ID: 1188602215

View in Genome Browser
Species Human (GRCh38)
Location X:31981591-31981613
Sequence AAGAAGAACCAGAAAGACGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 742
Summary {0: 1, 1: 0, 2: 1, 3: 68, 4: 672}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188602213_1188602215 -1 Left 1188602213 X:31981569-31981591 CCTTTTTACTTCCATTTGGAGGA 0: 1
1: 0
2: 2
3: 31
4: 288
Right 1188602215 X:31981591-31981613 AAGAAGAACCAGAAAGACGAAGG 0: 1
1: 0
2: 1
3: 68
4: 672

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188602215 Original CRISPR AAGAAGAACCAGAAAGACGA AGG Intronic
900752969 1:4410894-4410916 AAGAAGAACCAGGAAGATGCGGG - Intergenic
900762982 1:4485407-4485429 GAGAAGAACCAGACTGAAGAAGG + Intergenic
901179551 1:7331845-7331867 AAGCAGAATAAGAAGGACGAGGG - Intronic
901284552 1:8066704-8066726 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
901795394 1:11676709-11676731 AAGAAGCACCAGCATGACAAGGG - Intronic
902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG + Intronic
903458033 1:23502095-23502117 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
903987348 1:27238222-27238244 AAGAAGAACTGAAAAGACCAAGG + Intronic
904295769 1:29518898-29518920 AAGAAGAAGGAGAAGGAAGAAGG - Intergenic
904597053 1:31653529-31653551 TAGAAGAAACAGAAAGAAAAGGG + Intronic
905178046 1:36150326-36150348 AACAGGCACCAGAAACACGAAGG + Intronic
905765095 1:40593856-40593878 GAGAAGAAAAAGAAAGAAGAGGG - Intergenic
906180817 1:43817339-43817361 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
906180828 1:43817431-43817453 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
909238937 1:73187668-73187690 AAGAACAATCAGAAAGGAGAAGG - Intergenic
909642971 1:77887904-77887926 AAGAAGAAGAAGAAAGTTGAAGG - Intergenic
910474834 1:87595651-87595673 AAAAAGAAAGAGAAAGAGGAGGG - Intergenic
910619806 1:89240855-89240877 TAGAAGAACTAGAAAAACAAAGG - Intergenic
910666475 1:89730262-89730284 ATGAAGACCCAGAAAGACTCTGG + Intronic
910679808 1:89851496-89851518 AAAAAGAAAAAGAAAGACAAGGG - Intronic
910774851 1:90864513-90864535 AAGAAGAAGAAGAAAGAAGGTGG - Intergenic
911663246 1:100527150-100527172 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912710805 1:111948508-111948530 AAGAAGAAAGAGAAAGTAGAAGG - Intronic
912744161 1:112231391-112231413 AACAAGGCCCAGAAACACGATGG + Intergenic
913046764 1:115080249-115080271 AAGAATTAGGAGAAAGACGATGG + Intronic
913128516 1:115815772-115815794 AAGAATAACAAGAAAGGGGAGGG - Intergenic
913404432 1:118473867-118473889 AAGAAGGACCAGAAAGAACCAGG - Intergenic
913553806 1:119943343-119943365 AAGAACCACCAGAAAGAAGTAGG + Intronic
913691177 1:121281339-121281361 AAGAAGAAAGAGAATGAAGAAGG - Intronic
914146365 1:144998633-144998655 AAGAAGAAAGAGAATGAAGAAGG + Intronic
914960099 1:152197470-152197492 AAAAAGAAGAAGAAAGAAGAAGG - Intergenic
915054920 1:153119383-153119405 CAGGAGAACCAGAAAGACCACGG + Intergenic
915132820 1:153707701-153707723 AAAAAGAGACAGAAAGAGGAAGG + Intergenic
915167038 1:153953729-153953751 GAGAAGAACCAGAAAGAAAAGGG - Intronic
915923474 1:159996741-159996763 AAGAAGAACTAGAAAGAAGGTGG - Intergenic
916498883 1:165369598-165369620 TAGAAAAACCAGAAAGAAGATGG - Intergenic
916571432 1:166031215-166031237 AAGAATAACCAGCAAGACTGAGG - Intergenic
916882336 1:169032026-169032048 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
917015658 1:170528778-170528800 AGGAAGAACCAGCCAGACAAGGG + Intergenic
917130822 1:171741281-171741303 AAGACGAATCAGAAAGAGAATGG - Intronic
917409380 1:174742214-174742236 AAGAAGAAGAAGAAAGAAAAGGG + Intronic
917685016 1:177406939-177406961 AAGTAGAACCAAAAAGACACAGG - Intergenic
918549987 1:185731384-185731406 AAGAAGTACAAGAAATATGAGGG + Intergenic
918730152 1:187983021-187983043 AAGGAGAACAAGAAGGATGAAGG + Intergenic
919501672 1:198345180-198345202 GAGCAGAACCAAACAGACGAGGG + Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919974991 1:202604504-202604526 AAGAAGAACAAGAAGGAGAAGGG - Exonic
920320108 1:205114016-205114038 AAAAAGAAACAGAAAGGCGGTGG + Intronic
920478501 1:206299815-206299837 AAGAAGAAAGAGAATGAAGAAGG - Intronic
920764090 1:208814750-208814772 AAGAATAACAAGAAAGAGAAGGG + Intergenic
921110872 1:212035511-212035533 AAGAAAAACCAGCAAGAAGGCGG - Exonic
921119294 1:212123051-212123073 GAAAAGAAGCAGCAAGACGATGG - Intergenic
921233794 1:213102402-213102424 AAGAAGAACCAAGAAGTGGAAGG - Intronic
921253943 1:213322723-213322745 AAGAAGAAGGAGAAAGAAAATGG - Intergenic
921952543 1:220945541-220945563 AAGGAGAACCAGATAGCCTAGGG - Intergenic
922312236 1:224405927-224405949 AAGATGAATCAGAAAGACACAGG + Intronic
922699339 1:227749463-227749485 AGGAAGAACCAGCAACACGCAGG - Intronic
922942786 1:229482428-229482450 AGGAAGAAACAGAAACACAATGG + Intronic
922943389 1:229489135-229489157 AAGAAGAAAAAGAAAAAGGAAGG - Intronic
923004714 1:230038173-230038195 AAAAAGAAAAAGAAAGAAGAAGG + Intergenic
923098503 1:230794069-230794091 AGGAAGAAGCAGAAAGACCCTGG + Intronic
923378668 1:233392609-233392631 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
923388893 1:233493897-233493919 ATGAGGAACTAGAAAGAAGATGG - Intergenic
923714243 1:236411512-236411534 AAGAAGAAGAAGAAAGAAGAAGG - Intronic
924129034 1:240886593-240886615 AAGAAGAAAAAGAAAGAGAAAGG - Intronic
924263590 1:242256884-242256906 AAAAAGAAAGAGAAAGAAGAGGG - Intronic
924668467 1:246098191-246098213 ATCAAGAACAAGAAAGATGATGG + Intronic
1063228446 10:4039682-4039704 AATAAGAAGAAGAAAGAGGAGGG - Intergenic
1063998670 10:11644305-11644327 AAGAATAACCAGAAAGAGGCCGG - Intergenic
1064104635 10:12490550-12490572 AAGAAAAACCACAAAGAGGCTGG + Intronic
1064655593 10:17552350-17552372 AAGAAGGAACAGAAAGGCAATGG - Intergenic
1065066096 10:21966667-21966689 AAGAAGAAGAAGAAAGAGGTGGG - Intronic
1065734596 10:28740234-28740256 AAGAAGAAAGAGAGAGAGGAAGG - Intergenic
1066434632 10:35385991-35386013 AAAAAAAAACAGAAAGACAAAGG - Intronic
1066511016 10:36095847-36095869 AAAAAGAACCAGATAAATGATGG - Intergenic
1066627940 10:37428347-37428369 AAGAAGAAGAAGAAAGAGAAAGG + Intergenic
1066721205 10:38341614-38341636 AAAAAGAAAGAGAAAGAAGAGGG + Intergenic
1067150656 10:43730045-43730067 AAGAAGAAGAAGACAGGCGAGGG + Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067222160 10:44352240-44352262 AGGAAAAAACAGAAACACGAGGG - Intergenic
1067254351 10:44621177-44621199 AAGAAGAAACAGGAAGAACAAGG + Intergenic
1068376068 10:56182735-56182757 AAGAAGAAAAAGAAAAAGGAAGG + Intergenic
1068538971 10:58269891-58269913 AAGAAGACTCAGAAAGCTGAAGG - Intronic
1068620957 10:59182140-59182162 AAGGAAAACCAGAAAGTAGAAGG - Intronic
1068692351 10:59930223-59930245 AAGAAGAAAGAGAAAAATGAAGG - Intergenic
1069473066 10:68710317-68710339 AAAAAGAAGAAGAAAGAAGAAGG - Intergenic
1069619494 10:69827910-69827932 AAGAAGGACCACAAAGAAGCGGG - Intronic
1069950708 10:72016340-72016362 AAGAAGAAAAAGAAAGAGGAAGG + Intergenic
1070421238 10:76239222-76239244 GAGAAGGACCAGAAAGATCAGGG - Intronic
1071097530 10:81995792-81995814 ATGAAGAACCAGAAAGTACAAGG - Intronic
1071230399 10:83579557-83579579 AAAAAGAACAAGAATGAAGAGGG + Intergenic
1071409067 10:85369171-85369193 AAGCACAATCAGAAAGACAAGGG - Intergenic
1071575244 10:86720824-86720846 AAGAAGATCCAGGAAGAAGACGG + Intronic
1071675734 10:87654424-87654446 AGGAAGAACCAGAAATAGCAGGG + Intergenic
1072024537 10:91441819-91441841 ACAAAGATCCAAAAAGACGAAGG - Intronic
1072025160 10:91447776-91447798 ACAAAGATCCAAAAAGACGAAGG + Intronic
1073667059 10:105545377-105545399 GTGAAGAACCAGAAAGAAAATGG - Intergenic
1074200763 10:111233167-111233189 CAGAGGAACCAGAGAGAAGATGG - Intergenic
1074403722 10:113163396-113163418 GAGAACAACCAGGAAGACAAGGG - Intronic
1074561901 10:114542608-114542630 AAAAAGAAAGAGAAAGAAGAAGG + Intronic
1074700517 10:116088090-116088112 ATGGAGAACCAGAAGGACAAAGG + Intronic
1075382800 10:122032571-122032593 AAGAGGAACCAGAAGCCCGAAGG - Intronic
1076023855 10:127096144-127096166 CAGAACAAAAAGAAAGACGATGG - Intronic
1076316653 10:129546613-129546635 AAGAAGGACCAGAGAGAGAATGG + Intronic
1076850942 10:133092715-133092737 AAGAAGCACCTGAATGAAGAAGG + Intronic
1077449681 11:2631633-2631655 AACAAGAAACAGAAAAACCAAGG - Intronic
1077651353 11:3975624-3975646 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1078727502 11:13944767-13944789 AAAAAGAACAAGAAAGAAAAGGG - Intergenic
1078741166 11:14067465-14067487 AAGAAGAATCACAAAGACACTGG - Intronic
1079645156 11:22853703-22853725 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1080109144 11:28546114-28546136 AAGAAGGACGAGAGAGAAGAGGG + Intergenic
1080165000 11:29225388-29225410 AAGAAGAGACAGAAAGAGGTGGG - Intergenic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1080759905 11:35238393-35238415 AGGTAAAACCAGAAAGAAGAGGG + Intergenic
1082741445 11:56916037-56916059 TAGAAGAACCAGAACCAGGATGG - Intergenic
1082858097 11:57827565-57827587 AAGGAGACCCTGAAAGACTAGGG + Intergenic
1083516857 11:63267941-63267963 AAGAAGAAGAAAAAAGAAGAAGG - Intronic
1084292066 11:68179031-68179053 AACAGGAACCAGAAAGGCCAGGG - Intronic
1085335416 11:75690053-75690075 AAGAAGAAGTAGAAGGAAGAAGG - Intergenic
1085541059 11:77270165-77270187 AAGGAGACCCAGAGAGAAGAAGG + Intronic
1085807668 11:79651109-79651131 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086825525 11:91490363-91490385 AGGAAGGAGCAGAAAGAGGAAGG - Intergenic
1086851507 11:91814920-91814942 TAGAAGAAGCAGGAGGACGAAGG + Intergenic
1087628041 11:100619597-100619619 AGGAAGAACAAGAAAGCAGAAGG - Intergenic
1087728611 11:101752963-101752985 AAGAAGCACCAGAAAGAGATTGG + Intronic
1088058454 11:105612859-105612881 AAGAAGAAACATGAAGACTATGG + Intronic
1089088302 11:115842905-115842927 AAGAAGAGCCAGGAAGAGAAAGG - Intergenic
1089126017 11:116177142-116177164 AAGATGTAGCAGAAAGAGGAGGG + Intergenic
1090345684 11:126068339-126068361 AAGAAGAAGCAGAAACACAAGGG + Intergenic
1090612433 11:128483531-128483553 AAAAAGAGCCAGAAAGGGGAAGG + Intronic
1090757225 11:129803322-129803344 AGGAAGCACCAGAAAGGCGCTGG + Intergenic
1091337143 11:134780705-134780727 GAGAAGAAGGAGAAAGAGGAGGG - Intergenic
1091395527 12:152168-152190 AAAAAGCACCAGAAAGGGGAAGG + Intronic
1092611648 12:10179358-10179380 AAGAAAAACAGGAAAGAAGAGGG + Intronic
1092708726 12:11311484-11311506 AAGAAGAACCAGAAAGAAGGTGG - Intergenic
1093482802 12:19622681-19622703 AAGAAGAAAAAGAAAGAAGTGGG - Intronic
1093508408 12:19896805-19896827 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1093687024 12:22068398-22068420 AAGAAGAGGAAGAAAGATGAGGG + Intronic
1093726456 12:22516580-22516602 AACAAGAAACAGAAAGACCAAGG + Intronic
1094070294 12:26405149-26405171 AAGAAGAAGAAGAAAGAAGGAGG + Intronic
1094337139 12:29372382-29372404 AAGAAGAAGAAGAAAGAAGGTGG + Intronic
1094443611 12:30506386-30506408 AAGAAGAAAAAAAAAGACAAAGG + Intergenic
1095154971 12:38841857-38841879 AGGGAGAAGCAGAAAGATGAAGG + Intronic
1095659089 12:44708067-44708089 GAGAAGAACCAGAAGGACTGTGG + Intronic
1095926620 12:47585439-47585461 AAGAAGATCCAAAGAGAGGAGGG + Intergenic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096276661 12:50215235-50215257 AAGAAAAACCACAAAGATGTTGG + Intronic
1096356955 12:50949293-50949315 AAGAAGAAAAAGAAGGACAAAGG - Intergenic
1096831522 12:54318167-54318189 AAGAAGTAACAGAAAGAGGCTGG - Intronic
1096834361 12:54339707-54339729 AAGAAGAACCATTAAGACTGAGG + Intronic
1097696711 12:62781716-62781738 AAGAAGTACCTGAGAGAGGAAGG + Intronic
1097892241 12:64789161-64789183 AAGAAGAAGAAGGAAGAAGAAGG - Intronic
1098423532 12:70331694-70331716 GAGAAGAGCCAGAAAGTCAATGG - Intronic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098717913 12:73855482-73855504 AAGAAGAACAAGAGACACCAGGG - Intergenic
1098895304 12:76053279-76053301 AAGAAGAAGCAGAAACACAAGGG - Exonic
1099330368 12:81277342-81277364 GAAAAGAACTAGAAAGAAGACGG - Exonic
1099601744 12:84748288-84748310 AAGAAGAACCAAAAAAACTGGGG - Intergenic
1099822220 12:87726913-87726935 AAGAGAAACTAGAAAGACTAAGG - Intergenic
1099986389 12:89670201-89670223 GACAAGAACCAGAAACAGGAGGG + Intronic
1100131901 12:91504788-91504810 AAGATGGACCACAAAGAGGAAGG + Intergenic
1100438462 12:94593412-94593434 AAGAAGAAGAAGGAAGAAGAAGG + Intronic
1100997483 12:100318250-100318272 AGAAAGAAGCAGAAAGATGAAGG - Intronic
1101811940 12:108115036-108115058 AGGAAGAAAGAGAAAGAGGAAGG + Intergenic
1101855029 12:108435048-108435070 AAGAAGAATCAGTAAGACCTGGG + Intergenic
1101976092 12:109360093-109360115 AAGAAGAAAAAGAAAAAAGAAGG - Intronic
1102167964 12:110821038-110821060 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1102974978 12:117200190-117200212 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
1103211021 12:119166513-119166535 AAAAAGAATCAGAAAAAAGAAGG + Intergenic
1103509138 12:121462342-121462364 AAGAACTACCAGAAAGCCCAGGG + Intronic
1103680663 12:122690966-122690988 AATAACAAGCAGAAAGAGGAAGG - Intergenic
1104141587 12:125992636-125992658 AACAAGAACCAGCCAGATGAGGG + Intergenic
1105232894 13:18516205-18516227 ATGAAGACCCAGACACACGATGG + Intergenic
1105967745 13:25399850-25399872 AAGAAGAAGATGAAAGAGGAGGG - Intronic
1106388678 13:29314072-29314094 AAGCAGACCAAGAAAGAGGAAGG + Intronic
1106578618 13:30999072-30999094 AACAAGAGCCAGAAACAGGAAGG + Intergenic
1106786587 13:33113666-33113688 AAGAAGAACCAGGCAGCCTAAGG + Intronic
1106790816 13:33153443-33153465 AAGAAGGACCAGAGAAACGCTGG + Intronic
1106812005 13:33368030-33368052 AATAAGAAAGAGAAAGAGGAAGG - Intergenic
1107668587 13:42718680-42718702 AAGAAGGAGGAGAAAGAAGAGGG + Intergenic
1107870794 13:44744813-44744835 AAGAACAACCAGACAGGCTACGG - Intergenic
1108173121 13:47764269-47764291 AAGAAGAAGCAGAAACACAAGGG + Intergenic
1108774759 13:53751965-53751987 AAGAGGAAGCAGCAAGACAAAGG + Intergenic
1109428534 13:62200244-62200266 AACAAGAACAAAAAAGAGGATGG - Intergenic
1109599567 13:64606724-64606746 AAAAAGAACCAGAGAGTGGAAGG + Intergenic
1109714387 13:66202390-66202412 AAGGAGAAAGAGAAATACGAGGG - Intergenic
1110358272 13:74594818-74594840 AATTAGAATCAGACAGACGATGG + Intergenic
1111240345 13:85465512-85465534 AAAAAGAACCAGACAGAAGGAGG - Intergenic
1111340249 13:86876110-86876132 AAGAAAAACAATAAAGACAAGGG + Intergenic
1111368396 13:87281951-87281973 AATAAAAACCAAAAAGACCAAGG - Intergenic
1111834018 13:93364926-93364948 AAGAAGAACCAAAGACAAGATGG - Intronic
1112383761 13:98918793-98918815 AAGTAGAACAAGAAAGAGGAAGG + Intronic
1112786251 13:102954912-102954934 AAGAAGAAAGAGGAAGAGGAGGG - Intergenic
1113258606 13:108534779-108534801 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
1113283819 13:108823087-108823109 AAGAAAAATCAGAAAAATGATGG - Intronic
1114038133 14:18648848-18648870 AAGAAGATGAAGAAAGAAGAAGG - Intergenic
1114392226 14:22322368-22322390 AAGAAGAAGGAGAAAGAGAAAGG + Intergenic
1114881905 14:26796717-26796739 AAGAAGAAAGAGAAAGAAGGAGG + Intergenic
1114994644 14:28332673-28332695 AAGAAGAATAAGAAAGACAAAGG + Intergenic
1115018529 14:28646379-28646401 AAGAAGAAGAAGAAAGGAGAAGG + Intergenic
1115941395 14:38614246-38614268 AAAAAGAACTAGAAAGGGGAGGG + Intergenic
1116567603 14:46469656-46469678 AAAAAAATCCAGAAAGACGTGGG + Intergenic
1116860471 14:49991685-49991707 AAGAAGAGACAGAAAGACACTGG - Intronic
1117087743 14:52219010-52219032 AAAAAGAAAAAGAAAGAAGAAGG + Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1118559045 14:67057686-67057708 AACAAGAAAGAGAAAGAGGAAGG - Intronic
1118692229 14:68351247-68351269 AAGAAGAACCTGCTAGACTAAGG + Intronic
1119601750 14:75981325-75981347 AAGAAGAAGCAGAAGGACCATGG + Intronic
1119660403 14:76447363-76447385 AGGAAGAACCAGGAAGCTGAAGG - Intronic
1120441228 14:84543061-84543083 AAGAGGAACCAGAAAATTGAAGG + Intergenic
1120625936 14:86826556-86826578 CAGAAGAAAGAGAAAGAGGAGGG + Intergenic
1120719076 14:87870902-87870924 AAGAAGAAGAAGGAAGAAGAAGG - Intronic
1121822132 14:96979512-96979534 ACTGAGAACCAGAGAGACGAAGG + Intergenic
1121847462 14:97185755-97185777 AAAAAGAACCTGAAGGAAGATGG - Intergenic
1122038161 14:98963298-98963320 AAGGAGAAGGAGAAAGAAGAAGG + Intergenic
1122384767 14:101336821-101336843 AAGAACAAGAAGAAAGACGTGGG + Intergenic
1122935450 14:104953933-104953955 AAAAAGAGCCAGAAAGAGAAAGG - Exonic
1123677559 15:22726071-22726093 AAGAAGAACCTAACAGACCATGG - Intergenic
1123792327 15:23734258-23734280 AAGAAAAAGAAGAAAGAAGAGGG + Intergenic
1123792337 15:23734330-23734352 AAGAAGGAGAAGAAAGAAGAAGG + Intergenic
1124137376 15:27046798-27046820 AAGAAAAAGCTGAAAGACAACGG - Intronic
1124329765 15:28800334-28800356 AAGAAGAACCTAACAGACCATGG - Intergenic
1125049735 15:35283047-35283069 AAGAAGAAGAAGGAAGAAGAAGG - Intronic
1125913787 15:43466291-43466313 AAGATGAAACAGAAAGTCTAAGG + Intronic
1127837993 15:62806309-62806331 AGGAAGAACTAGAAAGAAGGGGG - Intronic
1127869609 15:63060347-63060369 TGGAAGAACCAGAGAGAGGAAGG - Intronic
1128095618 15:64952324-64952346 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095622 15:64952357-64952379 AAGAGGAAGAAGAAAGAAGAAGG - Intronic
1128095631 15:64952461-64952483 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095748 15:64953691-64953713 AAGGAGAAGAAGAAAGAAGAAGG - Intronic
1128095772 15:64954055-64954077 AAGAGGAAGAAGAAAGAAGAAGG - Intronic
1128095837 15:64954743-64954765 AAGAACAAAAAGAAAGAAGAAGG - Intronic
1128179712 15:65591104-65591126 AAGAATAACCAAAGAGAAGAAGG + Intronic
1129085717 15:73088906-73088928 AAGAAGATTCAGAAAGAGTAAGG + Intronic
1129151336 15:73689867-73689889 ATGAAGACCCAGAAAGGCAAGGG + Intronic
1129905248 15:79182627-79182649 AAGAAAAGACAGAAAGAGGAAGG - Intergenic
1130161639 15:81407540-81407562 AACAGGAACCAGAAAGAGAAGGG + Intergenic
1130309747 15:82742959-82742981 AGAAAGAACCAAAAAGACGCTGG + Intergenic
1130795137 15:87199860-87199882 AAGAAAAAGAAGAAAGAGGAAGG + Intergenic
1133209874 16:4257625-4257647 AAGAAAACCCAAAAAGAGGAAGG + Exonic
1133580716 16:7141991-7142013 AAGAAGAAGGAGGAAGAAGAAGG - Intronic
1133628271 16:7592612-7592634 AAAAAGAATCAGAGAAACGAGGG - Intronic
1133855085 16:9542152-9542174 AAGAAGAAACTGAAACAAGAAGG + Intergenic
1134369912 16:13613635-13613657 CAGAAGACCCAGAAAGCCCATGG + Intergenic
1134543437 16:15088795-15088817 AAGAAGCACCAAATAGACCATGG + Intronic
1134751411 16:16628261-16628283 AAAAAGAAAGAGAAAGAGGAAGG - Intergenic
1135127694 16:19824748-19824770 AAGATGAACCAGGAAGAGGAAGG + Intronic
1135361021 16:21814952-21814974 AAGAAGCACCAAATAGACCATGG + Intergenic
1135374920 16:21937379-21937401 AAGAAGGAGAAGAAAGACAAGGG - Intergenic
1135611733 16:23873467-23873489 AAGAAGAACCAGAAAACCCATGG - Intronic
1136104313 16:28018627-28018649 AAGAATAACAAGAAAGAAGAGGG + Intronic
1136261510 16:29080444-29080466 AAGAAGCACCAAATAGACCATGG - Intergenic
1136470684 16:30477998-30478020 AAGAAGAAAAAGAAAGATGAAGG + Intronic
1136539119 16:30918826-30918848 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1137064413 16:35825046-35825068 AAGAGAAACCAGAAATAAGATGG - Intergenic
1137530599 16:49276562-49276584 AAGAAGAGGGAGAAAGAAGAGGG + Intergenic
1137566346 16:49534970-49534992 AAGAAGAACCATAAAGAAATGGG - Intronic
1137830220 16:51537104-51537126 ATGAAGACTCAGAAAGACTAAGG - Intergenic
1137968378 16:52959217-52959239 AAGAAGAAATAGAAAGAAGGAGG - Intergenic
1138231162 16:55337456-55337478 AAGAAGAGCCAGAGACACCAGGG - Intergenic
1138293860 16:55870323-55870345 AAGAAGAAAGAGGAAGAGGAAGG + Intronic
1138293872 16:55870396-55870418 AAGAAGGAAGAGAAAGAGGAAGG + Intronic
1139044515 16:63040400-63040422 AAGAAGGACAGGAAAGAAGAAGG + Intergenic
1139156618 16:64450840-64450862 ATGAGGAACCAAAAAGATGAGGG + Intergenic
1139272433 16:65696820-65696842 AAGAAGAAAGAGAAAGAAAAGGG + Intergenic
1139813826 16:69649406-69649428 AAGTAGAAGCAGAAAAATGAAGG - Intronic
1140016653 16:71193452-71193474 AAGGAGAACCAGACAGAATAGGG + Intronic
1140624066 16:76770752-76770774 AAGAAGAAACAGCAAGAATAGGG + Intergenic
1141372406 16:83500367-83500389 AAGAAGAAGAAGAAAGAAGAAGG - Intronic
1141623285 16:85248390-85248412 CAGAGGAAACAGAAAGAAGAGGG - Intergenic
1141711412 16:85701386-85701408 AAGAAGAAGGAAAAAGATGAAGG - Intronic
1141801261 16:86310996-86311018 AGGAAGGACCAGGAAGATGAAGG - Intergenic
1142241555 16:88949569-88949591 AAAAAGAAAAAGAAAGAAGATGG + Intronic
1142705706 17:1692639-1692661 AAGAAGAACTAAAAAGAGGTGGG - Intergenic
1143179532 17:4975441-4975463 AAGAAGAAATGGAAAGAAGAGGG + Intronic
1143395407 17:6590978-6591000 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1143656944 17:8300443-8300465 AGGAAGAAGAAGAAAGAAGAAGG - Intergenic
1143794681 17:9327172-9327194 AAGAAGAAGAAGGAAGAAGAAGG + Intronic
1144746787 17:17621370-17621392 AAGAAGAAGGAGGAAGAAGAAGG + Intergenic
1144746790 17:17621396-17621418 AAGAAGAAAGAGGAAGAAGAAGG + Intergenic
1145099208 17:20059586-20059608 AAGGAGGACCAGAAAGAAAAGGG - Intronic
1146208739 17:30925541-30925563 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1146684401 17:34831249-34831271 CAGAAGATCCAGAAAGAGAATGG + Intergenic
1148356764 17:46980351-46980373 AAGAAGAGAAAGAAAGAAGAAGG - Intronic
1148551025 17:48550878-48550900 AAGAAGGACCAGAAGGCCAAGGG - Exonic
1148672874 17:49425265-49425287 AAGAAGAAAAAGAAAGACATGGG - Intronic
1149003770 17:51783583-51783605 AAGGAGAATAAGAAAGAAGAAGG + Intronic
1149103389 17:52933050-52933072 AAGAAGAAGCAGAAAGTCAAGGG + Intergenic
1149299822 17:55294773-55294795 AACAAGAACAAGAAAGAGGATGG + Intronic
1149797906 17:59538419-59538441 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1149797932 17:59538565-59538587 AAGAATAAGGAGAAAGAAGAAGG - Intergenic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150540287 17:66089727-66089749 AAGAAGAAAAAGAGAGACAAAGG + Intronic
1152391851 17:80008172-80008194 TTGAAGAACCAGCAAGGCGAAGG + Intronic
1153135028 18:1907063-1907085 AAGAAGAAAGGGAAAGAAGAAGG - Intergenic
1153177051 18:2387820-2387842 ATGAAGAAGCAGAAAAAAGAAGG + Intergenic
1154102104 18:11485570-11485592 AAGAAGAAAAAGAAAGTCAAGGG + Intergenic
1154335447 18:13461337-13461359 AAGAAGAGCGAGGAAGACGTGGG + Intronic
1154520409 18:15222247-15222269 ATGAAGACCCAGACACACGATGG - Intergenic
1155294757 18:24374850-24374872 AAGGAGCACCAGGAAGACAAGGG + Intronic
1155712406 18:28899458-28899480 AAGAAGAAAGAGAAAAAGGAAGG - Intergenic
1155776711 18:29772562-29772584 CAGAAGAACAAGAAAGCAGATGG + Intergenic
1156036919 18:32774301-32774323 AAAAAGAAGCAGAAAAAGGAAGG + Exonic
1157214684 18:45773115-45773137 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1157550805 18:48580691-48580713 CAGAGTACCCAGAAAGACGACGG - Intronic
1157768670 18:50325161-50325183 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1158718825 18:59905185-59905207 AAGAAGAACCAGAGAGCTGGAGG + Intergenic
1159599088 18:70411556-70411578 AAGAAGAAAGAGAAAGATGCTGG - Intergenic
1161801245 19:6417762-6417784 AAGAAGATCCAGAATGATGCTGG - Exonic
1161905842 19:7155916-7155938 AAGAAGAAAAAGAAAGAAGAAGG + Intronic
1162325824 19:9998670-9998692 AAGAAGAAAGAAAAAGAAGAAGG - Intronic
1162404094 19:10463068-10463090 AAGAAGAAAGAGAAAGAAGAAGG - Intronic
1162641346 19:12012683-12012705 AAGAAGGACCAGGAAGATAAAGG - Intergenic
1162815817 19:13193778-13193800 AAGAAGAAAGAGAAAAAGGAAGG - Intergenic
1163387239 19:17007372-17007394 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1164535601 19:29084558-29084580 AAGAAGTAGCTGAAAGAGGAAGG + Intergenic
1164718639 19:30415046-30415068 AAGCAGAAGCAGGAAGAAGAAGG - Intronic
1165638607 19:37364791-37364813 AAGGAGGACCAGAGAGACCATGG + Intronic
1167666272 19:50824083-50824105 AAGCAGAAACAGGAAGACGGAGG + Intergenic
1168108066 19:54176316-54176338 TTGAAGAACCAGAAAGCCAATGG - Intronic
1168378712 19:55902092-55902114 AAGAACAGCCTGAGAGACGAGGG - Exonic
925667274 2:6272652-6272674 AACAAGAAGCAGAAAAACTATGG + Intergenic
927205454 2:20606617-20606639 AAGAAGAAGAAGAAAGACGCTGG - Intronic
928822225 2:35374999-35375021 AAGAAGCACCAGAAAGGACAAGG + Intergenic
929015015 2:37485260-37485282 AAGAAGAAGGAGGAAGAAGAAGG - Intergenic
929144530 2:38694993-38695015 ACCAAGAACCAGAAAGACAAGGG - Intronic
929370392 2:41216645-41216667 AGGAAGAACAAGAAAAACAAAGG - Intergenic
929647890 2:43648161-43648183 AAAAAAAACCAGAAAGACACAGG - Intronic
929728261 2:44456482-44456504 AAGAAGAAACAAAAAGACCTTGG + Intronic
929759774 2:44797504-44797526 ATGAGGAAACAGAAAGACAAAGG + Intergenic
929772718 2:44905987-44906009 AAGAAGAGGCAGAAAAATGAAGG - Intergenic
930040070 2:47115349-47115371 GAGCAGATCCAGAAAGAGGAAGG - Intronic
930956580 2:57210194-57210216 AAAAAGAATTAGAAAGACTAAGG + Intergenic
931477377 2:62603017-62603039 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
931733039 2:65170000-65170022 AAGAAGAAAAAGAAAGATAAAGG + Intergenic
931809486 2:65840960-65840982 AAGAAGAAGCAGAGAGTAGAGGG - Intergenic
931819277 2:65935241-65935263 AAGGAGAGCCAGAAGGACAAAGG + Intergenic
932672095 2:73746711-73746733 GAGAACAACCTGAAAGACAAAGG + Intergenic
932757773 2:74420752-74420774 AAGAAGAAGAAGAAAGAAAACGG - Intronic
932827378 2:74954309-74954331 CAGAAGAAACAGGAAGACGAAGG - Intergenic
933129158 2:78651514-78651536 GAGAAGAACTATAAAGACAAGGG - Intergenic
933598265 2:84304333-84304355 ATTATGAACCAAAAAGACGAGGG + Intergenic
934535313 2:95128556-95128578 AAGAAAAAGAAGAAAGAAGAAGG + Intronic
934884342 2:98011503-98011525 AAGAAGAAAAAGAAAGAGAAAGG - Intergenic
935089213 2:99878144-99878166 AACAAGAAGCGGAAAGAGGAAGG + Intronic
935100719 2:99992990-99993012 AAGAAGGAACAGAAAGGGGAGGG - Intronic
935189044 2:100761201-100761223 AATAGGAACCAGACAAACGATGG + Intergenic
935311901 2:101792627-101792649 AATAAGAAGAAGAAAGAAGAAGG - Intronic
935948119 2:108304407-108304429 AAGCAGAGACAGAAAGAAGAGGG + Intronic
936731293 2:115384447-115384469 AAGAAGAAGAAGGAAGAAGAAGG + Intronic
937327125 2:120996723-120996745 ACGAAGAAGAAGAAAGAAGAAGG - Intergenic
937731452 2:125235847-125235869 AAAAAGAACCTGAAAAACCAAGG - Intergenic
937784592 2:125880541-125880563 AAAAAGCACCAGAAAAAAGATGG - Intergenic
938519760 2:132056022-132056044 ATGAAGACCCAGACACACGATGG - Intergenic
938682505 2:133705717-133705739 GAGAAGTACCAGAAAGGCAAAGG + Intergenic
939113454 2:138034023-138034045 GAGAAGAAACAGAAAGATGGTGG + Intergenic
939335407 2:140820889-140820911 AAGAAGCAACAGAAAGAGGAGGG - Intronic
940164050 2:150748370-150748392 AAGAAGGAGGAGAAGGACGAGGG - Intergenic
940164056 2:150748397-150748419 AAGAAAAAGAAGAAAGAGGAAGG - Intergenic
940579185 2:155555100-155555122 AAGTAGACCCAAAAAGAGGATGG + Intergenic
942087590 2:172457889-172457911 ATGAAGAAGCAGAAAGCAGATGG + Intronic
942461516 2:176171723-176171745 AAGAAGGACCAGAAGGCCAAGGG + Exonic
942877852 2:180823903-180823925 AAGAAGAAACAGAAAGACCTAGG - Intergenic
943521462 2:188955979-188956001 AAGAAGAAAGAGAAAGAAAAAGG + Intergenic
943684607 2:190805262-190805284 AAGAAGAAAGAAAAAGAAGAAGG + Intergenic
943856197 2:192795500-192795522 AAGCAGAATCAGAAACACAAGGG - Intergenic
944280996 2:197897197-197897219 AAGAGGAAGAAGAAAGAAGAAGG - Intronic
944453501 2:199869425-199869447 AAGAAGAAAGAGAAAAAGGAAGG - Intergenic
945752308 2:213803468-213803490 CAGAAGAGACAGAAAGACAATGG - Intronic
946042752 2:216796545-216796567 AAGTAGCAGAAGAAAGACGATGG + Intergenic
946528533 2:220546585-220546607 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
946779575 2:223179090-223179112 AAGAAGACCCAAAAAGGAGATGG + Intronic
947952006 2:234156235-234156257 AAGAAGAAAAAGAAAGAGGAGGG - Intergenic
948127211 2:235572968-235572990 AAGAAGAAGAAGAAAAAAGATGG - Intronic
948433709 2:237937620-237937642 AAATAAAACCAGAAAGAGGAGGG + Intergenic
948617010 2:239205662-239205684 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
948972945 2:241443434-241443456 AAGCAGAACCAGACACACCATGG + Intronic
1169043338 20:2515016-2515038 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1169047474 20:2545673-2545695 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1169702349 20:8461165-8461187 AAAAAGAATCTGAAAGTCGAGGG + Intronic
1169765567 20:9144645-9144667 AAGAAGAAGAAGAAAGAAGGAGG + Intronic
1170056781 20:12214171-12214193 AAGAAGCACAAGGAAGAAGAAGG + Intergenic
1170188070 20:13615005-13615027 AAGAAGAACCTAACAGACCATGG + Intronic
1174011660 20:47454639-47454661 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1174269942 20:49360604-49360626 GAGAAGAACCTGAAAGATCAAGG + Intergenic
1174379393 20:50146922-50146944 AACAAGAATCAGAAAGGGGAAGG - Intronic
1174763529 20:53229947-53229969 AGGAAGAAAGAGAAAGAAGAAGG + Intronic
1174774635 20:53332415-53332437 AAGAAGAATGAAAAAGACGATGG + Intronic
1175419128 20:58820332-58820354 TAGAAGCACCAGGTAGACGAAGG + Intergenic
1175438637 20:58974000-58974022 AAGAAGAAGAAGGAAGAAGAAGG + Intergenic
1176177807 20:63736968-63736990 AAGAAGAGCCAGAGAGAAGTGGG + Intronic
1176668966 21:9714178-9714200 AAGAAGAAAGAGAAAAAAGAAGG - Intergenic
1176726901 21:10444806-10444828 AAGAATAACCAAAAAAATGAGGG + Intergenic
1176776874 21:13144507-13144529 ATGAAGACCCAGACACACGATGG + Intergenic
1177095134 21:16823266-16823288 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1177810992 21:25924828-25924850 AAGAAAATCCAGCAAGCCGAGGG - Intronic
1178327341 21:31656652-31656674 AAAAAGAAAGAGAAAGAAGAAGG - Intergenic
1179081848 21:38178722-38178744 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1180462259 22:15575889-15575911 AAGAAGATGAAGAAAGAAGAAGG - Intergenic
1182183547 22:28376888-28376910 AAGAAGCACCAGAAAGAAACAGG + Intronic
1182547379 22:31084105-31084127 AAGAGGAACAAGAAAGGGGATGG - Intronic
1183199885 22:36378726-36378748 AAAAACAACAAAAAAGACGAAGG + Intronic
1183680407 22:39325417-39325439 AGGAAGAAGAAGAAAGAAGAAGG + Intergenic
1183773756 22:39948933-39948955 AAGAAAAATCAGAAAGCCAAAGG - Intronic
1183821935 22:40353303-40353325 AAGAAGAAGAAGAAAGGAGAAGG - Intronic
1183889600 22:40915698-40915720 CAGAATAGCCAGAAAGATGAAGG + Intronic
1184003823 22:41694505-41694527 AAGAAGGACAAGAAAGAGGCTGG + Exonic
1184185662 22:42863330-42863352 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1184345969 22:43913155-43913177 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1184345972 22:43913239-43913261 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1184368086 22:44065177-44065199 AAGACGAAGCAGATAGACAAAGG - Intronic
1184989879 22:48160183-48160205 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
949310444 3:2691390-2691412 AAGAAGAAAGAGGAAGAGGAGGG + Intronic
949828791 3:8191614-8191636 AAGAGGAAGAAGAAAGAAGAAGG - Intergenic
949828793 3:8191640-8191662 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
950352137 3:12365840-12365862 AAGAAGAAGAATAAAGTCGAAGG - Intronic
950360793 3:12448235-12448257 AAAAAGAAAAAGAAAGAGGAAGG + Intergenic
950771386 3:15314368-15314390 AAGAAAAACCAGACAGAGGCGGG - Intronic
952231946 3:31440881-31440903 AAAAAAAACCAGAAAAAGGAAGG - Intergenic
952344475 3:32471027-32471049 AAGAAGAAGAAGATAGAAGAAGG + Intronic
954006644 3:47596596-47596618 AAGAAGAAGAAGAAAAAAGATGG + Intronic
954280436 3:49573360-49573382 AAGATGGACCAGAAAGATGGAGG + Intronic
955000502 3:54923059-54923081 AAGAAGAACCAGGGAGATGAGGG - Intronic
955230968 3:57098387-57098409 AAGAAGAACTACAAACACAAAGG - Exonic
955307444 3:57848500-57848522 AGGAAGAAGAAGAAAGAAGAAGG - Intronic
956094563 3:65702563-65702585 AAGAACAAGCAAAAAGACCAGGG - Intronic
956202630 3:66722314-66722336 AAGAAGAAGGAGAAAGAGGGAGG - Intergenic
957304169 3:78435037-78435059 AAGAAGAATCATAATGATGATGG + Intergenic
957538325 3:81534609-81534631 GAGAAGAAACAGAAAAAGGAAGG + Intronic
957573289 3:81976712-81976734 AAGAAGGAGGAGAAAGAGGAGGG + Intergenic
957953842 3:87158796-87158818 AAGAAGAAAGAGAGAGAGGAAGG + Intergenic
958461124 3:94397254-94397276 ATGAAGACCCAGAAGGATGAGGG + Intergenic
960288129 3:115852814-115852836 AGGAAAAACCAGAAAGAAAATGG + Intronic
960537482 3:118829157-118829179 AAGAAGAAACAAAAAGAGGGAGG + Intergenic
960738499 3:120806392-120806414 AAGAAGCAGCAGAAACACAAGGG + Intergenic
960983900 3:123258858-123258880 AAGAAGAACCAAAAAGGCATAGG + Intronic
962163984 3:133029687-133029709 AAGAAGAAACAGAAAGAACGTGG + Intergenic
962559026 3:136586935-136586957 AAGAAGAGCCAGAAAATGGAGGG + Intronic
963603836 3:147397821-147397843 GAAAAGGACCAGAAAGATGAGGG - Intronic
963931080 3:151004877-151004899 AAGAAAAGACAGAAAGAAGAGGG - Intergenic
964715078 3:159713164-159713186 AAGAAGAAAGAGAAAGAAAAAGG + Intronic
965636384 3:170785639-170785661 AAGAAGAAAGAGAGAGACAACGG + Intronic
965711736 3:171562713-171562735 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
965783851 3:172315983-172316005 AAAAAGAAGAAGAAAGAAGAAGG - Intronic
965906494 3:173713980-173714002 AAGAAAAAGGAGAAAGATGAAGG + Intronic
966158715 3:176945936-176945958 AAGATGAAACAGAATGAGGAAGG + Intergenic
966757358 3:183384013-183384035 AATAAGAACCAGAAACTCAAAGG + Intronic
967197416 3:187040656-187040678 AAGAAGAACTAGAGAAAAGAAGG - Intronic
968039899 3:195580008-195580030 TAGAACAGCCAGCAAGACGAGGG - Intronic
968376544 4:47593-47615 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
969255075 4:5995959-5995981 AAGAAGAACCTGAAGGAGGTAGG - Intergenic
969708490 4:8829301-8829323 ATGAAGAGACAGAAAGACAAAGG + Intergenic
969938402 4:10706051-10706073 AAGAGGAACCAGAAACAAGGTGG + Intergenic
970166861 4:13247755-13247777 AAGTAGAAGGAGAAAGAAGATGG - Intergenic
970382668 4:15523729-15523751 AAGAAGAATCAGAGAAAAGAGGG - Intronic
971035840 4:22692054-22692076 GAAAAGAAACAGAAAGACCAGGG + Intergenic
971577401 4:28293226-28293248 TTGAAGAAGCAGAAAGATGAAGG + Intergenic
971914017 4:32843674-32843696 AAGAAGAGCAAGAAAAAGGATGG + Intergenic
972052131 4:34750361-34750383 AAGAAGAACCAGTTAGACCAAGG - Intergenic
972287414 4:37662390-37662412 AAGATGATCCAGAAAGAAAAAGG + Intronic
974070331 4:57117785-57117807 AACAAGAATCAAAAAGAAGAGGG - Intergenic
974136922 4:57830071-57830093 AGGAAGAAAGAGAAAGAGGAAGG + Intergenic
974385800 4:61201158-61201180 AAGAAGAAAAAGAAAGAGAAGGG + Intergenic
976221068 4:82757234-82757256 CAGAAGAACCACACAGACAAAGG - Intronic
976354597 4:84102476-84102498 TAGAAAAACCTGAAAGGCGAAGG + Intergenic
976703530 4:87997264-87997286 AAGAACTACCAGAAAGAAGCAGG - Intergenic
978037937 4:104019705-104019727 AAAAAAAACCTGAAAGACAAAGG + Intergenic
978268539 4:106858990-106859012 AAGAAGAAGAAGAAAGAAGGAGG + Intergenic
978386465 4:108180450-108180472 AAGAGGAAGCAAAAAGAAGAGGG + Intergenic
978852298 4:113353749-113353771 AAGCAGAAACAAAAAGAGGAAGG + Exonic
978912290 4:114078414-114078436 AAGAAGAAGAAGAAACACAAAGG + Intergenic
979405014 4:120299168-120299190 AAGAAAAAGGAGAAAGAGGAAGG - Intergenic
979975611 4:127192591-127192613 AAGTAGCACCAAAAAGAGGAAGG - Intergenic
980211497 4:129794185-129794207 GAGAAGGACGAGAAAGAGGAGGG - Intergenic
980649553 4:135694817-135694839 AAGATGATGCAGAAAGATGATGG - Intergenic
980742570 4:136972059-136972081 AAGAAGAAGGAGGAAGAAGAAGG + Intergenic
981168148 4:141587671-141587693 AAGAAGAAACTGAAAGACAAAGG - Intergenic
981422345 4:144565547-144565569 GGGAAGAACCAGAAAAACAAAGG - Intergenic
981530435 4:145747818-145747840 AAGAAAAACAAGAAAGAAGGAGG - Intronic
981640070 4:146931975-146931997 AAGAAAAAGCAGAAAGAAGAAGG - Intronic
981856147 4:149295306-149295328 AAGAAGAAAGAGAAACACGAGGG + Intergenic
982223942 4:153148669-153148691 AAGAAGAAAGACAAAGACAAAGG + Intergenic
982820372 4:159937400-159937422 CAGAAGAACAAGAAAGGCAATGG + Intergenic
982934760 4:161458641-161458663 AAGCAGAAACAGAAAGAAAATGG - Intronic
982970594 4:161980087-161980109 AAAAAGAAAAAGAAAGAGGAAGG + Intronic
983203160 4:164884205-164884227 AAGAAGAAAGAAAAAGAGGAAGG + Intronic
983226384 4:165089732-165089754 AAGAAGGACAAGAAACAGGAGGG + Intronic
983426715 4:167593458-167593480 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984781212 4:183527405-183527427 AAGAAGAAAGAGAGAGAGGAAGG + Intergenic
985405816 4:189637337-189637359 AAGAAGAAAGAGAAAAAAGAAGG + Intergenic
986143542 5:5054682-5054704 AAGAAAAAGAAGAAAGAAGAAGG + Intergenic
986391053 5:7288684-7288706 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
986603665 5:9499880-9499902 AAGAAGAAACCGAAATAAGAAGG + Intronic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987399045 5:17456098-17456120 AGAAAGAACCATAAAGAAGAGGG + Intergenic
987910175 5:24132529-24132551 AAAGAGAACCAGAAAGAATATGG + Intronic
988031622 5:25770670-25770692 TAGAAGAAACAGAAAGTTGAGGG + Intergenic
988193337 5:27966999-27967021 AGGAAGCCCCAGAAAGACGGGGG + Intergenic
988276655 5:29089664-29089686 AAGAGGAAGTAGAAAGAGGAGGG - Intergenic
988452622 5:31358670-31358692 AGGAAGAAAGAGAAAGAAGATGG - Intergenic
988632071 5:32942294-32942316 AAGAAGAAGGAGGAGGACGAGGG + Intergenic
988632089 5:32942416-32942438 AGGAAGAAGAAGAAAGAAGAAGG + Intergenic
989727580 5:44604778-44604800 AACAAGTACCGGAAAGAAGACGG + Intergenic
989992312 5:50781908-50781930 AATAAGAACAAGTGAGACGAGGG - Intronic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990474409 5:56147872-56147894 AAGAAGAAGAAGAAAGGAGAAGG - Intronic
990821383 5:59844597-59844619 AGGAAGAACCAGATATATGAAGG - Intronic
990877746 5:60505384-60505406 AAGGATAACCAGCAAGACAAAGG - Intronic
991409218 5:66330281-66330303 AAGAAGATCCAGGAAGATTAAGG + Intergenic
992033826 5:72751599-72751621 AGGAAGGAAGAGAAAGACGAAGG + Intergenic
992078456 5:73213242-73213264 AAGAAGAAGAAGGAAGAAGAAGG + Intergenic
992097393 5:73375665-73375687 AAGAACAAGCAGGAAGAGGAAGG + Intergenic
992560245 5:77944886-77944908 AAGAAGAAAGAGAGAGAGGAAGG + Intergenic
992864152 5:80940877-80940899 AAAAAGAACTAGAGAGAAGACGG - Intergenic
993070375 5:83154598-83154620 AAGAAAAACCAGAAAGACTCAGG - Intronic
994913679 5:105945617-105945639 AAAAAGAAGAAGAAAGAAGAGGG + Intergenic
995511816 5:112918241-112918263 AAGAACAACCAGTAGGAAGAGGG + Intronic
995735886 5:115298542-115298564 AAGAAGAAAAAGAAAGAAGGAGG + Intergenic
995796794 5:115949752-115949774 AAGGAAAACCAGATAGAAGAAGG + Intergenic
996300275 5:121973663-121973685 AAGAAGATCCACAAACACAAGGG - Intronic
996501395 5:124220560-124220582 AAGAAAAAGAAGAAAGAGGAGGG - Intergenic
996606568 5:125329977-125329999 AAGAAGAAGAAGGAAGAAGAAGG + Intergenic
996764852 5:127025760-127025782 AAGAAGAAAGAAAAAGATGAAGG - Intronic
997240694 5:132304621-132304643 AAGAAGAAGAAGAAAGATCAGGG + Intronic
997405358 5:133641916-133641938 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
997742606 5:136270293-136270315 AAGAAGAAACTGAAACACTAAGG - Intronic
999376614 5:151091170-151091192 AAGAAGAAGCAGAAAGGAGCTGG - Intronic
999444673 5:151629846-151629868 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
1000762283 5:165241276-165241298 AAGAAGAAAGAGAAAGAAAAGGG + Intergenic
1001146405 5:169188385-169188407 AAGAAAAACCTGGAAGAGGATGG + Intronic
1001426536 5:171626156-171626178 AAGAAGAAGAAGAAAGGTGAAGG - Intergenic
1001635205 5:173204993-173205015 AAGAGGAAAGAGAGAGACGAAGG - Intergenic
1001737807 5:174021114-174021136 AAGAAGAAGGAGAAGGAAGAAGG + Intergenic
1002123765 5:177026072-177026094 CAGGAGAACCAGGGAGACGAAGG - Intronic
1002288094 5:178178787-178178809 AAGAAAAAGAAAAAAGACGATGG + Intergenic
1002531070 5:179845790-179845812 AAAAAGAACCAAAAAGAGGCCGG - Intronic
1002952475 6:1828340-1828362 CAGAAGAAGCAGAGAGAAGAAGG + Intronic
1002969088 6:1995823-1995845 AAGCAGGACCAGAAAGAGGGAGG - Intronic
1002969140 6:1996162-1996184 TAGAAGAATGAGAAAGAGGAAGG - Intronic
1003056766 6:2828043-2828065 AAGAAGAATTAGCAAGAGGATGG - Intergenic
1003138625 6:3453811-3453833 AAGTAGAAGCAGAAAGTGGAAGG - Intronic
1003358692 6:5402069-5402091 AAGAAGAATCAGAAAGAAAGTGG - Intronic
1003358694 6:5402103-5402125 AAAAACAACCAGAAGGAGGATGG - Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1004368474 6:15031865-15031887 GAGAAGAAGAAGAAAGAGGAGGG + Intergenic
1004563245 6:16771330-16771352 AAGGAGAATCAGAAAGACCAAGG - Intergenic
1004585174 6:16992547-16992569 AGGAAAAACTAGAAAGACCACGG + Intergenic
1004615977 6:17289312-17289334 AAGGAGAACCCGAAAGACCTTGG - Intronic
1004823904 6:19400016-19400038 TAGATGACCCAGAAAGACTAAGG + Intergenic
1005947751 6:30606611-30606633 AAGAAGAAACGTAAAGATGAAGG - Exonic
1007025965 6:38574436-38574458 AAAAAGTACCAAAAAGACTAGGG + Intronic
1007126500 6:39430150-39430172 GAGAAGAAGCATAAAGAAGAGGG - Intronic
1007590920 6:43020631-43020653 AATAAGAGACAGAAAGAAGAGGG - Intronic
1008034318 6:46730141-46730163 AAAAATAACCAGAATGATGAGGG + Intronic
1008999454 6:57696759-57696781 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1009034611 6:58101433-58101455 AAGCACAATCAGAAAGACAAGGG + Intergenic
1009349054 6:62651941-62651963 AAGAAAAAGCAGAGAGAAGAGGG - Intergenic
1009961464 6:70527764-70527786 AAGAAGGAGCAGAACGAAGAGGG - Intronic
1010351166 6:74876289-74876311 AAGAAGAACAAGGAGGAGGAAGG + Intergenic
1010485669 6:76410457-76410479 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1011113126 6:83860059-83860081 ATAAAGGACCAGAAAGAAGAGGG - Intronic
1011749400 6:90440009-90440031 AAAAAGAAAAAGAAAGAGGAAGG - Intergenic
1011851697 6:91637229-91637251 AAAAAAAACCAGAAAGACACGGG - Intergenic
1012754282 6:103205342-103205364 AAGAAGAAGTAGAAAGAAGTAGG - Intergenic
1012993859 6:105953483-105953505 AAGAGGAACCAAAATGAAGATGG - Intergenic
1013028027 6:106298639-106298661 AAAATGAACCAGAAAAACGAAGG + Intronic
1013101895 6:106994147-106994169 AAGAACTACCACAAAGACAATGG - Intergenic
1013175453 6:107673059-107673081 AAGAAGAAAGAGAAATAAGAAGG + Intergenic
1013793590 6:113860094-113860116 AAGAAGAACAAGAAGGAGGCTGG + Exonic
1013859078 6:114611998-114612020 AGGAAGAAAGAGAAAGAAGAAGG - Intergenic
1014344844 6:120255160-120255182 AAGAAGACACACAAAGAGGAGGG - Intergenic
1014585312 6:123190910-123190932 AAGAAGAGACAGATAGACCAGGG + Intergenic
1015955103 6:138590467-138590489 AGGAAGAACCAGAGGGAAGAGGG - Intronic
1016744863 6:147568226-147568248 AAGAAAAACCAGATATACCAGGG + Exonic
1017282929 6:152642738-152642760 AAAGAGAACGAGAAAGACCATGG - Intergenic
1017790174 6:157790836-157790858 ACAGAGAACCAGAAAGACAAAGG - Intronic
1017799568 6:157881347-157881369 AAGGAGAGGGAGAAAGACGAGGG - Intronic
1018209387 6:161465811-161465833 AAGAAGAAAAAGAAAGAGAATGG - Intronic
1018788267 6:167125683-167125705 AAGCAGAACCAGAAGAAAGAGGG - Intronic
1019763827 7:2834664-2834686 AAGATGAACCACATATACGATGG + Intronic
1019939120 7:4275288-4275310 AAGAAGAAAAAGAAAGATGAGGG + Intergenic
1020577346 7:9949887-9949909 AAGAAGAAGAAGAAGGAAGAGGG + Intergenic
1021807490 7:24371692-24371714 CAGAAGTATCAGAAAGATGATGG - Intergenic
1021916430 7:25437934-25437956 AAGAAGAAGTGGAAAGACAAGGG - Intergenic
1022420223 7:30213330-30213352 AGTAAGAAACAGAAAGAGGAAGG - Intergenic
1022840110 7:34156178-34156200 AATAAGAACGAGAAAGACCCAGG + Intergenic
1022934867 7:35163786-35163808 GAGAAGAACCAGCTAGACGTGGG - Intergenic
1023047089 7:36219590-36219612 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023047096 7:36219639-36219661 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023214496 7:37847531-37847553 AAGAAGAAGGAGAAAGAAGAAGG + Intronic
1023290442 7:38663170-38663192 AAGCACAATCAGAAAGACAAAGG + Intergenic
1023550906 7:41369161-41369183 AAAAAGAAAGAGAAAGAAGAAGG - Intergenic
1023584391 7:41714244-41714266 AGGAAGAAAGAGAAAGAGGAGGG + Intergenic
1024032258 7:45471412-45471434 AAGAAGAAGAAGAAAGAAGGAGG + Intergenic
1024431624 7:49294945-49294967 AAGGAGAATCTGAAAGAAGAAGG + Intergenic
1024805866 7:53138962-53138984 ATGAAGACCCAGACACACGATGG - Intergenic
1024999546 7:55303652-55303674 AAAAAGAAGAAGAAAGAAGAAGG + Intergenic
1025776396 7:64564405-64564427 AAAAAGAAAAAGAAAGACCAGGG - Intergenic
1025854125 7:65263612-65263634 CAGAAGGACCAGGAAGACAAGGG - Intergenic
1025885784 7:65590020-65590042 ATGAAGACCCAGACACACGATGG - Intergenic
1026760900 7:73125040-73125062 AACAAGGATCAGAAAGACAAGGG + Intergenic
1027037242 7:74933836-74933858 AACAAGGATCAGAAAGACAAGGG + Intergenic
1027086320 7:75267616-75267638 AACAAGGATCAGAAAGACAAGGG - Intergenic
1027351158 7:77312941-77312963 AAGAAGAATGAGAAACACAAGGG - Intronic
1027615129 7:80413394-80413416 AAGAAGAAACAGACAGAAGGAGG - Intronic
1027821540 7:83051756-83051778 AAGAAGAAGAAGAAAGTTGAAGG + Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1028256013 7:88598482-88598504 AAGAAGAACAAGAAAGCGGAGGG + Intergenic
1029392619 7:100285642-100285664 AACAAGGATCAGAAAGACAAGGG - Intergenic
1029835143 7:103301514-103301536 AAGGAGAAACAGAAAAAGGAAGG + Intronic
1029956686 7:104647772-104647794 AGGAAGAAGGAGAAAGAGGAAGG + Intronic
1029966397 7:104745245-104745267 AGGAAGAAGGAGAAAGAGGAAGG - Intronic
1031618574 7:123908916-123908938 AAGAAGAAGAAGAAGGAAGAAGG + Intergenic
1032661445 7:133988366-133988388 AAGAAAAATCAGAAAAAAGAAGG - Intronic
1032989961 7:137382758-137382780 AAGTAGAACAAGAAAGAAGGTGG + Intronic
1033002551 7:137523064-137523086 AAAAAGAAAGAGAAAGACGGAGG + Intronic
1033282301 7:140014916-140014938 AAGAAGAAGAAGAAAGAAGGAGG + Intronic
1033610682 7:142961131-142961153 AAGAAGAGGCAAAAAGACAAGGG + Intronic
1033959727 7:146899664-146899686 AAGAAGAACCAGGAAATCCAAGG + Intronic
1034251555 7:149695541-149695563 AAGAAGAAGAAGAAAGGCAAAGG + Intergenic
1035110779 7:156479854-156479876 AACAAGAAAAAGAAAGAGGAGGG + Intergenic
1035766260 8:2108132-2108154 AATTAGAATCAGAAAGAAGATGG - Intronic
1035841552 8:2817291-2817313 AAGAAGCAGCAGAAAGACATGGG + Intergenic
1037277727 8:17199745-17199767 AAAAAGAAGAAGAAAGAAGAAGG - Intronic
1037344211 8:17880961-17880983 AAAAAGAACCAGAATTACTAAGG - Intronic
1037710896 8:21354758-21354780 AAGAAGAGCCAGAAGGGTGAAGG - Intergenic
1038216549 8:25566981-25567003 AAGCAGAGAAAGAAAGACGAAGG - Intergenic
1038829365 8:31040152-31040174 ATGAGCAACCAGAAAGATGAAGG + Intronic
1038900918 8:31842821-31842843 AAGAGGAACCAGACACAAGAAGG - Intronic
1039556936 8:38483267-38483289 AAGCAGAAACAGGAAGAGGAAGG - Intergenic
1039806199 8:41001795-41001817 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1039854007 8:41397171-41397193 AAGAAGGAGCAGCAAGACGAAGG + Intergenic
1040719301 8:50297793-50297815 AAGCAAAACCAGAGAGAAGAGGG + Intronic
1041360944 8:57053440-57053462 AAGAGAAACCAGAATGAAGAAGG - Intergenic
1042264598 8:66895372-66895394 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1042601718 8:70505586-70505608 AAAAAGAAAAAGAAAGAAGAAGG - Intergenic
1042819225 8:72911929-72911951 AAGGGGAAACAGAAAGACAATGG - Intronic
1043503952 8:80884610-80884632 AGGAAGAAGAAGAAAGAGGAAGG + Intergenic
1044152432 8:88798034-88798056 AAGAAGAAAGAAAAAGAGGAAGG - Intergenic
1044203405 8:89462976-89462998 AAGAAGAACCAGACTGTCTAAGG - Intergenic
1044444604 8:92259806-92259828 AAGAAGAACCAGAGAAAGTACGG + Intergenic
1045101799 8:98852008-98852030 AAAAAGAAAAAGAAAGAAGAAGG + Intronic
1045558317 8:103236526-103236548 GAGTAGAATCAGAAAGACGGGGG - Intergenic
1045806215 8:106165480-106165502 AGAAAGAAACAGAAAGAGGAAGG + Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046230123 8:111345290-111345312 AAAAAGAAGAAGAAAGAGGAAGG + Intergenic
1046739588 8:117814025-117814047 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1046918919 8:119706859-119706881 AAGAAGAAAGAGAGAGAGGAAGG - Intergenic
1047062960 8:121248782-121248804 AAGAAGGAGCAGAAGGACAAAGG - Intergenic
1047350556 8:124069428-124069450 AAGAAGAAACCCAAAGATGATGG + Exonic
1047556971 8:125942120-125942142 CAGAAAAACCAGAAACAGGAAGG - Intergenic
1047874991 8:129126296-129126318 AAGAAGAAGAAGAAAAAAGAAGG + Intergenic
1048735860 8:137500829-137500851 AAAAAGAAAAAGAAAAACGAAGG - Intergenic
1050444654 9:5706567-5706589 AAGAAGAACCCAAAACAAGATGG - Intronic
1050475917 9:6040967-6040989 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1050942169 9:11473144-11473166 AAGAAGCAGAAGAAAGAAGAAGG + Intergenic
1050942172 9:11473187-11473209 AAGAAGAAGAAGAAAGTAGAAGG + Intergenic
1051522813 9:18009218-18009240 AAGAAGAAATAGGAAGATGAAGG - Intergenic
1051804522 9:20977169-20977191 ACAGAGAACCAGAAAGATGATGG - Intronic
1051867196 9:21695959-21695981 AAGAAGATCCAGAATGACGCTGG + Intergenic
1052002724 9:23306382-23306404 AAAAAGAAACAAAAAAACGACGG + Intergenic
1052381030 9:27771087-27771109 AAGAATAACCATAAAAACCATGG + Intergenic
1052381523 9:27776021-27776043 AAGAAGAATCAGACAGGTGAAGG - Intergenic
1052597649 9:30580834-30580856 AAGAGGAACAAGAAAGTGGAGGG + Intergenic
1053147942 9:35724547-35724569 AAGCAGAACTAGAAAAAAGAGGG - Intronic
1053504048 9:38625560-38625582 AAGAAGAGGCAGAAAGAGGATGG - Intergenic
1054745476 9:68849997-68850019 AACAAGAACCAGAATGACCATGG + Intronic
1056099868 9:83291026-83291048 AAGAAGAAACAAAAAGACATGGG + Intronic
1056697627 9:88873345-88873367 AAGAAGAAGAAGGAAGAAGAAGG + Intergenic
1057616961 9:96600332-96600354 AAGAAGAACTGGACAGATGAGGG + Intronic
1058159505 9:101552549-101552571 AAGAAGAACGAGAACGAGAAAGG + Exonic
1058470263 9:105270577-105270599 AGGAAGGCCCTGAAAGACGAAGG - Intronic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058771865 9:108241849-108241871 AATAAGAACCAGAAAGAAAATGG + Intergenic
1058981353 9:110173587-110173609 AGGAAGTACCAGGAAGAGGAGGG - Intergenic
1061442324 9:130614261-130614283 AAGAAGAATCAAGAAGATGAGGG - Intronic
1061617626 9:131790729-131790751 AAGAAGAAACAGAGACACTAAGG + Intergenic
1062638472 9:137504051-137504073 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1062638474 9:137504074-137504096 AAGAAGAAGAAGGAAGAAGAAGG + Intronic
1062662694 9:137646995-137647017 TGAAAGAACCAGTAAGACGAAGG - Intronic
1203572686 Un_KI270744v1:146580-146602 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1203656900 Un_KI270753v1:6757-6779 AAGAAGAAAGAGAAAAAAGAAGG + Intergenic
1185492334 X:527167-527189 AAGAAGAAAGAAAAAGAAGAAGG - Intergenic
1185875711 X:3700563-3700585 AAGAAAAAAGAGAAAGAAGAAGG - Intronic
1185992653 X:4909519-4909541 AGGAAGAAAGAGAAAGAAGAAGG - Intergenic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186102595 X:6172922-6172944 AGGAAGAACAAGAAAGCTGATGG + Intronic
1186312920 X:8339779-8339801 AAGAAGAAAAAGAAAGAAGAGGG + Intergenic
1186365747 X:8891446-8891468 AATAAGGTCCAGAAAGACTAAGG + Intergenic
1186443703 X:9607739-9607761 AAGTAGAACATGAAAGAGGATGG + Intronic
1186619526 X:11224180-11224202 AAGATGAAGAAGAAAGAAGAAGG + Intronic
1186619530 X:11224242-11224264 AAGATGAAGAAGAAAGAAGAAGG + Intronic
1186647586 X:11523766-11523788 AAGTAGAACCAGCAAGTGGAGGG + Intronic
1186835027 X:13429033-13429055 AAGAAGAAGAAGAAAGAAAAGGG - Intergenic
1187025794 X:15434156-15434178 AAGAAGGAGGAGAAAGAAGAAGG + Intronic
1187025802 X:15434217-15434239 AAGAAGAAGGAGATAGAAGAAGG + Intronic
1187283942 X:17884803-17884825 AAGAAAAACCACACAGAAGAAGG - Intergenic
1187417902 X:19109045-19109067 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1187741069 X:22355916-22355938 AAGAATAACCAGCATGGCGAAGG - Intergenic
1187853884 X:23618092-23618114 AAGAATAACCAGAAAAACTATGG + Intergenic
1188349745 X:29113364-29113386 AAGAAGATCAATAAAGAGGAGGG - Intronic
1188486072 X:30683918-30683940 GAGAAGTACCAGGAAGACTAGGG - Intronic
1188602215 X:31981591-31981613 AAGAAGAACCAGAAAGACGAAGG + Intronic
1189420464 X:40852735-40852757 AAGTAGAAGCTGAAAGAGGAAGG + Intergenic
1189867952 X:45351148-45351170 AAGCAGAGCCAGAAAGAAGAAGG - Intergenic
1190005299 X:46731004-46731026 AAGAAGAACCAGGAAGACTCAGG + Intronic
1190047480 X:47124281-47124303 AAGAAGAAAGAGAAAGAGGCCGG + Intergenic
1190533784 X:51407047-51407069 CAGAAGCACCAGCAGGACGAGGG + Exonic
1190821824 X:53980411-53980433 ATGAAGAGGCAGCAAGACGAAGG + Intronic
1190887279 X:54541094-54541116 AAGAAGAAAAAGAGAGATGAAGG - Intronic
1191105773 X:56771218-56771240 CAGAAGAACAAGAAAGAGGGAGG - Intergenic
1191106766 X:56776620-56776642 CAGAAGAACAAGAAAGAGGGAGG - Intergenic
1191788504 X:64943589-64943611 ACAAAGATCAAGAAAGACGAAGG - Intronic
1191821800 X:65318383-65318405 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1192272041 X:69589907-69589929 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1193102974 X:77636788-77636810 AAGAAGAAGGAGAAGGAAGAAGG + Intronic
1193103000 X:77636897-77636919 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1193851804 X:86546312-86546334 AAGAAGAAGAAGAAAGAGGTAGG - Intronic
1194480404 X:94414968-94414990 AAGAAGAACGAGAAAGAAAAGGG - Intergenic
1194858158 X:98959977-98959999 CAGAAGAAACAGAAACAAGATGG + Intergenic
1194938609 X:99981879-99981901 AACAAGAACAAGAGAGAAGAAGG - Intergenic
1195317725 X:103695095-103695117 AAGAAGGACCAGGAAGGCAAAGG - Intergenic
1195433337 X:104813963-104813985 AAGAAAAACTAGAAAGACCAAGG - Intronic
1195863222 X:109403192-109403214 AAGAAGGAGCAGATAGATGAGGG - Intronic
1195965185 X:110423343-110423365 AAAAAGAAAAAGAAAGAGGAAGG + Intronic
1197381175 X:125742300-125742322 AAGAAGAACAAGAAAAACCCAGG + Intergenic
1197645766 X:129015124-129015146 CAGAAGAAGCAGCAAGAAGATGG - Intergenic
1197904823 X:131413424-131413446 AAGAAGAAGAAGAAAGAAAAGGG + Intergenic
1198396908 X:136228640-136228662 AAGAGGAAGAAGAAAGACAACGG - Exonic
1198409596 X:136353004-136353026 AAGAAGAAAAAGAGAGACCAGGG - Intronic
1198818751 X:140622389-140622411 AAAAAGAAGAAGAAAGATGAAGG + Intergenic
1199751538 X:150824078-150824100 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1199751568 X:150824223-150824245 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1201461675 Y:14232565-14232587 AAGAAGAAGCAGAAGAAGGAAGG - Intergenic