ID: 1188612182

View in Genome Browser
Species Human (GRCh38)
Location X:32114300-32114322
Sequence GTTGAGGCACAGAGACAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 250}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188612182 Original CRISPR GTTGAGGCACAGAGACAAAT TGG (reversed) Intronic
900009481 1:92830-92852 GTGGAGGGACAGAAACAAGTGGG + Intergenic
900025591 1:269407-269429 GTGGAGGGACAGAAACAAGTGGG + Intergenic
900358815 1:2278187-2278209 GGTGGGGCACAGAGACCAGTGGG - Intronic
901211869 1:7531259-7531281 GTGGAGGCACAGTGACAACAAGG - Intronic
902637707 1:17745461-17745483 TTGGAGGCACAGAGAAAAACAGG + Intergenic
903809654 1:26028371-26028393 GTTCAGGCTCAGAGCCAAACAGG + Intronic
906968135 1:50480438-50480460 GCTGAGGCACAGTGTTAAATAGG + Intronic
908078166 1:60543734-60543756 CTTGAGACAAAGAGAGAAATGGG + Intergenic
908494772 1:64683471-64683493 ATTGAGGAACAGAGAGAAAAAGG - Intronic
908964408 1:69740596-69740618 GATGAGGTACAGAAACAACTGGG + Intronic
912350130 1:109004683-109004705 GTTGATGCACAGAGGCCTATCGG - Exonic
914007227 1:143742954-143742976 ATTGCAGCACAGAGACAAAGAGG - Intergenic
914646044 1:149653448-149653470 ATTGCAGCACAGAGACAAAGAGG - Intergenic
916169377 1:161989101-161989123 GATGAGCCAGAGAGACAAACTGG - Intronic
917019083 1:170566957-170566979 ATTGAGGTTCATAGACAAATGGG - Intergenic
919105563 1:193146520-193146542 AATGAGACACAGAGAGAAATGGG + Intronic
919280955 1:195487579-195487601 CTAGAGGCAAAGAGACAAGTTGG + Intergenic
920139013 1:203794066-203794088 GTCGTGGCACAGACAGAAATTGG + Intergenic
921955110 1:220974389-220974411 GTTCAGGCACAGAGACTCACTGG + Intergenic
924664270 1:246054665-246054687 GTTGATGTACAGTGACAAAAAGG + Intronic
1063991889 10:11575267-11575289 GATGAGGCACAGAGAGAATTGGG - Intronic
1064009893 10:11727435-11727457 GGGGATGCTCAGAGACAAATGGG + Intergenic
1064307355 10:14179480-14179502 GTTGAGGCAGAGAGAAAAAGGGG - Intronic
1065753516 10:28910077-28910099 GTGGAGGCACACAGGCAAAGTGG - Intergenic
1066177412 10:32923319-32923341 GTTGAGGCAAAGAGTGAAAGTGG + Intronic
1069309330 10:67014020-67014042 GATGAAGGACAGAGACAAAAGGG + Intronic
1072758036 10:98033567-98033589 GAGGATGCACAGAGAGAAATGGG - Intergenic
1074760952 10:116667145-116667167 CTTGTGACACAGAGACAAAGGGG + Intronic
1077892963 11:6432525-6432547 ATTGAGGAAAAAAGACAAATGGG - Intronic
1078322695 11:10350988-10351010 GGGGAGGCAGAGAGAGAAATAGG + Intronic
1078396790 11:10988592-10988614 TTAGAGGCACAGAGAACAATTGG + Intergenic
1078504897 11:11929796-11929818 GTTCAGGCCCAGAGGAAAATTGG - Intronic
1078746716 11:14122597-14122619 AATGAAGCACAGAGAAAAATGGG - Intronic
1079118216 11:17654018-17654040 TTTGAGGCACAGTGACACATGGG - Intergenic
1079338247 11:19589967-19589989 GTTGAGGCACAGAGAGAGGCAGG - Intronic
1080183689 11:29453820-29453842 GTTCAGGCACAGAGGAAAATAGG - Intergenic
1081366145 11:42237860-42237882 GATGAGTCACAGAGACAAGAAGG + Intergenic
1081844977 11:46234123-46234145 GTTGAGGCACTGAGTCACAGAGG + Intergenic
1082271623 11:50178395-50178417 GTTCAGCAGCAGAGACAAATGGG + Intergenic
1082858701 11:57833068-57833090 GCTGAGGCACAGGGACATACAGG + Intergenic
1085325199 11:75601326-75601348 GTTAAGGGAGAGAGACAAAACGG - Intronic
1087111422 11:94473485-94473507 GTTGATGTAGAGAAACAAATGGG + Intronic
1088835024 11:113570455-113570477 CTTGAGGCTCAGAGACATAAGGG - Intergenic
1089953060 11:122547638-122547660 GTTGGGGCACAGAGATAGGTCGG - Intergenic
1090267424 11:125362056-125362078 GTTGAGGGAGAGGGACAAACTGG + Intronic
1090425245 11:126602975-126602997 ACTGAGGCATAGAGACCAATAGG + Intronic
1090735895 11:129611957-129611979 GTTCAGACACAGAGAGGAATCGG - Intergenic
1090955382 11:131509110-131509132 GTAGAGGCAAGGGGACAAATGGG - Intronic
1091148103 11:133298546-133298568 GTTAAGGCAGAGAGACCAAGAGG - Intronic
1091856838 12:3747339-3747361 GTTGATGCACAGAAACACACTGG - Intronic
1091999994 12:5024072-5024094 GAGGAGCCACAGGGACAAATGGG - Intergenic
1092833731 12:12468760-12468782 GTTGATGAACACAGTCAAATAGG + Exonic
1094325101 12:29229425-29229447 GTTGAGGAACAAAAATAAATTGG + Intronic
1095495838 12:42782643-42782665 GTTCAGCCACAGAGACAGCTAGG - Intergenic
1095834849 12:46626363-46626385 GCAAAGGCACAGAGACAAAACGG - Intergenic
1098795628 12:74885323-74885345 GTTGAAGCCCAAAGGCAAATTGG + Intergenic
1100120298 12:91362266-91362288 GTTGAGCCACAGTGATAAAGGGG - Intergenic
1101213094 12:102554066-102554088 GTTGAGACACAGAGAAAGAATGG + Intergenic
1101945429 12:109132688-109132710 GTGAATACACAGAGACAAATCGG - Intronic
1104498127 12:129259908-129259930 GATGAGGGAAAGAGCCAAATTGG + Intronic
1107482090 13:40793641-40793663 GTTGAGGAATAGAGAGAACTGGG - Intronic
1107628000 13:42310278-42310300 GTTCTGGCACAGAGAAAAAGCGG + Intronic
1109521388 13:63515231-63515253 GATGAGACATAGAGACAGATAGG + Intergenic
1111062192 13:83036080-83036102 GTTAATGCACAGAAACAAACTGG - Intergenic
1111639649 13:90951383-90951405 GATGATGCCCAGAGAGAAATGGG - Intergenic
1112392527 13:98998367-98998389 GTCTAGGCATAGAGACAAATGGG + Intronic
1112697878 13:101970906-101970928 TTTGAGCTACAGAGAGAAATAGG - Intronic
1113017676 13:105846320-105846342 GTTGAGGCACAGAGTAAGCTGGG - Intergenic
1113864229 13:113510663-113510685 ATTGAGGGCCAGAGAGAAATTGG + Intronic
1114357290 14:21925183-21925205 TTTGAGGCACTAAGAAAAATAGG + Intergenic
1114430718 14:22658111-22658133 GCTGAGGCACAGAGACATTAAGG + Intergenic
1114659092 14:24333589-24333611 ACTGAGGCTCAGAAACAAATAGG - Intronic
1118249791 14:64148465-64148487 GTAATGGCACAGAGGCAAATGGG - Intronic
1118933697 14:70266051-70266073 GTTGGGCCAAAAAGACAAATTGG - Intergenic
1119534839 14:75394624-75394646 GCTGAGGGACAGTGAAAAATGGG - Intergenic
1119935081 14:78585043-78585065 TTTGAGGAAAAGAGACAAAAAGG + Intronic
1120738007 14:88076941-88076963 GCTGAAGCAAAGAGACAATTAGG + Intergenic
1126241356 15:46447914-46447936 GTTGAGGCAAAGAGGAAATTCGG + Intergenic
1128616793 15:69116584-69116606 AAGGAGGCAGAGAGACAAATGGG + Intergenic
1128901240 15:71424337-71424359 GTTGGGGAACAGAGAAAATTGGG + Intronic
1129205648 15:74035680-74035702 GTTGAGCCACTGGGATAAATGGG - Intronic
1129925371 15:79359065-79359087 GGAGAGGCACTCAGACAAATTGG + Intronic
1130054155 15:80507868-80507890 GGTGAGGGAGAGAGCCAAATTGG + Intronic
1131377085 15:91934392-91934414 GTAGAAGCACAGAGACCCATGGG + Intronic
1131862772 15:96672326-96672348 GCTGAGGCTCAGAGACATTTAGG + Intergenic
1132072486 15:98790622-98790644 CTCGAGGCACAGAGACAGAAGGG - Intronic
1133108174 16:3527801-3527823 GCTGAGGCAGAGAGACAGAGAGG - Intronic
1137369344 16:47890389-47890411 ACTGAGGCACAGAGAGAGATGGG - Intergenic
1138789249 16:59883132-59883154 GTTCAGGCACTGAGACAGAAAGG + Intergenic
1138796514 16:59976427-59976449 CATGAGACACAGAGTCAAATGGG + Intergenic
1139213297 16:65102302-65102324 GTTGACTCAATGAGACAAATTGG - Intronic
1140201220 16:72896363-72896385 GGGAAGGCACAGAGACAGATGGG - Intronic
1140294570 16:73695817-73695839 GTGGAGATACTGAGACAAATGGG - Intergenic
1142454849 16:90214072-90214094 GTGGAGGGACAGAAACAAGTGGG - Intergenic
1143180748 17:4982562-4982584 GTTGAGTCACGGAGGGAAATGGG + Intronic
1143472826 17:7186607-7186629 GGTGGGGGACAGAGAGAAATAGG - Intergenic
1144150984 17:12445679-12445701 GTGGAAACAGAGAGACAAATAGG - Intergenic
1145066307 17:19763597-19763619 TATGAGGCACAGAGACACGTAGG + Intergenic
1145106074 17:20118239-20118261 GTTGATGCACAAGGACAAGTTGG + Intronic
1147162375 17:38575696-38575718 GCTGTGGGACAGAGACAACTGGG - Intronic
1148674386 17:49436680-49436702 GTGGAGGAACAGAGCTAAATAGG - Intronic
1149230251 17:54525436-54525458 TTTGAGGCACAGACAAAAACAGG + Intergenic
1149529948 17:57387090-57387112 ATTGAGGCAAAGAGGCAACTGGG - Intronic
1150282271 17:63935610-63935632 GGTGAGAAACAGAGACAACTTGG - Intergenic
1151210827 17:72542647-72542669 GATGAGGAACACAGACAAAGTGG - Intergenic
1151741395 17:75984940-75984962 GTTGATGAAGAGAGTCAAATTGG + Intronic
1151868185 17:76818943-76818965 TTTGAGACACAGAGACGCATAGG + Intergenic
1154221379 18:12457798-12457820 ATTGTGCCACAGAGAGAAATGGG + Intronic
1155746413 18:29361074-29361096 GAAGAGGCAGAGAGACAAAGAGG - Intergenic
1158207184 18:55006340-55006362 GTAGGGACACAGAGAGAAATAGG - Intergenic
1160464240 18:79062848-79062870 GTTGGGGCACAGAGGGAAAGAGG + Intergenic
1162896276 19:13766319-13766341 GCTGAAGCACAGAGATAGATAGG - Intronic
1163537937 19:17888490-17888512 CTTGAGGCAGAGAGATGAATGGG - Intronic
1164336798 19:24331495-24331517 ATTGAGGCACAGAGTGAAAAAGG + Intergenic
1164698477 19:30264461-30264483 GTTCAGGGCCAGAGACAAAATGG + Intronic
1164959815 19:32418104-32418126 TCTGAGGCACAGACACAAACTGG - Intronic
1167234052 19:48303242-48303264 GAGGAGTCACAGAGACAAAGAGG + Intronic
926708589 2:15856685-15856707 CAAGAGGCACAGAGACAAATAGG + Intergenic
926839112 2:17058772-17058794 ACTGAGGCACAGAGAAAAAAAGG - Intergenic
926910382 2:17847459-17847481 AATGAGGCACAGAAACAACTTGG - Intergenic
929932999 2:46273160-46273182 CTTGAGGCCCAGAGGCACATGGG + Intergenic
931028339 2:58140003-58140025 GTTGTCTCACAGAGAAAAATAGG + Intronic
931895180 2:66720571-66720593 ATTAAGGCCCAGAGAGAAATGGG - Intergenic
935875627 2:107504065-107504087 GTTGCAGCATAGAGACAACTGGG - Intergenic
936043815 2:109170955-109170977 GCTGAGGCACAGAGGCACACAGG + Intronic
936749449 2:115623196-115623218 GTTGAACCACAGAGACAACATGG + Intronic
937699685 2:124850362-124850384 AGAGAGACACAGAGACAAATAGG + Intronic
937921075 2:127131316-127131338 GTGAAGGCACAGAGAGAAAACGG + Intergenic
938823352 2:134980425-134980447 TTTGAGCCAAAGAAACAAATTGG - Intronic
938986559 2:136581960-136581982 GGTGAGGGACAGAGAGAAGTTGG - Intergenic
939713311 2:145551285-145551307 ACTGAGGGACACAGACAAATTGG + Intergenic
940079203 2:149780748-149780770 GTTGAGGAAGAGAAACGAATGGG - Intergenic
942005199 2:171691824-171691846 ATTGAGTCACACAGACCAATGGG + Intronic
942730465 2:179056346-179056368 GTTGGGGCACAGAGATAAAAAGG + Intergenic
945603860 2:211902177-211902199 GTGGAGGCACAGAGAACAAGGGG - Intronic
945638134 2:212385431-212385453 GTTGACTCACATAGACAGATAGG - Intronic
946146130 2:217732377-217732399 GTTGAGCCACAGAGAGAACCAGG - Intronic
947226766 2:227847990-227848012 ATTGAGGCACAGATACAAAGGGG + Intergenic
947643122 2:231718225-231718247 CTTGGGGCAGAGAGACAACTGGG - Intergenic
947937183 2:234017497-234017519 ATTGAGACACAGAGAGAAACAGG - Exonic
948134533 2:235626815-235626837 GGAGAGGTACAGACACAAATTGG + Intronic
1170605959 20:17875272-17875294 GTTGAGGCACCGAGAGTAAGGGG + Intergenic
1173257340 20:41404205-41404227 GTGGAAGAACAGAGACAAAGAGG - Exonic
1174896498 20:54454823-54454845 AGTGAGGCACAGAAACAACTGGG + Intergenic
1174989067 20:55489092-55489114 GCTGAGGCAAAGAGACAATATGG + Intergenic
1175738569 20:61404567-61404589 ATTGAGGCACAGAGACAACGTGG + Intronic
1177351605 21:19950471-19950493 GTTGTGGGACAGAGACAACTAGG + Intergenic
1178311222 21:31531477-31531499 GTTAGGGTACAGAGACAAACTGG + Intronic
1179080258 21:38164307-38164329 GTGGGGTCACAGAGACAAAGGGG - Intronic
1179196767 21:39171488-39171510 GTTGAGGCACATGGACGAAGTGG + Intergenic
1182341981 22:29630545-29630567 CTTCAGGCATAGAGACTAATAGG - Intronic
949527095 3:4915778-4915800 ATTTAGACACAGAGACACATAGG - Intergenic
950418149 3:12880363-12880385 TTTGGGGCTCAGAGACACATGGG + Intergenic
950626004 3:14247450-14247472 GCTGAGGCACAGAGAAGAAAAGG - Intergenic
955299615 3:57764722-57764744 ATTGAGGCACAGAGAGATCTTGG + Intronic
955866670 3:63391285-63391307 TTAGAGTCACAGAGACACATTGG - Intronic
956728061 3:72172847-72172869 ATTTACGCACAGAGAAAAATAGG + Intergenic
959532852 3:107453370-107453392 GATGAGGCACAGTGACACAAAGG - Intergenic
959792402 3:110378642-110378664 GAAGAGGCACAGAGACAAACGGG + Intergenic
959798772 3:110464740-110464762 GCTGTGGCATAGGGACAAATGGG + Intergenic
960724364 3:120655191-120655213 GTTGAGCCAGAGAGACTGATGGG + Intronic
961017258 3:123478002-123478024 TTTAAGGCACAGAGACACAGGGG + Intergenic
961538816 3:127586820-127586842 CTTGAGGCACAGAGGCCAGTGGG + Intronic
961710244 3:128823087-128823109 CTTGGGGCTCAGAGACACATGGG - Intergenic
964365090 3:155941962-155941984 GTTGAGGAACACTGACAAAAAGG - Exonic
967258611 3:187619489-187619511 GTTCAGGGACAGAGAAAAATAGG - Intergenic
967863330 3:194170041-194170063 GTGGGGGCACAGAGACAAATAGG - Intergenic
968285117 3:197504049-197504071 CTAGAGGCACAGACAGAAATGGG - Intergenic
969506372 4:7590626-7590648 ACTGAGGCCCAGAGACAAAGGGG + Intronic
970132582 4:12887584-12887606 GTTCAGACAGGGAGACAAATAGG + Intergenic
971327850 4:25658637-25658659 GGTGAGGCACACAGGCAACTCGG + Intronic
974214281 4:58824972-58824994 GTTGGAGCACAGTGACAGATGGG - Intergenic
976416873 4:84786646-84786668 ACTGAGGCACAAAGACATATAGG - Intronic
977569499 4:98614800-98614822 GTTTAGTCACAGAGACAAACTGG - Intronic
977917818 4:102613452-102613474 GTGGAGGCCCTGAGACAAATGGG + Exonic
978248901 4:106606957-106606979 TTTGAGACACAGAGTCATATGGG - Intergenic
978623567 4:110659116-110659138 CTTGAGACACAGAGACACAGGGG + Intergenic
979108579 4:116719803-116719825 GTTGGTGCACAGAGTAAAATGGG - Intergenic
981967374 4:150621330-150621352 GTTGAGGAATAAAGAAAAATAGG - Intronic
982129641 4:152216735-152216757 AATGAAGCACAGAGAAAAATTGG + Intergenic
982535142 4:156600820-156600842 GTTGAGGGACAGAGAGAGGTTGG - Intergenic
983337840 4:166419369-166419391 GAGGAGGTAGAGAGACAAATAGG - Intergenic
985812505 5:2100007-2100029 GTGGAGACAAAGAGACAAAAGGG + Intergenic
985983130 5:3488795-3488817 GGAGAGACACAGAGACAAAGGGG - Intergenic
986793547 5:11187248-11187270 TATGAGAAACAGAGACAAATGGG + Intronic
986859360 5:11907803-11907825 ACTGAGGCACACAGACAATTAGG - Intergenic
987982678 5:25107561-25107583 ACTAAGGCAGAGAGACAAATTGG + Intergenic
989001958 5:36770609-36770631 GTGAAGGCACAGAGAGAAAATGG - Intergenic
989193105 5:38690384-38690406 GTTGAGGCTTAAAGATAAATAGG - Intergenic
991702855 5:69332468-69332490 GGAGAGGCAGAGAGAGAAATAGG + Intronic
992639817 5:78759551-78759573 TTTGAGGCACAGAGATAAGAAGG + Intronic
992787269 5:80182495-80182517 GTTGAGCTACAGAGAGGAATAGG - Intronic
995234488 5:109811700-109811722 GGAGAGGCACAGAAACAAACTGG - Intronic
995372413 5:111433808-111433830 GATGACGCACAGCCACAAATTGG + Intronic
997857444 5:137384757-137384779 TTTGACACACAGAGACAAAGAGG - Intronic
998529146 5:142869029-142869051 GATGAGGCACAGAGAGTAACTGG + Intronic
999763637 5:154722053-154722075 CCTGAGGCACAGAGAGAAATTGG - Intronic
1001956394 5:175850872-175850894 GCTGAGGCAGAGACACAACTAGG + Intronic
1003991128 6:11487737-11487759 GTAGAGGCAGAGACATAAATGGG - Intergenic
1004564588 6:16784201-16784223 GTGGAGACACAGATACACATAGG + Intergenic
1005367712 6:25095924-25095946 GGGGAGGCACAGATACAAGTTGG + Intergenic
1007375768 6:41455671-41455693 ATTTAGCCACAGAGACACATAGG + Intergenic
1009342155 6:62569526-62569548 GTAGGTGCACAGAGAAAAATAGG - Intergenic
1009402856 6:63276904-63276926 GTTCAGGGCCAAAGACAAATTGG - Intronic
1010059508 6:71606341-71606363 GTTGACACAAAGAGGCAAATGGG - Intergenic
1010169945 6:72962709-72962731 GTGGAGCCAGAGAGACTAATAGG + Intronic
1010243310 6:73638243-73638265 GTTGAGCCAAAGAGAAAAATTGG + Intronic
1012110273 6:95221874-95221896 GTTGAGAAACAGGGACAAAAAGG - Intergenic
1012532585 6:100255954-100255976 ACTGTGGCACAGAGACAAAATGG + Intergenic
1012736372 6:102950389-102950411 GGTGAAGCACAGAAAAAAATTGG - Intergenic
1012806130 6:103895341-103895363 ATTGAGGAACAGAAACACATGGG - Intergenic
1012918247 6:105194271-105194293 TCAGAGGCACAGAAACAAATGGG + Intergenic
1013724962 6:113083133-113083155 GTTTAGGCACAGGCAAAAATTGG - Intergenic
1016054397 6:139564481-139564503 GAGGAGGCAGAGAGACAGATTGG - Intergenic
1016527366 6:145017289-145017311 ATTGAGGCACAGACACAGACAGG - Intergenic
1016908385 6:149173463-149173485 ATAGAAGCACAGAGACACATAGG + Intergenic
1016976166 6:149810787-149810809 AAAGAGGCACAGAGCCAAATTGG + Exonic
1017205375 6:151799637-151799659 GGGGAAGCAGAGAGACAAATAGG + Intronic
1019747147 7:2707368-2707390 GTTGCGGCACAGAGGCACACCGG - Intronic
1020673369 7:11148180-11148202 GTTGAGGTATAGAGAAAGATGGG - Intronic
1021465518 7:20938654-20938676 CTTGAGGCACAGAAGCAAAATGG + Intergenic
1022371633 7:29777072-29777094 GTGGAGGCAGAGAGACCAGTTGG + Intergenic
1024002384 7:45199247-45199269 GTTTATTCACAGTGACAAATGGG - Intergenic
1025075301 7:55937402-55937424 GTAGAGGCAGAGAGACTCATTGG + Intronic
1027494045 7:78865419-78865441 GTTGATGGACAGAAACAAAAGGG + Intronic
1028549249 7:92039539-92039561 GTTGAGGTACAGACACAGAATGG - Intronic
1031555409 7:123169284-123169306 GCTGAGCCACATAGACAAAAAGG + Exonic
1032064393 7:128754760-128754782 CTTGAGTCAAAGAAACAAATGGG + Intronic
1032875541 7:136034387-136034409 GTTGAGGAAGAGAATCAAATTGG + Intergenic
1035560822 8:602418-602440 GCTGAGCCACAGAGACCAGTAGG + Intergenic
1037627360 8:20619783-20619805 GTTTAGACACAGAGACACAGAGG + Intergenic
1040546498 8:48402016-48402038 GTTGAAGCAGATAGAAAAATTGG + Intergenic
1040970489 8:53131299-53131321 GTAGAGACATAGAGACAATTGGG + Intergenic
1041299480 8:56395853-56395875 GTGGAGACACTGAGAAAAATGGG + Intergenic
1041774557 8:61509765-61509787 GTAGGGGCACAGAGAGAAAAAGG + Intronic
1042452645 8:68966644-68966666 GCTGAAGCAGAGAGACAATTAGG - Intergenic
1043087291 8:75850046-75850068 TCTGTGGCACAGGGACAAATGGG - Intergenic
1043112702 8:76208032-76208054 TTTGAGGCAAAGAGAGAATTAGG - Intergenic
1048897072 8:139001675-139001697 GCTGAGGCACAGAGAGGCATAGG + Intergenic
1049854454 8:144852775-144852797 CTTGGTGCACAGAGTCAAATTGG + Intronic
1051958732 9:22731858-22731880 ATTGAGGCAGAGAGACAAATTGG + Intergenic
1052295595 9:26893494-26893516 GTTGAATGACTGAGACAAATAGG - Intergenic
1053288324 9:36864211-36864233 GCTGAGGTACAGAGACAGAAAGG + Intronic
1053334835 9:37258180-37258202 ATTGAGGAACAGAGACATAAAGG - Intronic
1055178795 9:73356525-73356547 GTTAAGGCACAGATACTAACTGG - Intergenic
1056008971 9:82305135-82305157 GTTGAGGACCACAGACAGATAGG + Intergenic
1056512857 9:87322114-87322136 GTGGAGCCACAGACACAAAACGG - Intergenic
1057797647 9:98170025-98170047 GCTACGGCACAGAGACAAATAGG - Intronic
1059008818 9:110434057-110434079 GTAGAGGCCCAGAGATAGATGGG - Intronic
1059064388 9:111067865-111067887 GTTAAGGCACTGAGACTAGTAGG + Intergenic
1059789748 9:117628048-117628070 GTTGGTTCACAGAGACAAAGGGG + Intergenic
1060627483 9:125126902-125126924 CTTGAGGCAAAGAAGCAAATAGG - Intronic
1061259002 9:129469378-129469400 GTGGAGGCACAGAGAAGAAAGGG - Intergenic
1061709292 9:132476678-132476700 TTTGAGGCACAGAGACACACAGG + Intronic
1062080415 9:134620609-134620631 GCTGAGGCAGAGACACAATTAGG - Intergenic
1062262408 9:135669610-135669632 GTTGGGGCAGAGGGACAAATGGG - Intergenic
1186785624 X:12954067-12954089 CTGGAGATACAGAGACAAATAGG + Intergenic
1186941203 X:14509611-14509633 GTTGAGGCCAAGAGAAAAATAGG + Intergenic
1187077346 X:15948249-15948271 GTAGAGGAACAGAGAGAGATGGG - Intergenic
1188612182 X:32114300-32114322 GTTGAGGCACAGAGACAAATTGG - Intronic
1188760255 X:34019064-34019086 GTAGAGGAACAGAGAGAAAGGGG - Intergenic
1188760532 X:34023398-34023420 GTTGTTGCTCAGAAACAAATAGG + Intergenic
1189116452 X:38348233-38348255 ATAGAGGCAAAGAGACAAAGAGG - Intronic
1189588610 X:42487981-42488003 CTTTAGGCAGAGAGACAAAGGGG + Intergenic
1192198244 X:69046748-69046770 GCTGAGGCTCCGAGACAAAAAGG - Intergenic
1193092748 X:77511870-77511892 GAGGAGGCAGAGAGACAGATAGG + Intronic
1195236018 X:102899078-102899100 CAGGAGGCACAGAGACAAACTGG - Intergenic
1196462103 X:115942326-115942348 CTGGATGCACAGAGAGAAATGGG + Intergenic
1197302158 X:124794445-124794467 GTTAAGGCACAAGGAGAAATCGG - Intronic
1198064398 X:133082083-133082105 GTTGAAGCAGAGAGAGAAGTAGG + Intronic
1198250816 X:134877718-134877740 GTTGAGACACACAGAGAAATTGG - Intergenic
1198937457 X:141913470-141913492 GTTAATGCACAGAAATAAATTGG - Intergenic
1198961595 X:142189395-142189417 GTTAATGCACAGAAATAAATTGG + Intergenic
1199801094 X:151252188-151252210 GTTGAGGCACTGAGTCCATTGGG - Intergenic