ID: 1188618188

View in Genome Browser
Species Human (GRCh38)
Location X:32185347-32185369
Sequence GTGAAGAAACAGATTCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 614
Summary {0: 1, 1: 1, 2: 11, 3: 67, 4: 534}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188618188_1188618190 -6 Left 1188618188 X:32185347-32185369 CCTTCCTGAATCTGTTTCTTCAC 0: 1
1: 1
2: 11
3: 67
4: 534
Right 1188618190 X:32185364-32185386 CTTCACAATAACTCCCAGTCTGG 0: 1
1: 0
2: 0
3: 14
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188618188 Original CRISPR GTGAAGAAACAGATTCAGGA AGG (reversed) Intronic
901736513 1:11316006-11316028 GGGAAGAAACAGACTCAGAGGGG - Intergenic
901912645 1:12472999-12473021 GTAAAGAAACAGGTTGTGGAAGG + Intronic
902405179 1:16178918-16178940 TTGAAGAAACAGGCTCAGGGAGG - Intergenic
902411917 1:16216770-16216792 GCGAAGAAACAGAAGCAGAAAGG + Intergenic
902828299 1:18992700-18992722 GTGGAGAAACAGGTTGAGGCTGG - Intergenic
902914842 1:19631033-19631055 ATGAAGAAACAGTTTTTGGAAGG + Intronic
903257605 1:22113457-22113479 GTGAGGAACCAAATTGAGGATGG + Intergenic
903259465 1:22123464-22123486 CTGAAGGAAGAGATTCTGGAAGG + Intronic
903289439 1:22298665-22298687 GTGAAGAAACAGGTTCAGACAGG + Intergenic
904425876 1:30422672-30422694 GTTAAAATACAGATTCAGGCCGG + Intergenic
904473590 1:30750748-30750770 ATGAGGAAACAGGCTCAGGAGGG - Intronic
904534707 1:31191502-31191524 TTGAAGAAATAGATTCAGAGAGG - Intronic
904698819 1:32346203-32346225 GGGAAGAAACAGCTTCCGGAAGG + Intergenic
904891909 1:33785641-33785663 GAGAAGAAACAGAGGCAGGGTGG + Intronic
904940091 1:34159623-34159645 ATGAAGAAACAGGTTCAGAGAGG - Intronic
905119856 1:35673241-35673263 GTAAAGAAAGAGATTTAGAAGGG - Intergenic
906383171 1:45345676-45345698 ATGAAGAAACAGACTCAGAGAGG + Intronic
906848221 1:49218044-49218066 GAGCAGAAACAGAATCAGTAGGG - Intronic
907277523 1:53325529-53325551 GTGAGGAAACTGAGGCAGGAGGG + Intronic
907399708 1:54217375-54217397 CTGAAGACACAGAGTCAGGAGGG - Intronic
907717980 1:56945525-56945547 GTGCAGGAAGAGATCCAGGATGG + Intronic
908364585 1:63406632-63406654 GTAAAGTAACAAATTCAGCAAGG - Intronic
908600598 1:65735061-65735083 GTGAAGAAAGTGATACAGGAAGG - Intergenic
908775358 1:67634343-67634365 ATAAAGAAACAGATTCAGAGAGG - Intergenic
908918260 1:69158043-69158065 CAGAAGAAACAGCTTCAGGAAGG - Intergenic
909475627 1:76077786-76077808 GAGAAAAAGCAGATACAGGAAGG - Intronic
909781679 1:79556697-79556719 GGAAAGAAACATATTGAGGAAGG + Intergenic
911052693 1:93684595-93684617 GGGAGGAAACAGACTCAGGAAGG + Intronic
911185775 1:94903369-94903391 GAGCAGAAACAGATTCTGGAGGG + Intronic
911573927 1:99551613-99551635 TTAAGGAAACAGATTCAGAAAGG + Intergenic
911594944 1:99788831-99788853 GAGTAGAAACAGAATGAGGAGGG - Intergenic
912107927 1:106304067-106304089 ATGAAAAAGCAGGTTCAGGAAGG - Intergenic
912448045 1:109752193-109752215 CCTAAGAAACAGAGTCAGGATGG + Exonic
912603115 1:110959298-110959320 ATGAAGAAACAGATTCAAAGAGG - Intronic
912900906 1:113647258-113647280 GAGCAGGAACAGATTGAGGAAGG + Intronic
913282900 1:117202410-117202432 GAGAAGAAAGAGCTTCAGGGAGG + Intronic
913539462 1:119804975-119804997 GTGAGGAAACAGGCTCAGGATGG + Intronic
914447147 1:147759727-147759749 ATGAAGAAACAGACTCAGTGAGG - Intronic
914965016 1:152248630-152248652 ATGAGGAAACAGACTCAGAAAGG - Intergenic
915255923 1:154628471-154628493 GTGTAAACACAAATTCAGGATGG - Intergenic
915703308 1:157818892-157818914 ATGAAGAAACATATTGATGATGG + Intronic
916018727 1:160774988-160775010 GGGAAGGAAAAGATTAAGGAAGG + Intergenic
916245227 1:162681126-162681148 GCTAAAAAACAGATCCAGGAAGG - Intronic
917113705 1:171579486-171579508 GCGAAGGAACAAATACAGGATGG - Intronic
918602792 1:186383322-186383344 AGGAAGAAACAGATTTGGGATGG + Intronic
918610097 1:186479745-186479767 ATGAAGAAACAGATTAAGAGAGG + Intergenic
920087174 1:203426112-203426134 GTGAAGAAACAGATTCAGAGAGG - Intergenic
920124840 1:203685737-203685759 AAGAAGAAACAGACTCAGGGAGG - Intronic
920278607 1:204826998-204827020 GGGAAGAAAAAGAAGCAGGAAGG + Intergenic
920729394 1:208468634-208468656 ATGAGGAAACAGATTCAGAATGG + Intergenic
922244703 1:223784399-223784421 GGGAAGAAACAGGTACAGGCTGG + Intronic
922490396 1:226011969-226011991 GTGTGGAAACAGACTCAGAAAGG + Intergenic
922873364 1:228920801-228920823 GTGAAGAAAGAGTTTCAGAATGG - Intergenic
923047205 1:230364102-230364124 GTGAACAAAGAGATTGAGCAAGG - Intronic
923374117 1:233342903-233342925 ATGAAGAATCCGATTTAGGATGG - Intronic
923457727 1:234179107-234179129 GTCAAGAAACAGAGTCGTGAAGG - Intronic
923666566 1:236003519-236003541 ATGAAGAAAGTGTTTCAGGAAGG + Intronic
924395596 1:243616603-243616625 GTTAAGAAATTGATTCAGCAAGG - Intronic
924440782 1:244083456-244083478 GTGGAGCTCCAGATTCAGGAAGG + Intergenic
1063448184 10:6133479-6133501 GTGAGGAAACAGGTGGAGGAAGG + Intergenic
1064527248 10:16269908-16269930 GGCAAGAAACAGATTCAGTCAGG + Intergenic
1064531955 10:16319515-16319537 GAGAAGAAAGAGTTTCAGGGTGG - Intergenic
1064944264 10:20770680-20770702 ATGAAGAAACAGAACAAGGAAGG - Intergenic
1065627036 10:27640321-27640343 GTGAAGAAGGTGCTTCAGGAAGG + Intergenic
1065819785 10:29515056-29515078 GAGAAGGAAGAGATTGAGGAAGG - Intronic
1065953131 10:30669833-30669855 GAGAAGGAAGAGATTGAGGAAGG + Intergenic
1066046434 10:31599513-31599535 GAGAAGAAAGAGTTTCAAGATGG + Intergenic
1066534703 10:36379033-36379055 ATGAATATACAGTTTCAGGAAGG - Intergenic
1067509322 10:46882336-46882358 TTGGAGCAACAGATTCAGCATGG + Intergenic
1067652931 10:48169519-48169541 TTGGAGCAACAGATTCAGCATGG - Intronic
1067661558 10:48239818-48239840 ATGAGGAAACAGATTCAGAGAGG - Intronic
1067798243 10:49336536-49336558 GTGAAGAAACACAATCAATAGGG - Intergenic
1068324916 10:55472348-55472370 GTGAAGAAACATAATCATAATGG - Intronic
1068434129 10:56968901-56968923 GTGAAGAAGCAGATTGAGTAGGG + Intergenic
1068610876 10:59058562-59058584 CTGAAGAATCAGTTTTAGGACGG + Intergenic
1068885339 10:62091867-62091889 CTGAAGCAAGAAATTCAGGAGGG + Exonic
1069652683 10:70061275-70061297 GTGGATGAATAGATTCAGGAAGG + Intronic
1070828818 10:79406441-79406463 GTGAAGAAGCAGGGTCAGCAGGG - Intronic
1071355910 10:84794878-84794900 ATTAAGAAACACATTCAGCAAGG - Intergenic
1071873073 10:89816172-89816194 GTGAGGACACAGCCTCAGGAAGG + Intergenic
1072197794 10:93131525-93131547 ACAAAGAAACAGATTCAGAATGG - Intergenic
1072279743 10:93854867-93854889 GTGAAGAAATAGCCTCAGAAAGG - Intergenic
1072559099 10:96553621-96553643 GTGAAGCAAATCATTCAGGATGG - Intronic
1072837641 10:98733593-98733615 GTGAAGAAACACATTCAAAGAGG - Intronic
1073535605 10:104274476-104274498 GTGATGCAAGAGATTCAGAATGG + Intronic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1073911975 10:108356683-108356705 GTGAGGAAACAGGTTCAGATGGG - Intergenic
1074340138 10:112620432-112620454 AGGAAGAAACAGATTCAAGTGGG + Intronic
1074438623 10:113455622-113455644 ATGGGGAAACAGACTCAGGATGG - Intergenic
1074540150 10:114358428-114358450 ATGAAGAAACAGACTCAGGGAGG + Intronic
1077396571 11:2326660-2326682 GTGCAGCAACAGATGCAGGTGGG - Intergenic
1078363280 11:10686763-10686785 GTGAACAAACTGATTCAAGGAGG - Intronic
1078745970 11:14114603-14114625 GTGAAGAAATAGAGGCTGGATGG - Intronic
1079594651 11:22227484-22227506 GTGCAGTAAAATATTCAGGATGG - Exonic
1080463646 11:32477126-32477148 TTGAAGAAGCAGAGTCAGGCCGG + Intergenic
1080691296 11:34560757-34560779 ATGAGGAAACAGACTCAGGCAGG + Intergenic
1080957087 11:37110766-37110788 GTGGAGAAATAATTTCAGGAGGG + Intergenic
1081025928 11:38015304-38015326 TTGAAAAAACATATTCAGGCCGG + Intergenic
1081346927 11:41999365-41999387 CTGAAGAAGCAGCTTCAGTATGG + Intergenic
1082740065 11:56901008-56901030 ATGAAGAAACAGACTCACAAAGG + Intergenic
1082997358 11:59264572-59264594 ATGAAGAAACAGGCTCAGGTGGG - Intergenic
1083233598 11:61338297-61338319 ATGTAGAAACAGATTCAGAGAGG - Intronic
1083786695 11:64953238-64953260 GTAAGGAAACAGACTCAGGGAGG + Intronic
1084057235 11:66643426-66643448 TTGAAGAAACAGACGCAAGAAGG - Intronic
1084079962 11:66815901-66815923 ATAGAGAAACAGGTTCAGGAGGG + Intronic
1084969711 11:72764500-72764522 GTGAAGAAACTGAGGCAGGCCGG + Intronic
1085021807 11:73214729-73214751 GTAGAGAAACAGGTTCAGAAAGG - Intergenic
1085075871 11:73591504-73591526 ATGAATAAAAAGATTCAAGAGGG - Intronic
1085520117 11:77132816-77132838 ATGATGAAACAGGCTCAGGAAGG + Intronic
1085925752 11:81018546-81018568 TTGAAGAAAGGGATTAAGGAAGG + Intergenic
1085998116 11:81947157-81947179 GTGAAAATCCAGATTGAGGATGG - Intergenic
1086253872 11:84850674-84850696 TAGAATAAACAGATTCAGCAAGG + Intronic
1087104552 11:94396843-94396865 ATGAGGAAACAGATTCAGAGAGG - Intronic
1087321132 11:96660235-96660257 TTAAAGAAACAGACTCAGCAAGG - Intergenic
1087783915 11:102332604-102332626 GTGAAGAAATAGATCCCAGATGG - Intronic
1087895982 11:103586866-103586888 GTGAAGAAACAGACTCAAAGAGG + Intergenic
1088181648 11:107120127-107120149 GAGAGGAAACAGATTGAGGAAGG + Intergenic
1088747997 11:112820575-112820597 GAGAAGCAGCAGATGCAGGAAGG + Intergenic
1088829346 11:113522101-113522123 GTGAAGCACAAGATTCATGAGGG + Intergenic
1089465242 11:118680733-118680755 CTTAAGAAGCAGATTCAGGCTGG + Intergenic
1091112825 11:132986371-132986393 GTGAAGAAACAGAATAATTAAGG + Intronic
1091332736 11:134743445-134743467 GAGGAGAAACACAGTCAGGAGGG - Intergenic
1091443661 12:530643-530665 ATGAAGAAACAGAAACAGAAAGG - Intronic
1092024300 12:5227953-5227975 GGGAAGACAAAGATCCAGGAAGG - Intergenic
1092126847 12:6080592-6080614 GAGAAGAAACAGAGTCACCACGG + Intronic
1092623511 12:10300515-10300537 GTGAATAAACAAAGTCTGGATGG - Intergenic
1092766686 12:11859435-11859457 ATTAAGAAGCAGATTCAGGCCGG - Intronic
1092986511 12:13850880-13850902 ATGAAGAAAGAGAATCAGAAAGG - Intronic
1093658030 12:21720185-21720207 GTGAGCAAACTGATTCAGCAAGG - Intronic
1093710480 12:22323862-22323884 GGGAAGAAAGAGCATCAGGAAGG + Intronic
1093791216 12:23252578-23252600 GTGAGGAAACTGAGTCATGAGGG + Intergenic
1093870074 12:24280318-24280340 GTTAAGAAACACAGTCAGGGAGG + Intergenic
1094073415 12:26445555-26445577 GTGAAGAAATAATTTCAAGAAGG + Intronic
1094528566 12:31250395-31250417 GTCAAGAAACAGTCTCAGAAAGG - Intergenic
1094728615 12:33148541-33148563 ATGAAGAAACAGATAGAGAAAGG + Intergenic
1095174136 12:39071264-39071286 CTGAAAAGACAGATCCAGGATGG - Intergenic
1095537896 12:43273628-43273650 GTGAGGAAAGAGACTCAGAAAGG - Intergenic
1096213355 12:49783881-49783903 GTGAAGAAAATGTTTCAAGAAGG - Intergenic
1098860800 12:75707835-75707857 ATGAAGAACAAGTTTCAGGAAGG - Intergenic
1099821675 12:87719329-87719351 ATGAAGAAACAGACTCAGAAAGG - Intergenic
1100068865 12:90685732-90685754 GTCAGGAAAGAGATTCAGAATGG + Intergenic
1100208716 12:92378996-92379018 ATGAAGAAAAATATTCAGGAAGG + Intergenic
1101109080 12:101468191-101468213 ATGAAGAAACAGGCTCAGGGAGG - Intergenic
1101582736 12:106058101-106058123 GTGAAGAAACAGATTGAAAGAGG - Intergenic
1101720425 12:107345994-107346016 GTGAGGAAGCAGACCCAGGAAGG + Intronic
1101923944 12:108955884-108955906 ATGAGAAAACAGATGCAGGAAGG + Intronic
1102195717 12:111023877-111023899 CTGAAGAAACAGGTTCAGGCAGG + Intergenic
1104685713 12:130782772-130782794 GTGAAAAAAAAGGTTCAAGAAGG - Intergenic
1104793043 12:131495878-131495900 GAGAAGAAATAGACTCAGGAGGG - Intergenic
1105447384 13:20469625-20469647 GAGAATAAACAGATACCGGAAGG - Intronic
1106071412 13:26415572-26415594 GTGAATAAACAAATGCAGCAAGG + Intergenic
1106322803 13:28658396-28658418 GTGAAGAAACCGAGACATGAAGG - Intergenic
1106689233 13:32096030-32096052 GTGAAGAAATAAAGACAGGAAGG - Intronic
1106799025 13:33236950-33236972 GGGAAGAAAGAATTTCAGGAAGG - Intronic
1107404837 13:40102753-40102775 GTGAATAAACAAATTCACTAAGG - Intergenic
1107736549 13:43405141-43405163 CTGAAGAGACAGTTTCAGGCAGG + Intronic
1108025828 13:46176354-46176376 CTGAAAAAACATTTTCAGGATGG + Intronic
1108749233 13:53430350-53430372 ATGAAGATTCAGATTCAGTAGGG + Intergenic
1109313642 13:60724472-60724494 TGGAAGAAACAGCCTCAGGAGGG + Intergenic
1109650507 13:65319013-65319035 TTGTAGAAACAAATACAGGAAGG - Intergenic
1111073131 13:83196345-83196367 GAGATGTAAAAGATTCAGGATGG + Intergenic
1113243110 13:108362028-108362050 GAGAGGAAACAGGTGCAGGATGG + Intergenic
1113363351 13:109652311-109652333 GTGATGAAACAGACTGAGAAGGG - Intergenic
1113723203 13:112577052-112577074 GACAAGACACAGAATCAGGAAGG + Intronic
1113757730 13:112825322-112825344 GTGAAGAAACAGAATAGGAAGGG - Intronic
1114303453 14:21399060-21399082 GTGAACAAACAGTTGGAGGATGG + Intronic
1115950775 14:38718861-38718883 GTGAAGAAAGTGCTTCAAGAAGG - Intergenic
1116524675 14:45889909-45889931 GTGAAGACACTGATTCTGAATGG + Intergenic
1116630585 14:47326373-47326395 GTGAAGAATGAGACTCAGAAAGG + Intronic
1117540050 14:56738242-56738264 GTGAATAAACACATTCATGGAGG + Intergenic
1119473602 14:74914069-74914091 ATGGAGAAACAGGCTCAGGAGGG - Intronic
1120486558 14:85121532-85121554 ATGAAGAAACACATTCTAGAGGG - Intergenic
1121442002 14:93955388-93955410 GTGAAGCAACAGACCCAGCAAGG + Intronic
1121505321 14:94472817-94472839 GAGAAGAGAGAGATTCAGGCTGG + Intronic
1121683664 14:95815582-95815604 GTGAGGAAACCGACTCAGGGAGG - Intergenic
1122666006 14:103330148-103330170 GTGAGGAAAGAGACTCAGGAAGG - Intergenic
1122862147 14:104587503-104587525 GTGAAGAGACGGGGTCAGGAGGG + Intronic
1123076772 14:105671398-105671420 GTGAAGAAAGGGATTTGGGAGGG - Intergenic
1124444475 15:29717659-29717681 GTGAGGAAACAGACTCAGATTGG - Intronic
1124883782 15:33665274-33665296 CTAAAGAAACAGATACAGAAAGG - Intronic
1125146426 15:36474213-36474235 GTTAAGAATCAGATAAAGGATGG + Intergenic
1126813007 15:52427433-52427455 GGGAAGAAACACAGTAAGGAGGG + Intronic
1126922022 15:53537540-53537562 ATGAAGAAACAGAGACAGAAAGG - Intronic
1127143910 15:56005604-56005626 GTGAAGAAGCAGCTTAAGGATGG + Intergenic
1127706592 15:61553158-61553180 GAGAAGATACAGATTCAACATGG + Intergenic
1129089363 15:73132349-73132371 GTGAAGAAACAAAAAAAGGATGG - Intronic
1129885838 15:79036420-79036442 GTGGAGAAACAGAGGCGGGAGGG - Intronic
1130557407 15:84932366-84932388 GTGAAGATAAAACTTCAGGAAGG + Intronic
1131337863 15:91567059-91567081 GTGAAAACACAGATTCTGGAAGG + Intergenic
1132153339 15:99477609-99477631 TTGAAGAAACAGGCTCAGGGAGG + Intergenic
1132635275 16:941832-941854 GTGATGTTACAGATTCAGGAAGG + Intronic
1133107364 16:3521127-3521149 GTAAAGAGCCAGTTTCAGGAGGG - Intronic
1133129637 16:3668878-3668900 CTCAGGAAACACATTCAGGATGG + Intronic
1133737083 16:8624062-8624084 CTGAAGAAACAGATGCAGAGAGG + Intronic
1133962133 16:10503687-10503709 TTGAGGAAACTGATTTAGGAAGG - Intergenic
1133985432 16:10664716-10664738 ATTAGGAAACAGATTCAGAAGGG + Intronic
1134288656 16:12884803-12884825 TTGATGAAACAAATTAAGGAAGG - Intergenic
1134572425 16:15302668-15302690 GTGAAGAAACAGGCTCAGAGAGG - Intergenic
1134729957 16:16453373-16453395 GTGAAGAAACAGGCTCAGAGAGG + Intergenic
1134937476 16:18258527-18258549 GTGAAGAAACAGGCTCAGAGAGG - Intergenic
1135840793 16:25874333-25874355 GTGAAGAAACAGGTCCAGAGGGG + Intronic
1135880882 16:26255084-26255106 GTGATGAAATAGCATCAGGAAGG + Intergenic
1136280510 16:29206286-29206308 GTGAAGAAACAGCTGAAGGCTGG + Intergenic
1136318713 16:29468721-29468743 GTGAAGACAAAGAATGAGGAGGG + Intergenic
1136433285 16:30208065-30208087 GTGAAGACAAAGAATGAGGAGGG + Intronic
1136713510 16:32259033-32259055 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1136754401 16:32670398-32670420 ATGAAAAAACAGTTTCAGGAAGG + Intergenic
1136813712 16:33199967-33199989 ATGAAAAAACAGTTTCAGGAAGG - Intronic
1136820188 16:33310047-33310069 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1136826751 16:33366586-33366608 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1136831817 16:33465357-33465379 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1137010436 16:35315447-35315469 GTGAGGAAACAGTCTCAGGGAGG + Intergenic
1137507701 16:49068755-49068777 GAGAAGAAAAAGACTCTGGAGGG - Intergenic
1137543192 16:49378472-49378494 CTTAGGAAAGAGATTCAGGAAGG + Exonic
1137812796 16:51368803-51368825 ATGAAGAAACAGATTCAGAGAGG + Intergenic
1138756340 16:59490654-59490676 CTAAAGACACAGAGTCAGGAAGG + Intergenic
1138767410 16:59620982-59621004 GTGAGAAAAGAGATTCAGAAAGG - Intergenic
1138929010 16:61629585-61629607 GTGAATAAATAGATTCAGAGAGG + Intergenic
1139007137 16:62586667-62586689 GTGAAAAAACAGCTCCAGGCTGG - Intergenic
1139193917 16:64896505-64896527 TTTAAGAAACAGTTTCAGGATGG + Intergenic
1140285082 16:73595418-73595440 GGGAAGATACTGTTTCAGGAAGG - Intergenic
1140565399 16:76035891-76035913 GTCATGAAAAAGATTCATGAAGG - Intergenic
1140567501 16:76061226-76061248 ATGAAGATACAGATACTGGAAGG - Intergenic
1141015800 16:80448215-80448237 GTTAAGAAAAAGATTCAGGCCGG + Intergenic
1141070348 16:80948778-80948800 GTGAAGGAAGAGATTGTGGAAGG + Intergenic
1141670905 16:85491262-85491284 GTGAAGAAACAGATTGATCCTGG - Intergenic
1141916809 16:87103524-87103546 GTGACTACACAGCTTCAGGATGG - Intronic
1202992288 16_KI270728v1_random:22941-22963 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1203056548 16_KI270728v1_random:930729-930751 ATGAAAAAACAGTTTCAGGAAGG + Intergenic
1143208983 17:5169220-5169242 ATGAGGAAATAGATTCAGGGAGG - Intronic
1143252705 17:5534924-5534946 GTTAAGACACAGATTCAGCCGGG + Intronic
1143477004 17:7208531-7208553 GTGAAGACACAGATGCCAGAGGG - Intronic
1143588327 17:7863628-7863650 ATTTAGAAACAGTTTCAGGATGG - Intronic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1144150477 17:12438569-12438591 GCGAAGAAACAGTTTCATGGAGG - Intergenic
1144620653 17:16816385-16816407 GTGAGGAAACAGGTTCAGAGAGG - Intergenic
1144704284 17:17356997-17357019 GGGAAGGAAGAGATTCAGGCTGG - Intergenic
1144833943 17:18147177-18147199 GGGAAGAAACAGGTTCAGAGAGG - Intronic
1144884987 17:18451762-18451784 GTGAGGAAACAGGTTCAGAGAGG + Intergenic
1144966324 17:19078936-19078958 TTGAGGAAACAGACTCAGGGAGG + Intergenic
1144981594 17:19173121-19173143 TTGAGGAAACAGACTCAGGGAGG - Intergenic
1144986630 17:19205118-19205140 TTGAGGAAACAGACTCAGGGAGG + Intergenic
1145147232 17:20492615-20492637 GTGAGGAAACAGGTTCAGAGAGG - Intergenic
1145901096 17:28491009-28491031 GAGAAGAAAGAGATGCAAGAAGG + Intronic
1146937414 17:36820903-36820925 ATGAAGAAACTGGTGCAGGAGGG - Intergenic
1147000306 17:37358046-37358068 AAGTAGAAACAGAATCAGGAAGG + Intronic
1147358041 17:39912749-39912771 ATGAAGAAACAGATTCAAAGAGG - Intronic
1147406339 17:40215082-40215104 ATGAAGAAACAGACACAGCAAGG - Intergenic
1149376089 17:56045642-56045664 ATGAAGAAAGAGATTCAGAGAGG + Intergenic
1149597177 17:57871173-57871195 GTGAAAAAACAGATTGTGGGAGG - Intronic
1151055095 17:71021657-71021679 GAGAACAAAGAGTTTCAGGAAGG - Intergenic
1151115547 17:71730879-71730901 GTAAAGAAACTGAGTCAGAAAGG + Intergenic
1151811635 17:76446625-76446647 GTCATGAGACAGGTTCAGGAAGG - Intronic
1152675376 17:81637411-81637433 GTAGAGAAACAATTTCAGGAAGG + Intronic
1153187493 18:2501419-2501441 ATGAAGAAACAGATTCAGGTAGG - Intergenic
1153273273 18:3344047-3344069 ATGAAGAAACAGATTCAAGAAGG - Intergenic
1154246132 18:12701510-12701532 GTGACGAAACAGATTTATAAAGG - Intronic
1154285722 18:13054605-13054627 ATGAAGAAACAGGTTGAGGGAGG - Intronic
1154982689 18:21516695-21516717 ATGAAGAAACATGTTCAGGTTGG + Exonic
1155130684 18:22931905-22931927 GTGAAAACAAAGATTTAGGAGGG + Intronic
1155530011 18:26757519-26757541 TTGAACAAACAGCTTCAGGGGGG - Intergenic
1156933990 18:42680385-42680407 GTTAGGAAACAGATTCCAGAAGG + Intergenic
1157142874 18:45128511-45128533 GTCAGGAAACAGATACTGGAGGG - Intergenic
1157147254 18:45176473-45176495 GTGAAGAAAAAAATTCAGTCTGG - Intergenic
1157197069 18:45628147-45628169 GTTAAGAAATAGTTTCAGGCTGG + Intronic
1157272199 18:46284430-46284452 ATGAAGAAACTGATTCAGAGAGG - Intergenic
1157771908 18:50356397-50356419 GTGAAGAAAGAGAAACATGAGGG - Intergenic
1159257513 18:65966293-65966315 GTGAAGAAAGTGTTTCAAGAAGG - Intergenic
1159478744 18:68959861-68959883 CTGAAGAGAGAGACTCAGGATGG - Intronic
1160348309 18:78152893-78152915 GAGTAGAAACATCTTCAGGAGGG - Intergenic
1160557693 18:79736593-79736615 GTGAAGAATGAGATGCAGGTAGG - Intronic
1160578912 18:79872741-79872763 GTGAGGAAACAGGCTCAGAATGG - Intronic
1160610665 18:80082527-80082549 GAGAACAAACAGATTTAGAAAGG - Intronic
1162034972 19:7933760-7933782 CTCAAGAAACGGACTCAGGAGGG + Intronic
1163657953 19:18558641-18558663 TTGAAAAAACTGATTCAGAAGGG + Intronic
1163911412 19:20197622-20197644 GTGAAGAAAGAGTTGCAGGATGG - Exonic
1163912233 19:20206520-20206542 TTGAAGAAGTAGAATCAGGAAGG + Intergenic
1164868205 19:31622632-31622654 GTGAAGAAATAGATTTACAAAGG - Intergenic
1164918321 19:32069889-32069911 GTGGAGAAAAAGATTGGGGAGGG - Intergenic
1165932046 19:39365644-39365666 GTGAGAAAACAGATTTGGGAAGG - Intronic
1167116323 19:47491234-47491256 GTGAGGAAACAGATCCAGAGAGG + Intronic
1167308685 19:48723608-48723630 ATGAGGAAACAGAATCAGGTAGG - Intronic
1168292643 19:55364053-55364075 ATGGAGAAACAGGTTCAGTAAGG - Intergenic
1168725545 19:58579707-58579729 GTGTAGAATCAGCTTCATGAAGG - Intergenic
925072851 2:984635-984657 GTGAAGGAGCAATTTCAGGACGG - Intronic
925860872 2:8173800-8173822 GTAAAGACACAGAACCAGGAGGG + Intergenic
926529454 2:14024914-14024936 GTGAGGAAACAGATTCCAAAAGG - Intergenic
928435396 2:31251532-31251554 ATGAAGCAACTGAGTCAGGAGGG + Intronic
928966662 2:36982722-36982744 GTGAAGAAAAAAATACAGCAGGG - Intronic
929848657 2:45559775-45559797 ATGAAGAAAAAGTTTCAGGCCGG + Intronic
930974111 2:57433559-57433581 GTGAAGAAACCTTTTCAGAAGGG + Intergenic
931173227 2:59827110-59827132 ATGAGGAAACAGGTTCAGAAAGG + Intergenic
932626050 2:73296652-73296674 ATGAGGAAACAGATTCAAAAAGG + Intergenic
933824903 2:86150463-86150485 GGGAAGAAATAGTTTCAAGAAGG + Intronic
934492365 2:94770267-94770289 ATGTAGAAGCAGATTCAGAAGGG - Intergenic
935643634 2:105314110-105314132 GTGAAGACACAGAAAGAGGAAGG + Intronic
935734781 2:106097801-106097823 AGGAACACACAGATTCAGGATGG + Intronic
936114440 2:109690817-109690839 GGGAAAAAACAAAGTCAGGAAGG - Intergenic
936824719 2:116567665-116567687 GTGAAGAAACAGCCACAGAATGG - Intergenic
937138359 2:119575357-119575379 GTGAGGAAGGAGATTCAGGAGGG - Intronic
937637055 2:124167936-124167958 GAGAAGAAAGAGAGCCAGGAAGG + Intronic
938645623 2:133327220-133327242 GTTAAGCAACAAATTCAGGCAGG - Intronic
939396889 2:141642268-141642290 ATGAGGAAACAGATTCAGAGAGG - Intronic
939445349 2:142303135-142303157 CAGAAGAAAGAAATTCAGGAGGG - Intergenic
939459159 2:142476769-142476791 ATGAAGAAGCAGATTTAGGCTGG - Intergenic
940492401 2:154380529-154380551 ATGAAGAAAAAAATTCTGGAAGG - Intronic
940853239 2:158707784-158707806 TAGAAGTCACAGATTCAGGATGG - Intergenic
940858932 2:158752341-158752363 GTGAAGAAAGACTTTCTGGAGGG - Intergenic
941298729 2:163774059-163774081 GTGAAGAGAAAGACCCAGGAAGG - Intergenic
941530845 2:166668889-166668911 ATGAGGAAACAGGTTCAGAAAGG + Intergenic
941547849 2:166876326-166876348 GTAATAAAACAGACTCAGGAAGG + Intergenic
941691801 2:168507843-168507865 GAGAAGAAAGAGAATGAGGAAGG - Intronic
941803082 2:169682844-169682866 TTAAGGAAACAGATTCAGAAGGG - Intronic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
945464473 2:210151645-210151667 AAGAAGAAACAGACTCAGCATGG - Intronic
945688089 2:212997282-212997304 GCAAGGAAACAGATTCAGGTTGG - Intergenic
945906493 2:215599625-215599647 GTGAAGAAACAGGTTCAGTGGGG - Intergenic
946978396 2:225178439-225178461 GTGAAGAAACGGAATGAGAAGGG - Intergenic
947760414 2:232599956-232599978 GTGAAGAAGCAGAGCCCGGAAGG + Intergenic
948027686 2:234790994-234791016 ATGAAGAAAAAGATTCTGCAAGG - Intergenic
948259805 2:236595233-236595255 GAGAAAAAACAGATGCAGCACGG + Intergenic
948496292 2:238352004-238352026 GGGAAGAAACAAAGGCAGGAGGG + Intronic
1169165717 20:3421879-3421901 GGGAGGAAAAAGGTTCAGGAAGG - Intergenic
1169316734 20:4597990-4598012 GAAAAGAAATAGAATCAGGATGG - Intergenic
1169773841 20:9230444-9230466 GTTAAGAAAAAGTTTTAGGAGGG + Intronic
1170276294 20:14594180-14594202 GTGAAGAACCAGGTTGAAGAGGG - Intronic
1170771529 20:19337009-19337031 ATGAAGAAACAGACTCAGAGAGG - Intronic
1170852989 20:20020893-20020915 TTGAAGATGCAGATGCAGGAGGG + Intronic
1172009207 20:31836664-31836686 GTGAAAAAACAGGTTCAGAGAGG + Intergenic
1172359015 20:34299370-34299392 GTAAAGAAAGGGTTTCAGGAAGG - Intronic
1173099747 20:40074720-40074742 GAGATAAAACAGATTAAGGAGGG - Intergenic
1173254318 20:41383167-41383189 GTGAAGAAACCGTATCAGGGTGG - Intergenic
1173373097 20:42457807-42457829 GTAAAGAAACAATTACAGGAAGG - Intronic
1173894498 20:46540477-46540499 GAGAAGAAACAGATTCAGAGAGG - Intergenic
1174459968 20:50675618-50675640 TTGAGGAAACAGGTTCAGGCAGG + Intronic
1174466371 20:50720742-50720764 ATGAAGAAACTGAGTCAGGAAGG + Intergenic
1174984925 20:55440372-55440394 GTGAAGAAAGCGTTTCAGGAAGG + Intergenic
1175212084 20:57366010-57366032 GTGCTGAAACATTTTCAGGAAGG + Intronic
1175231154 20:57474184-57474206 GTGAGGAAACAGACTCAGAGAGG + Intergenic
1176041513 20:63068407-63068429 GTGAATAAACAGACACAGGTGGG - Intergenic
1176845966 21:13876817-13876839 ATGTAGAAGCAGATTCAGAAGGG - Intergenic
1177741306 21:25156859-25156881 GAGAAGAAACATATTCAGAAGGG + Intergenic
1178232259 21:30799652-30799674 TTGCAGAGACAGATTCAAGAAGG + Intergenic
1178928981 21:36800556-36800578 GTGAGGAAACAGAGGCAGGAAGG + Intronic
1179171282 21:38974885-38974907 GTAAAGAACCAGATTCCAGAGGG + Intergenic
1179292422 21:40030370-40030392 GTGGAGAAGCAAATCCAGGAAGG + Intronic
1179538706 21:42069584-42069606 GTGAGAAAACAGGTTCAGAAAGG - Intronic
1179541016 21:42083326-42083348 GAGAAGAAGAAGCTTCAGGAAGG - Intronic
1181783701 22:25210469-25210491 ATGAAGAAACAGGCTCAGGGAGG + Intergenic
1181982734 22:26777348-26777370 CTGAAGAAACAGAGTCAGAGAGG - Intergenic
1182078496 22:27511733-27511755 ATGGAGAAACAGGTTCAGGGAGG - Intergenic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1184064602 22:42110518-42110540 TTGAAGAAACAGAGTCAGGAAGG - Intergenic
1184101962 22:42345441-42345463 GAGAAGAAACAGGTTCAGACTGG + Intergenic
1185030593 22:48440985-48441007 GTGAGGAGACAGCTGCAGGATGG - Intergenic
949535595 3:4993770-4993792 ATAAGGAAACAGATTCAGGAAGG - Intergenic
950215862 3:11158391-11158413 GAGAAGAAACAGGTTCAGAGGGG + Intronic
951252039 3:20405082-20405104 GTGAATAAACAGATATAGAATGG - Intergenic
951796544 3:26545086-26545108 GTGAAGAAAAAGATCCTGGTTGG + Intergenic
952531038 3:34262281-34262303 GAGAGGAAACAGACTCAAGAAGG - Intergenic
952977461 3:38708354-38708376 GTCAAGAAACAGATTACAGAGGG - Intronic
953174262 3:40535219-40535241 GTGAAGAATCAGATACGGCAAGG - Exonic
953470905 3:43165196-43165218 ATGAAGAAACAGATTTATGAAGG - Intergenic
954752474 3:52821435-52821457 GTGTAGAAACAGCAGCAGGAAGG + Intronic
954987564 3:54809263-54809285 GAGAAGAAAGAGATAAAGGAAGG - Intronic
955205526 3:56892478-56892500 GTGAATAAACATATAAAGGAGGG - Intronic
955614022 3:60786508-60786530 ATGAAGTAACAGACTCAGGTAGG - Intronic
955629526 3:60957639-60957661 GTGAAGAAATTGACACAGGAGGG - Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
955987249 3:64586878-64586900 TTGAAGGAAAAGTTTCAGGAAGG - Intronic
956647436 3:71470230-71470252 ATGAAGAAACAGGCTCAGGAAGG - Intronic
956666572 3:71647855-71647877 GTGGAAAAATATATTCAGGATGG + Intergenic
957341047 3:78897135-78897157 GTGAAGGTACAGAATAAGGAGGG - Intronic
957414803 3:79887708-79887730 GAGAACAAACAGATGTAGGAAGG - Intergenic
957538325 3:81534609-81534631 GAGAAGAAACAGAAAAAGGAAGG + Intronic
957866490 3:86031086-86031108 ATGAATAAACAGACTTAGGAAGG + Intronic
958880831 3:99667052-99667074 ATGAAGAAACAGATTCAGGAAGG + Intronic
959794528 3:110408913-110408935 ATGAATAAACAAATTCAGCAAGG - Intergenic
959861303 3:111218159-111218181 GTGAGGAAACAGATTCAGAGAGG + Intronic
960375007 3:116890076-116890098 GTGCAGAAACGGATCCAGGAAGG - Intronic
960430934 3:117567832-117567854 GTGAAGCAAGATATTCAGCATGG - Intergenic
960660143 3:120049079-120049101 GTGAAGAGACAGATTCATTTTGG - Intronic
960818719 3:121703470-121703492 GAGAAGAAAAAGAGTTAGGAAGG + Intronic
960983489 3:123254469-123254491 GTGGGGAAACAGAGACAGGAAGG - Intronic
961409483 3:126708260-126708282 GTGAGGAAACAGGTTCAGTGAGG + Intronic
961410259 3:126715289-126715311 ATGAAGAAACTGAGTCAGGGAGG - Intronic
961687740 3:128646359-128646381 GTGAAGAAACAGTTTTAGGCTGG - Intronic
962057515 3:131887523-131887545 GTGAAAAAACAAATGTAGGAGGG + Intronic
964010741 3:151888329-151888351 GTGAAGATACAGCTTCAGTTTGG + Intergenic
964211201 3:154230156-154230178 GTAAGGAAACAAATACAGGAAGG - Intronic
964450548 3:156808625-156808647 ATGAAGAAACAAATTCAGACAGG - Intergenic
964592366 3:158378893-158378915 GTGAATAAACAGATTTTGGAGGG - Intronic
964837341 3:160954111-160954133 ATGAAGAAACAGACTCAGAGAGG - Intronic
965815238 3:172629379-172629401 GCGAAGAAACACACTCAGGAAGG + Intergenic
965873445 3:173287846-173287868 GTTAAAAAACAAATTGAGGAGGG - Intergenic
966138667 3:176730174-176730196 ATGAGGAAATAGGTTCAGGAAGG + Intergenic
966200182 3:177353880-177353902 GTGAAGAAAGTGTTTCCGGAAGG + Intergenic
966378054 3:179317188-179317210 ATGAAGAAACAGATTTAGGCTGG - Intergenic
966706002 3:182914651-182914673 TTCAAGAAACAGATTTAGGAGGG - Intronic
966779235 3:183569415-183569437 GTGCAGAAACAAACACAGGAGGG + Intergenic
967554895 3:190845437-190845459 GTGTGGAAACAAATTCAGAAAGG + Intergenic
967730307 3:192900985-192901007 TTGAAGAAACTGATGAAGGATGG + Intronic
969030301 4:4206748-4206770 GTGGGAAAACAGATTCAGCAAGG - Intronic
969380081 4:6789639-6789661 TTGCATAAACAGATTCATGATGG + Intronic
969533185 4:7740686-7740708 GTGAAGAAGCAAAGTCAGGGAGG - Exonic
969552172 4:7877548-7877570 GTGAGGAAACAGACACAGAAAGG + Intronic
970138730 4:12956447-12956469 ATGAAGAAACAGGCTCAGCAAGG - Intergenic
970158408 4:13164716-13164738 GTGAGAAAACAGACTCAGGGAGG - Intergenic
970265599 4:14280686-14280708 GTGAAGAAAATATTTCAGGAAGG + Intergenic
970672760 4:18415320-18415342 ATGAGGAAACAGATTCAGTGAGG - Intergenic
971073308 4:23119757-23119779 GTGAGGAAACAGACTCAGAGGGG + Intergenic
971735660 4:30447116-30447138 GTGAAGAAGCATACACAGGAGGG + Intergenic
971761883 4:30776607-30776629 CTGAAGAAACGGTCTCAGGAAGG - Intronic
972623136 4:40768640-40768662 GTGAAGAAAAAGATACATGTTGG - Intronic
972681475 4:41310726-41310748 GTAAAGAAACTGAATCATGAGGG - Intergenic
973547651 4:51997944-51997966 GAGAAGAAACAAGTTTAGGATGG + Intronic
974047034 4:56907326-56907348 GAGAAGAAAACGTTTCAGGAAGG - Intergenic
974759938 4:66261949-66261971 GCCAAAACACAGATTCAGGAAGG - Intergenic
974797206 4:66767571-66767593 GTGAAGACATAAATTTAGGAGGG + Intergenic
975611049 4:76203707-76203729 ATGAAGGAACAGATGCAGGCTGG + Intronic
975770791 4:77720325-77720347 CTGAAGAAGCAGCTTAAGGATGG + Exonic
977016427 4:91697752-91697774 GTCAAGGAAGAGATTCTGGAAGG - Intergenic
978067036 4:104417708-104417730 ATGAAGAAACAGATTCAAAGAGG + Intergenic
978093186 4:104742838-104742860 GGGCAGAAACAGGATCAGGAAGG - Intergenic
978160657 4:105543686-105543708 GTGAAGAAACTGAGTCAGGGAGG + Intergenic
979577427 4:122310708-122310730 GAGAAGCAGCAGATGCAGGAAGG - Intronic
980204264 4:129697556-129697578 AGGAAGAAAAAGATTCAGGAAGG - Intergenic
980706231 4:136499342-136499364 CTGAAGTAAGAGATTCAAGAAGG - Intergenic
981073075 4:140565588-140565610 GTGAAGCCACAGAGACAGGAGGG - Intronic
981399316 4:144294581-144294603 CTGAAGAAACAGATTTAGACAGG + Intergenic
981688905 4:147484318-147484340 ATGAAGCAATAGACTCAGGAGGG - Intronic
982079731 4:151777687-151777709 ATGAAGAAAGAGATACAGGGAGG - Intergenic
983076948 4:163337904-163337926 GGGCAGAAACAGTTTCAGGTGGG - Intronic
983621510 4:169766158-169766180 CAGAAGAAACAGATTTGGGAAGG + Intergenic
984004060 4:174287100-174287122 GTGAAGAATCAGCATCAAGAGGG + Intronic
984005387 4:174299879-174299901 ATGAAGAAACAGAATTATGAAGG - Intronic
984580296 4:181502882-181502904 GTGAACAAACAGCCTCAAGAGGG + Intergenic
985040043 4:185880986-185881008 GTGAAGAAAAAGAGAAAGGAAGG + Intronic
985360609 4:189171739-189171761 CTGAAGAAACAGCTCCAGCATGG - Intergenic
985429774 4:189868018-189868040 GAGAAGAAGCAGATGCAGGCAGG - Intergenic
986032423 5:3906599-3906621 ATAAAGAGACAGATTGAGGAGGG + Intergenic
986702684 5:10427025-10427047 GAGAAGAAAAAGATTTGGGAAGG - Intronic
986832657 5:11598124-11598146 ATGAGGAAACAGATTCAGAGAGG + Intronic
987040841 5:14060879-14060901 GGGAAGAGACAGATTCAGAAGGG + Intergenic
987112212 5:14698954-14698976 ATGAAGAAACAGATTTAGGGAGG - Exonic
987448819 5:18055765-18055787 ATGAAGAAATAGTTTCTGGAAGG - Intergenic
987787612 5:22522741-22522763 GAGAAAGAATAGATTCAGGAAGG - Intronic
988376631 5:30443741-30443763 GTGAAGAAACAACTACAGAATGG + Intergenic
988562973 5:32297498-32297520 GTGAAGAAAAGGATTTAGAATGG - Intronic
988919786 5:35929679-35929701 ATGAAGTAAGAGATGCAGGAAGG + Intronic
988968031 5:36439547-36439569 ATGAAGGGACAAATTCAGGAAGG + Intergenic
989203882 5:38792594-38792616 GTGAGGAAAGAGAGTGAGGATGG - Intergenic
990253671 5:53942895-53942917 GTGATGAAAGTGCTTCAGGAAGG + Intronic
990810733 5:59720049-59720071 TGGAAGAAACAGCTTCAGAAGGG - Intronic
992197387 5:74353473-74353495 GTTAAGAAACAGAATAAGGCCGG - Intergenic
992765358 5:79993701-79993723 GTTAAGAAACACATGAAGGATGG - Intronic
993554031 5:89313363-89313385 GTGAGGAAACTGATTCAGAGAGG - Intergenic
993860714 5:93133535-93133557 TTGAAGAACCAGATTTAGGAAGG - Intergenic
994036601 5:95208922-95208944 GAGAAGAAACAGATTAAAGAAGG - Intronic
994330409 5:98498476-98498498 GAGATGAAACATATTGAGGAAGG + Intergenic
994470874 5:100204391-100204413 GAGAAAAAACAGAGCCAGGAGGG + Intergenic
994572579 5:101533189-101533211 TTGAAAAAACTGATTCAGGCTGG + Intergenic
995060270 5:107805901-107805923 GCTAAGTAACAGATCCAGGACGG + Intergenic
995800833 5:115992423-115992445 GGGAAGACTCAGATTCAGGGTGG + Intronic
996207631 5:120761142-120761164 ATGAAGCAATAGATACAGGAGGG - Intergenic
996300745 5:121981301-121981323 GTGAAGAAACTCTTTCAAGAAGG + Intronic
996861665 5:128073966-128073988 AAGAAGAAACAGATGCAGAAAGG + Intergenic
997281209 5:132647277-132647299 ATGAAGAAGCAGATTTTGGATGG - Intergenic
997300219 5:132798208-132798230 GTGCAGAAACAGGTTGAAGAGGG - Intronic
997837383 5:137206568-137206590 GTGAAGAAACAGACACACGGTGG - Intronic
998057589 5:139092094-139092116 GTGAAGAAAAAGGTCAAGGAGGG + Intronic
998767994 5:145509834-145509856 GTGAAAAAACAGATTCTGAGAGG - Intronic
999257012 5:150215349-150215371 GTGAAGCAGCAGATTCAGAGGGG - Intronic
999730445 5:154473345-154473367 ATGGAGAAACAGACTCAGGGAGG - Intergenic
1000040528 5:157481499-157481521 ATGAGGAAACAGACTCAAGAGGG + Intronic
1000146481 5:158458111-158458133 GAGAAGACAAAGATTCAGAAGGG - Intergenic
1000357864 5:160418291-160418313 GTGAAGAAACAGGTTCTGAGAGG + Intronic
1001832970 5:174805080-174805102 GTGAAGACACAGATGCAGGAGGG - Intergenic
1002101741 5:176861321-176861343 GTGAGGAAACAGGTTCAGGATGG + Intronic
1003049614 6:2767307-2767329 GAGAAGAACCAGCATCAGGAAGG + Intronic
1003350058 6:5308242-5308264 GTGAAGTCACAGAAGCAGGAAGG + Intronic
1004027520 6:11833603-11833625 GTGAAGAATCAGAGTGAGGAAGG + Intergenic
1004444124 6:15682165-15682187 TTGAAGAAACAGGCTCAGAATGG - Intergenic
1005368517 6:25105167-25105189 GTGAAGAGACAGAGTAAAGATGG + Intergenic
1005419062 6:25630460-25630482 GTGAAGAAACAGAAAGAGAATGG + Intergenic
1005640457 6:27791567-27791589 GTGAAGAAACAGAAGCCCGAGGG - Intergenic
1005923312 6:30418919-30418941 GACAAGAATCAGATCCAGGAGGG - Intergenic
1006753408 6:36393992-36394014 TTGAAGAAATGAATTCAGGAAGG + Intronic
1007100144 6:39240434-39240456 GTGAGGAAACAGGTTCAGAGGGG + Intergenic
1007110780 6:39312533-39312555 GTGAAGAAACAGGCTCAGAGAGG - Intronic
1007207794 6:40166668-40166690 GTGAGGAAACAGTTTCAGAGAGG - Intergenic
1007270409 6:40631947-40631969 GGGAGGGAGCAGATTCAGGAAGG - Intergenic
1007744745 6:44036648-44036670 ATGAAGAAACAGACTCTAGATGG + Intergenic
1008497631 6:52149255-52149277 GTCAAGAAAGAGTTTGAGGATGG + Intergenic
1008626760 6:53324693-53324715 GAAAAGAAATAGAATCAGGAAGG + Intronic
1008702280 6:54115484-54115506 ATGAAGAAACAAATTACGGAAGG + Intronic
1009450108 6:63790640-63790662 GAGAAAACATAGATTCAGGAAGG + Intronic
1010722550 6:79300274-79300296 GAGAAACAACAGATGCAGGAAGG - Intergenic
1010748245 6:79588527-79588549 GAGAAGCAGCAGATGCAGGAAGG - Intergenic
1011513832 6:88130321-88130343 GTGAAAAAACAGCTTTGGGAGGG + Intergenic
1011882951 6:92053485-92053507 GAGAAGAAAAAGAAGCAGGAGGG + Intergenic
1012646189 6:101684983-101685005 GAGAAGACACAGAAGCAGGAAGG - Intronic
1014780922 6:125563780-125563802 GTTAGGAGACAGATTCATGATGG - Intergenic
1014816974 6:125946671-125946693 GTAAAGAAAGAGTTTCAGGAGGG - Intergenic
1015774375 6:136798780-136798802 ATGAAGAAACAGGTCCAGAAAGG - Intergenic
1015968014 6:138714397-138714419 GTAAGGAAACAGATTCAGAGGGG + Intergenic
1016999752 6:149988555-149988577 GTGAGGAAGAAGAGTCAGGAGGG + Intergenic
1017006864 6:150033719-150033741 GTGAGGAAGAAGAGTCAGGAGGG - Intergenic
1017075681 6:150615632-150615654 GAGAAGAATCAGACTGAGGAGGG + Intronic
1017136227 6:151150005-151150027 ATGATAAAACAGATTCAGAAAGG + Intergenic
1017675533 6:156809986-156810008 CTGAGGAATCAGATTCAGGAGGG + Intronic
1019109564 6:169698995-169699017 GCACAGAAACAAATTCAGGAGGG + Intronic
1021088680 7:16454686-16454708 GTGGAGACCCAGCTTCAGGAGGG - Intergenic
1022525791 7:31036347-31036369 ATGAAGAAACAGGCTCAGAAAGG + Intergenic
1022812258 7:33881380-33881402 GTGTAGCAGCAGATGCAGGAAGG + Intergenic
1023026165 7:36052031-36052053 TTTAAGAAACACATTCAGTAAGG + Intergenic
1023085763 7:36568688-36568710 GTGAAGAAAGAGTTTCTGAAGGG - Intronic
1023132623 7:37017987-37018009 ATGAGGAAACAGGTTCAGGGGGG - Intronic
1023274725 7:38506074-38506096 TTGAAGAAACAAATTCTGTATGG - Intronic
1023519613 7:41037354-41037376 GTGAGGATTCAGATTCAGTAAGG - Intergenic
1023816691 7:43955963-43955985 GTGAGGAAACAGACTCTGGGAGG - Exonic
1024515513 7:50251288-50251310 GTGAAGCAATAGATTCATGAAGG + Intergenic
1025150911 7:56548624-56548646 GGGAAGAAAAAGATTAAGGGAGG + Intergenic
1025737919 7:64169567-64169589 GGGAAGAAAAAGATTAAGGGAGG - Intronic
1025744887 7:64233938-64233960 GAGAAGAAAGAGAGTCAAGAAGG + Intronic
1025766177 7:64453629-64453651 GGGAAGAAAAAGATTAAGGGAGG - Intergenic
1026363011 7:69620012-69620034 TTGAAGAAGTAGATTCATGAAGG - Intronic
1028426652 7:90696906-90696928 GTGAAGAAAGAGTTTCAGGAAGG + Intronic
1029411344 7:100413383-100413405 GTGAAGAAAGAGTTTTAGGTAGG - Intronic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1031337993 7:120561486-120561508 GTGAGGAAACAGATTCAGAAAGG + Intronic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1032469812 7:132170136-132170158 GTGAAGAAACTGAGTCACTAAGG - Intronic
1033897580 7:146093716-146093738 GTGAAGAAACAAAGTGAGAAGGG + Intergenic
1034054167 7:148016978-148017000 TTGAAGAGAAATATTCAGGAAGG + Intronic
1035234748 7:157489037-157489059 GTGAAGACACAGACCCAGGAGGG + Intergenic
1035906662 8:3518238-3518260 TTGAAGAAACATATTTATGAAGG - Intronic
1036828140 8:11995611-11995633 ATGAGGAAACAGATTTAGAACGG - Intronic
1037047837 8:14331654-14331676 GTGATAAATCATATTCAGGATGG - Intronic
1037921465 8:22809244-22809266 ACGAGGAAACAGATTCAGGGAGG + Intronic
1038272809 8:26089675-26089697 CTGAAGACGTAGATTCAGGAAGG - Intergenic
1038290415 8:26244273-26244295 GTGAGGAAACAGACTCAGAAAGG - Intergenic
1038777121 8:30541207-30541229 ATGAGGAAACAGATGCAGAAAGG - Intronic
1039697035 8:39923963-39923985 GTAAAAAAACAGAATTAGGAAGG - Intronic
1039727410 8:40233751-40233773 GTGAAGACACAGAGACAGAATGG + Intergenic
1039894711 8:41708601-41708623 ATGAATAAACAGAGTCAGAAAGG - Intronic
1040356785 8:46626085-46626107 GTGAAGAAACAGAATCTGAGGGG - Intergenic
1040564272 8:48552128-48552150 GGGAAGAAACTGATTCATGCAGG - Intergenic
1040982226 8:53255585-53255607 GAGAAGAAAGAATTTCAGGATGG + Intergenic
1041356744 8:57008484-57008506 TTGAAGAAACAGCTTCAAAATGG - Intergenic
1042187617 8:66152633-66152655 CTGTAGAAAGAGACTCAGGAGGG - Intronic
1043575870 8:81655585-81655607 GAGAAGAAAGAGACTAAGGAAGG + Intergenic
1044584577 8:93857582-93857604 ATGAGGAAACAGCTTCAAGAAGG - Intergenic
1044911917 8:97068786-97068808 ATGAAGAAACAGACTCATAAGGG + Intronic
1046136542 8:110034573-110034595 ATGAAGACACATTTTCAGGAGGG + Intergenic
1047274472 8:123395539-123395561 ATGAAGAAACGGATTCAAAAAGG - Intronic
1047701360 8:127452502-127452524 AGGAAGAAACAGATCCAGAAAGG - Intergenic
1047720944 8:127638511-127638533 GTCAAGATCCAGATGCAGGATGG - Intergenic
1048573437 8:135672999-135673021 CTGGAGAATCAGATTCAGGGCGG - Intergenic
1048675833 8:136778799-136778821 GTGAGGAAACAGGATCTGGATGG + Intergenic
1048947842 8:139466749-139466771 GTGAAAGAATAGAGTCAGGATGG - Intergenic
1049159217 8:141086615-141086637 GTGATCAATCATATTCAGGAAGG - Intergenic
1049483890 8:142841350-142841372 GTGCAGAAACGCACTCAGGATGG - Intronic
1050515903 9:6444524-6444546 TTTAAGAAACAGATTCCTGAGGG + Intronic
1050710899 9:8462040-8462062 ATGAAGAGACAGATTCTGCATGG - Intronic
1051008109 9:12374106-12374128 GTGCAGAAACAGCTGCAGGCAGG + Intergenic
1051477332 9:17522448-17522470 GTGAAGAATCAAGGTCAGGATGG - Intergenic
1052519773 9:29531586-29531608 GTGAAGAAACAAATTTGGGAAGG - Intergenic
1054858847 9:69929302-69929324 TTGAAGAAATAGAGTCAGGAAGG - Intergenic
1055700038 9:78934130-78934152 GAGAAGAAAAAGTCTCAGGAAGG + Intergenic
1056618587 9:88190948-88190970 GTGAAGAAACGCTTTGAGGATGG - Intergenic
1056980791 9:91309394-91309416 GTGAAGAAAATGTTTCAAGAAGG - Intronic
1057581358 9:96290278-96290300 GTGAAGAATAAGCTTCTGGAAGG + Intronic
1058105301 9:100963720-100963742 GTGAAGAAACAGGTTCACATGGG - Intergenic
1058432829 9:104933991-104934013 GAGAGGAATCAGTTTCAGGAAGG - Intergenic
1058568008 9:106307715-106307737 TTTCTGAAACAGATTCAGGAAGG - Intergenic
1058581821 9:106466910-106466932 ATGAAGAAACAGATTAAGTAAGG + Intergenic
1058635444 9:107033867-107033889 ATGAAGAAACAGACTAAGGAAGG - Intergenic
1059691074 9:116686940-116686962 ATGGAAAAACAGATTCAGTAAGG + Intronic
1059757785 9:117309999-117310021 ATGAAGAAACAGGCTCAGAAAGG - Intronic
1060575150 9:124685111-124685133 ATGAAGAAACAGATTTAGAAGGG - Intronic
1060835245 9:126750938-126750960 GTGAACAACCAAATTGAGGAAGG + Intergenic
1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG + Intronic
1061490702 9:130942368-130942390 ATGAGGAAACTGATTCAGAAAGG + Intergenic
1062606522 9:137351066-137351088 GTGGAGAAGCAGATTCTGGGCGG - Exonic
1185861360 X:3582524-3582546 GGGAAGAAACAGATTAACAAGGG - Intergenic
1185951620 X:4441604-4441626 GTGAACGATCAAATTCAGGAGGG - Intergenic
1186986842 X:15026242-15026264 CTGAAGAGACATTTTCAGGAGGG + Intergenic
1187122782 X:16425353-16425375 GTAAGGAAGCAGATTCAGAAAGG - Intergenic
1188618188 X:32185347-32185369 GTGAAGAAACAGATTCAGGAAGG - Intronic
1189273593 X:39768949-39768971 CTGACCAAGCAGATTCAGGAGGG + Intergenic
1189384166 X:40523702-40523724 GTGAAGACAAAGGTTAAGGAAGG - Intergenic
1190092707 X:47453448-47453470 CAGAATAAACAGATTCAGGGAGG + Intronic
1190262430 X:48805793-48805815 GCGATGACACAGATTCAGAAAGG - Intronic
1191887728 X:65906213-65906235 ATGAAGAAAGAAATACAGGAGGG + Intergenic
1192139396 X:68634666-68634688 AAGATGAAACAGATTCATGAAGG + Intergenic
1192681850 X:73260955-73260977 CTGAAGAAGTAGAATCAGGAAGG - Intergenic
1193731804 X:85110955-85110977 GTAAAGAAACAGATTGAGAGAGG + Intergenic
1193864558 X:86715175-86715197 TTGAGGAAACATGTTCAGGAGGG - Intronic
1195430158 X:104780122-104780144 GCCAAGAAACAAATTCAGGTAGG + Intronic
1196991563 X:121334947-121334969 ATGAAAAAGCAGATTCAGGCCGG + Intergenic
1197188076 X:123610545-123610567 GTGAAGAAACAGACTCTGAGAGG - Intronic
1197705134 X:129629501-129629523 ATGAAGAAACAGATGCAGAGAGG + Intergenic
1197731207 X:129811616-129811638 TTGAAGAAACACATGCAGCATGG + Intronic
1198056302 X:132998915-132998937 GTGAAGAAACAGGCCCAGAAAGG + Intergenic
1198122290 X:133606148-133606170 GTGAAGAAGCCGACCCAGGATGG + Intronic
1198432303 X:136579567-136579589 GTGAAGAAACACATTTGGCAGGG - Intergenic
1200266565 X:154649319-154649341 CTGGAGACACAGCTTCAGGAAGG + Intergenic
1200343944 X:155429363-155429385 ATGAGGAAACAGAATCAGGTGGG - Intergenic
1200375863 X:155779431-155779453 GAGAATAAATAGGTTCAGGAAGG - Exonic
1200627514 Y:5537799-5537821 GAGAAGCAACACATTCAGGGAGG - Intronic
1202129802 Y:21599286-21599308 GTGAAGATACAGATTGGTGAAGG - Intergenic
1202342344 Y:23882949-23882971 TTGAAAAAGCAGATTCAAGAAGG + Intergenic
1202528425 Y:25787136-25787158 TTGAAAAAGCAGATTCAAGAAGG - Intergenic