exonic
1091538309 12:1434732-1434754 GGAGATCCTTAGGCTAGTCATGG + Intronic
1092174213 12:6391674-6391696 GGAGCTGGTGAGTATAGTCCAGG + Intergenic
1092980089 12:13786153-13786175 GTACCTGCTTAGTTTAGTCGAGG - Intronic
1102313719 12:111868331-111868353 GGAGCTGCTAACTATAGTCTGGG + Intronic
1112367504 13:98767916-98767938 GAAGCTGACTAGTCTACTCACGG + Intergenic
1114674594 14:24431825-24431847 GGAGCTGCTGAGTCTGGTGCAGG + Exonic
1116227669 14:42172380-42172402 GGAGCTGCTGATTCTCCTCAAGG - Intergenic
1135135202 16:19882275-19882297 GGAGCTGCTTTGCATATTCATGG - Intronic
1135255167 16:20935929-20935951 GCAGCTGCTCAGTTTAGACAAGG - Intronic
1148822015 17:50365280-50365302 GGAGCTGCTCAGTGAAGACAAGG + Intergenic
1157577442 18:48752992-48753014 GGGGCTGCTTAGTCGAGCGATGG - Intronic
1167175549 19:47861374-47861396 GGAGCAGCTTGGTGAAGTCAGGG - Intergenic
930178780 2:48329516-48329538 GCAGCTGCATTTTCTAGTCAAGG - Intronic
932547544 2:72730073-72730095 GGAGATGCTTATTCTAGTTTGGG + Intronic
934678415 2:96265895-96265917 GGTGCTGCTCAGCCCAGTCACGG + Exonic
936535609 2:113308681-113308703 GGAGATGCTTGGTCTAGAGAAGG + Intergenic
941036607 2:160575684-160575706 GGAGCAACTTATACTAGTCATGG + Intergenic
944626162 2:201570936-201570958 GGAGCTTCTAATTCTTGTCAGGG - Intronic
945363172 2:208916960-208916982 GGAGCTGCTTTGTCATGTTAAGG - Intergenic
1169933989 20:10863467-10863489 GGAATTGCTTAGGCTAGGCATGG + Intergenic
1173156575 20:40617563-40617585 GGGACTCCTTAATCTAGTCAAGG - Intergenic
1174234344 20:49076474-49076496 TGAACTGCTTAGGCTAGGCATGG - Intronic
1178286880 21:31333229-31333251 GGGGCTGCTGAGCCTAGTCCAGG + Intronic
1181627409 22:24131198-24131220 GGAGATGCTTCTTCAAGTCAGGG + Intronic
1181864699 22:25846103-25846125 GGAGCTGCGGAGTCTATTCCAGG + Exonic
1181957901 22:26601609-26601631 GGAGCTGCTAAGCCTAGTTGGGG - Intronic
1183098600 22:35569707-35569729 TGAGCTGCATAGTCTAGTTCTGG + Intergenic
1183614879 22:38937957-38937979 GGGGCTGGGAAGTCTAGTCAAGG + Intergenic
1183928557 22:41223236-41223258 AGCACTGCTTAGTCTAGTCTAGG + Intronic
1184148271 22:42624050-42624072 GGGGCTCCTTAGGCTAGACAAGG - Intronic
950196637 3:11014078-11014100 GGAGGTGCTCAATATAGTCATGG + Intronic
951656018 3:25009486-25009508 GGAGCTGCTTACTGGACTCACGG - Intergenic
955639696 3:61068939-61068961 AGAGCTGATTAATCTAGTCAGGG - Intronic
957527461 3:81395511-81395533 GGAGATTCTGAGACTAGTCAGGG + Intergenic
961413336 3:126739454-126739476 GGAGCTGCATAGTCTAGTCCAGG - Intronic
961968954 3:130938654-130938676 GGAGCTGGTTAGTCTAGCATAGG + Intronic
962325202 3:134426941-134426963 GGAGCAGCTCAGTGTAGGCAGGG - Intergenic
971927081 4:33025531-33025553 GGAGATGCTTTGTCTAGTCAAGG + Intergenic
972329965 4:38055681-38055703 GGAGCTGCTGAGCCTAGCCAGGG + Intronic
978953580 4:114590743-114590765 GAAGCTGACTAGTCTACTCATGG - Intergenic
985755033 5:1708763-1708785 GGGGCAGCTTTGTCTAGACATGG + Intergenic
987207610 5:15643702-15643724 GGAGATGATTAGTGTGGTCAAGG + Intronic
991548046 5:67805508-67805530 GGAGCTGCATATTGTAGGCAAGG - Intergenic
993190333 5:84672309-84672331 GGAGCTGCTTAGTTTATGGATGG + Intergenic
1004326415 6:14677602-14677624 GGTGCTGCTTTATGTAGTCAGGG - Intergenic
1009948403 6:70366532-70366554 GGAGGTGTTTAGTTTAGACAGGG - Intergenic
1012511878 6:100011710-100011732 GGAGCTGCTTGGGTTAGTCCTGG - Intergenic
1012995294 6:105966881-105966903 TGAGCTGCTTAGACCAGGCAAGG + Intergenic
1019775965 7:2912442-2912464 GGAGCTTCACAGTCTAGTCGAGG - Intronic
1024411768 7:49051093-49051115 GGAGCTCCTTTGTATATTCAGGG - Intergenic
1030127218 7:106165642-106165664 GGAGGTGGCTAGTCTAGGCAGGG - Intergenic
1032463095 7:132126267-132126289 GGAGCTCCCTCGTCTAGCCAAGG - Exonic
1034393469 7:150802777-150802799 GGAGCTGGGTAGGCTGGTCATGG + Intronic
1034852377 7:154506797-154506819 GAAGCTGCTTAGTGTGATCAGGG + Intronic
1036947408 8:13107263-13107285 GGAGCTTCTTTTTCTACTCAGGG - Intronic
1041926327 8:63241285-63241307 GGAGCTACTTAGTGTAGTCTTGG - Intergenic
1046634488 8:116658655-116658677 GCAGCAGCTCAGTCTAGACAGGG - Intronic
1049223297 8:141437355-141437377 GGAGCTGCGTGGTCTGGACAGGG + Intergenic
1051486578 9:17615003-17615025 GGACATGCTCACTCTAGTCAGGG - Intronic
1051813558 9:21077665-21077687 GCAGCTGCTTAATCTCCTCAGGG + Exonic
1056936323 9:90917675-90917697 GGATCTTCTTAGTCTACTGATGG - Intergenic
1059892055 9:118814600-118814622 GGAGCTGCTTAGTTTACAAATGG - Intergenic
1061744757 9:132731331-132731353 GGAGCTCCTTCATCCAGTCAAGG - Intronic
1186760998 X:12721411-12721433 TGAGCTGCTCTGTCTCGTCAGGG + Exonic
1187442364 X:19331952-19331974 GGAGCAGATGGGTCTAGTCACGG + Intergenic
1187691686 X:21875075-21875097 GGAGGTACTTAATCTTGTCAGGG + Intronic
1188596407 X:31906751-31906773 GGAGCTGCTTAGTCTAGTCAAGG - Intronic
1189066108 X:37810838-37810860 GGAGATGCTTTGTTTACTCAGGG - Exonic
1197654335 X:129099930-129099952 GGAGATGCTTCATCTATTCAAGG + Intergenic
1199891596 X:152088409-152088431 TGAGCCTCTTAGTCTAGTCTTGG - Intergenic