ID: 1188637422

View in Genome Browser
Species Human (GRCh38)
Location X:32451736-32451758
Sequence CACAGGTAGAAGTCTGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 193}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188637422 Original CRISPR CACAGGTAGAAGTCTGGACA AGG Intronic
900261248 1:1730924-1730946 CACAGGTAGGAGGCTGGGCACGG + Intronic
900521274 1:3106547-3106569 CACAGGGCAAAGGCTGGACAAGG + Intronic
902271830 1:15310318-15310340 CAGAGGTAGAAGCCTGGAGTGGG - Intronic
902710214 1:18234185-18234207 TACAGATATAAGTCTGGAAAAGG + Intronic
905370578 1:37480607-37480629 CTGAGGCAGAAGACTGGACAAGG - Intronic
905578584 1:39065855-39065877 CAGAGTAAGAAGTCTGGACCAGG + Intergenic
905624880 1:39482821-39482843 CACAGATTTAAGGCTGGACATGG + Intronic
908264061 1:62361264-62361286 CTCAGGAAGCAGTCTGGAGAGGG + Intergenic
910858066 1:91716140-91716162 GACAGGAAGAGGTCTGTACAGGG + Intronic
914222938 1:145696567-145696589 CACAGGGAGAAGACAGGAGAGGG + Intronic
915121927 1:153634583-153634605 CAGAAGTGGAAGTCTTGACAGGG + Intronic
915577910 1:156793145-156793167 CACAGGCAGAAGTATGCAAAGGG - Intronic
916714265 1:167435953-167435975 CACAGGGATCAGCCTGGACAGGG + Intronic
916863333 1:168830385-168830407 CACAGGTAGCAGTGTGGGAAGGG + Intergenic
918099844 1:181363912-181363934 CAGAGTTAGAAGTCTGAACTTGG + Intergenic
920183819 1:204148434-204148456 CAGTGGCAGAAGTCAGGACAGGG + Intronic
920745518 1:208624377-208624399 CACATGCTGAAGTCTGGACTTGG + Intergenic
922706336 1:227792713-227792735 CACAGGGAGGAGATTGGACACGG - Intergenic
923571720 1:235121533-235121555 CACAGCTAGTTGACTGGACATGG - Intronic
923950801 1:238951077-238951099 CAGAGGTAGAAGACTGCAAAAGG + Intergenic
1066460930 10:35611610-35611632 CACGGATTGAAGTCTGGAAAAGG - Intergenic
1072309842 10:94144279-94144301 CACTGGTATAAGTCAGTACACGG - Intronic
1074353928 10:112764872-112764894 CACAGGTATATGTATGTACAAGG - Intronic
1076146912 10:128129662-128129684 GCCAGGAAGAAGTCTGGGCACGG - Intergenic
1077218600 11:1405391-1405413 CACAGGGGGAAGGCTGGGCAAGG - Intronic
1078860052 11:15238773-15238795 CACAGGGAGGAAGCTGGACAAGG - Intronic
1083482860 11:62960897-62960919 CACTGGTACAATTCTGGAAAGGG - Intronic
1083771449 11:64869925-64869947 CACAGGTGGGAGTGTGGGCAGGG + Intronic
1088497357 11:110444251-110444273 CATAGGCAGAAGTCTGAACTTGG - Intronic
1089576765 11:119450057-119450079 CTCATGAAGCAGTCTGGACATGG + Intergenic
1089874023 11:121702812-121702834 GATAGGGAGAAGGCTGGACATGG + Intergenic
1090067018 11:123511674-123511696 CAGAGATGGAAGACTGGACAAGG + Intergenic
1090572546 11:128063382-128063404 CACAGGTAGAATTGTGGAAGAGG - Intergenic
1090622115 11:128569413-128569435 CACGGGTTGAGCTCTGGACAGGG + Intronic
1091632322 12:2171330-2171352 CACAGATAGGAGGCTGGAGAAGG + Intronic
1092092566 12:5814868-5814890 CACAGCTAGAACTTTGGAAATGG - Intronic
1095039277 12:37423689-37423711 CACCGGTAGAAGTCGGCTCAAGG - Intergenic
1095595633 12:43954678-43954700 CTCTGGTAGAATTCTGGACCTGG - Intronic
1095945662 12:47751898-47751920 AGCAGGTAGAAGCCTGGGCAGGG - Exonic
1097708947 12:62897565-62897587 CAGAGGCTGAAGTGTGGACAAGG - Intronic
1102552215 12:113699771-113699793 CACAGGCAGAAGCCTGCAAATGG + Intergenic
1104372561 12:128236837-128236859 CACAGGTAGAGGGCTGGATTTGG + Intergenic
1104462973 12:128970147-128970169 CACTGGTAGAAGCCGGGCCAGGG + Intronic
1104842414 12:131831427-131831449 CACCGGCAGAAGCCAGGACATGG - Intronic
1105006510 12:132724460-132724482 CACATGCAGAAGACTGGAAAAGG - Intergenic
1106500076 13:30319754-30319776 CACAGGCATAAATCTTGACATGG + Intergenic
1108071181 13:46630001-46630023 CTCAGGGAGAATTCTGGGCAAGG + Intronic
1108368976 13:49748036-49748058 CAAAGGAAGAATTTTGGACAAGG + Intronic
1110827722 13:79992027-79992049 CACAGGTAGAAGATAGGTCATGG - Intergenic
1110833386 13:80057138-80057160 CTCATGTAGAAGTCTGGAGATGG + Intergenic
1111670133 13:91320005-91320027 CACAGGTGCAACTCTGGCCAAGG + Intergenic
1111904360 13:94238239-94238261 CACAAGTAGAAATCTGGATTGGG + Intronic
1114513423 14:23281057-23281079 CACAGATAGAAGGCTGGGCCCGG - Intronic
1116064690 14:39968336-39968358 CACAGGTAGACCTCAGGAAAGGG - Intergenic
1117481727 14:56152345-56152367 CACATGAAGGATTCTGGACAGGG + Intronic
1122429513 14:101631043-101631065 CACAGGGGGAAGTATGGAAACGG + Intergenic
1122921164 14:104880847-104880869 CACAGGTAGATGTGTGTACAGGG - Intronic
1124452461 15:29808306-29808328 CACTGTTAGAAGTTGGGACAGGG + Intronic
1125271841 15:37947759-37947781 CAGAGGGAAAAGTCTAGACAAGG + Intronic
1127581707 15:60344745-60344767 CACAGGGAGAGGACTGGAGACGG + Intergenic
1127674851 15:61229035-61229057 CAGAGGTAGGAGGCTGGAGAGGG - Intronic
1128502104 15:68233804-68233826 CACAGTGAGAAGGCTGCACAAGG + Intronic
1131414339 15:92240036-92240058 CACAGGTAGAAGAATGGAACTGG + Intergenic
1139467630 16:67162626-67162648 CACAGGATGAAACCTGGACATGG - Intronic
1140351864 16:74270181-74270203 CACCAGTAGAAATCTGGCCAAGG + Intergenic
1141051784 16:80772246-80772268 TTCAGGTAGAAGGCTGGACATGG + Intronic
1141409941 16:83826250-83826272 CACAGATGGAAGTCTGGGCGCGG - Intergenic
1141821972 16:86452719-86452741 CACAGGGAGAAGTTTAGGCATGG - Intergenic
1142150785 16:88511746-88511768 CACAGGTCGAATGCTGCACAAGG + Intronic
1143164443 17:4890946-4890968 CACAGGTAGAAGAGAGAACAAGG + Exonic
1144251253 17:13418868-13418890 CAGAGGTAGAGGGCTGGGCATGG - Intergenic
1144525619 17:15987248-15987270 ACCAGGTAGAAGTCTAGAGATGG - Exonic
1144755361 17:17677131-17677153 CACAGGTAGAAGGGTGAGCAGGG - Intergenic
1145235936 17:21208471-21208493 GAAAGGCAGAAGTCTGGACGCGG + Intronic
1145943651 17:28757865-28757887 AACAGGTAGAGGTCTGGATTAGG + Exonic
1146793342 17:35765137-35765159 CAGAGGTAAAAGTGTGGGCAGGG + Intronic
1146804899 17:35857259-35857281 AACAGGTATAAATCAGGACATGG + Intronic
1147232979 17:39032611-39032633 CACAAGTAAAAGACTGGAGAAGG - Intergenic
1148565900 17:48632823-48632845 CACAGGCACAAGCCTGGGCAGGG + Intronic
1148788717 17:50161068-50161090 CACAGCTGGATCTCTGGACACGG - Intergenic
1149531279 17:57397296-57397318 TACAGTGAGAAGGCTGGACAAGG - Intronic
1152307342 17:79529025-79529047 CTCAGGTAGAGGTGGGGACATGG + Intergenic
1154092435 18:11378263-11378285 CTCAGGCAGCATTCTGGACACGG - Intergenic
1155090541 18:22504892-22504914 CAGAGGTGGAAGCCTGGAGAAGG + Intergenic
1155219292 18:23669881-23669903 AACAGCTAGATGTCTGGCCAGGG - Intergenic
1155332420 18:24731677-24731699 TACAGATAGAAGTCTGCCCAAGG + Intergenic
1157782012 18:50447826-50447848 CCTATGTAGAAGTTTGGACATGG - Intergenic
1158488780 18:57891542-57891564 CCCAGGAAGAAGTCAGGTCAAGG + Intergenic
1158537101 18:58318109-58318131 CACAGGTATGAGTGTGGAGAGGG + Intronic
1158651191 18:59287782-59287804 CAAACGTAAAAGTCTGGAAATGG + Intronic
1159848964 18:73503104-73503126 CACACGTAGAACTGGGGACAAGG + Intergenic
1160039246 18:75330921-75330943 CACAGGGAGACGCCTGGAGATGG - Intergenic
1161768081 19:6217649-6217671 CACAGGGAGAGTTCTGGCCATGG + Intronic
1163659674 19:18569141-18569163 GATAGGTAGAAGTCTTGAGACGG + Exonic
1165407161 19:35637918-35637940 CACAGGAAGTAGCCAGGACACGG - Intergenic
1165596090 19:37012128-37012150 CACCGGTAGAAGTCGGCACAAGG + Intronic
1166170846 19:41026895-41026917 GGCAGGGAGAAATCTGGACAGGG + Intergenic
1166652301 19:44583786-44583808 CAGAGGCAGAAGTGTGGACTGGG - Intergenic
1168561853 19:57390770-57390792 CACAGGTTGGATTTTGGACATGG + Intronic
929438320 2:41946028-41946050 CAAATGCAGAAGTCTGTACAGGG + Intronic
929546846 2:42861515-42861537 CAAGGGTAGGAGGCTGGACAGGG - Intergenic
930841235 2:55848192-55848214 CACAGGAAGAAGTATGTCCAAGG + Intergenic
932665921 2:73698869-73698891 CCCAGGCAGAAGCCTGCACAGGG + Intergenic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
936081578 2:109436045-109436067 CACAGGGAGATGGCTGGACCAGG + Intronic
940216208 2:151306312-151306334 AACATGTGGAAGGCTGGACATGG + Intergenic
942773025 2:179545607-179545629 GACAGGTAGTAGTTAGGACAGGG + Intronic
944487417 2:200221538-200221560 CAGACATAGAAGTCTGGGCAAGG - Intergenic
946130270 2:217601223-217601245 CACTGCTAGAAGACTGGATATGG + Intronic
946441066 2:219696464-219696486 CACAGGAAGATGACTGGCCAGGG - Intergenic
946854819 2:223941999-223942021 CCCAGGTAGATGACTGGACCAGG - Intronic
947742503 2:232491043-232491065 CTCAGCCAGAGGTCTGGACAGGG - Intergenic
948649308 2:239430129-239430151 GCCAGGCATAAGTCTGGACAAGG + Intergenic
1168773734 20:432158-432180 CCCAGGTAGAAGTGAGGACCTGG - Intergenic
1169830296 20:9817721-9817743 CACAACTAGTGGTCTGGACAGGG + Intronic
1169887506 20:10416805-10416827 AACAGGCAGCAGTCTGGATATGG - Intronic
1170700414 20:18698630-18698652 CACAGCTGGAGGGCTGGACATGG - Intronic
1171571031 20:26251723-26251745 CACCGGTAGAAGTCGGCTCAAGG - Intergenic
1174101973 20:48134687-48134709 CACACGTAAAAGTCTCTACAAGG + Intergenic
1175467401 20:59198648-59198670 AACAGGGAGGAGTCTGAACAAGG + Intronic
1176070577 20:63224251-63224273 CACAGGGAGGACTCTGGAGAGGG - Intergenic
1177483109 21:21719648-21719670 CACAGCGAGAAGGCAGGACAAGG + Intergenic
1178542227 21:33462999-33463021 ATCAGGTAGAAGGCTGGGCATGG + Intronic
1178570158 21:33728516-33728538 AACAGGAAGAAGGCTGGGCAGGG - Intronic
1180573206 22:16748737-16748759 CACCGGTAGAAGTCGGCTCAAGG - Intergenic
1181761155 22:25059708-25059730 CCCAGGTACCAGTCTGCACAAGG + Intronic
1182450365 22:30416438-30416460 CACAGGCAGAAAGCTGGACATGG - Intronic
1182900913 22:33897491-33897513 ATCAGGCAGAAGTCAGGACAGGG + Intronic
1185081006 22:48709348-48709370 GACAGGTAGCAGTAAGGACATGG - Intronic
950433619 3:12966132-12966154 CAGTGGCAGCAGTCTGGACATGG - Intronic
952032118 3:29155872-29155894 AACAGGTGGCAGTCTGAACATGG + Intergenic
952665015 3:35893960-35893982 CACAGGTATAAGTGTGGAGCAGG - Intergenic
953323157 3:41990343-41990365 AAGAGGTAGAAGGCTGGGCACGG + Intergenic
953605401 3:44410276-44410298 CACAGGTAGGAGTGTGGTCTTGG - Intergenic
955705401 3:61722479-61722501 CAGAGGAAGCAGTCTGGATAAGG + Intronic
956696421 3:71922708-71922730 CAGTGGTAGCAGCCTGGACAGGG + Intergenic
957898190 3:86451290-86451312 CAGAAGTAGAAGTATGCACAGGG - Intergenic
959284136 3:104385570-104385592 CAAAGGAAGAAGTCTGAAGAAGG + Intergenic
963633154 3:147759368-147759390 GAAAGGTAGAAGACAGGACAAGG - Intergenic
964672598 3:159243570-159243592 CACAGATAGAAATCAGAACAGGG + Intronic
965013417 3:163126045-163126067 CCCAGGCAGAAGTTTGCACAGGG - Intergenic
966733510 3:183169820-183169842 CATATGTAGAAGTCTTGATATGG - Intergenic
970458735 4:16251574-16251596 CACAATTAGAAGACTGGAGAAGG - Intergenic
970630202 4:17933998-17934020 CAGAGGTAGCAGTCTTGGCAAGG - Intronic
980711293 4:136572063-136572085 CACATGTAAAAGTCTAGAGATGG - Intergenic
981510548 4:145552550-145552572 CACAGGAAGAAGTTTGGAGCAGG + Intronic
982234046 4:153235787-153235809 CAAAGGAAGAAGTGTGGAAAAGG - Intronic
982409827 4:155062201-155062223 AAAAGGTAGGAGACTGGACAAGG + Intergenic
983702453 4:170614688-170614710 CCCAGGAAGAAATCTGCACAGGG - Intergenic
984534880 4:180962106-180962128 CACAGTTAGATGTATGGACATGG + Intergenic
985402022 4:189602100-189602122 CACTGGTGGGAGGCTGGACATGG - Intergenic
987446353 5:18024371-18024393 CACAGGCAGAAGGTTGGAAAAGG - Intergenic
988943122 5:36166552-36166574 CACAGGTAAAAATCTGCACCCGG + Exonic
990939574 5:61188283-61188305 CCCAGGCAGAAGTCTTGATATGG + Intergenic
996425628 5:123311118-123311140 CACAGGTAAAAGTGTGTCCAAGG + Intergenic
1003163214 6:3653771-3653793 CACATGAAGAAGTCCAGACATGG + Intergenic
1003675289 6:8198610-8198632 CACATGTAGAAGAATGAACATGG - Intergenic
1005138408 6:22598484-22598506 CACAGGAAGAAGTCTGCAGATGG + Intergenic
1005891640 6:30145154-30145176 TACAGGTAGAAGTCAGGGGATGG - Intronic
1013079562 6:106800590-106800612 CACAGGTACATGTCTGGACATGG - Intergenic
1013817640 6:114117844-114117866 TAGAGGTAGATGTCTGGATAGGG - Intronic
1016784646 6:147997106-147997128 CACAGGTAATAGTCTGGAATAGG + Intergenic
1020769771 7:12375156-12375178 CACAGGAAGATGTCTGGAGAAGG + Exonic
1021388111 7:20057351-20057373 CACATGTAGAAGACTGGAACTGG + Intergenic
1022749088 7:33204441-33204463 CACTGATAGAAGTGTGGGCAGGG + Intronic
1025285339 7:57655767-57655789 CACCGGTAGAAGTCAGCTCAAGG - Intergenic
1027758989 7:82253356-82253378 AAAATGTAGAAGTCTGGCCATGG - Intronic
1028396506 7:90374910-90374932 CACACACAGAAGTCTGCACATGG + Intronic
1028748306 7:94353185-94353207 CAAAGCAAGAAGTCTGAACATGG - Intergenic
1030524784 7:110640010-110640032 CACAAGCAGAAGCCTGGAGAAGG - Intergenic
1031652617 7:124309211-124309233 CACAGGTAGTAGGCTGGATTTGG + Intergenic
1031775703 7:125906593-125906615 GACAGGTAGAAGCTTGTACATGG + Intergenic
1032625259 7:133584869-133584891 CAGAGATAAAAGTCTGGACCAGG - Intronic
1032723084 7:134566673-134566695 CAGAGGCAGAAGTCTGAGCAGGG - Intronic
1032945783 7:136851128-136851150 CAGAGGTGAAAGTATGGACATGG - Intergenic
1034265332 7:149777877-149777899 CACAGGGAGGAGGCTGGACAGGG + Intergenic
1037867861 8:22461781-22461803 TAAAGGTAGTAGTCTGGGCAGGG + Intronic
1039133528 8:34294702-34294724 CAGTGGCAGCAGTCTGGACAAGG - Intergenic
1039341319 8:36653285-36653307 CACAAGTATAATTCTGGACCAGG - Intergenic
1042661324 8:71157752-71157774 AAGAGGAAGAAGTCTAGACATGG - Intergenic
1044186731 8:89262031-89262053 CACAGGTAGAAGAATGAACCTGG + Intergenic
1046094948 8:109546528-109546550 CACAGGCAGCAGACTGGACAAGG - Intronic
1047657730 8:126996797-126996819 CAGAGGCATAAGTCAGGACAAGG + Intergenic
1049931112 9:457632-457654 CACAGGTATGTGACTGGACAGGG + Intronic
1050330417 9:4540187-4540209 CTCAGGGAGGAGTCTGGCCAGGG + Intronic
1054930986 9:70635158-70635180 CACAGGAAGCAGTCAAGACAGGG + Intronic
1055181767 9:73396930-73396952 CACATGTAGAAGAATGGACCTGG - Intergenic
1056457117 9:86771445-86771467 CACTGGTAGAAGGGTGGAGAAGG + Intergenic
1056847024 9:90047496-90047518 CACACCTAGAAGTCTGGGCGTGG - Intergenic
1057829595 9:98396429-98396451 CACAGGCAGAAGTGTGGCCCAGG - Intronic
1058581226 9:106460056-106460078 CACAGCTAGAAATCTGGAGCAGG - Intergenic
1059699624 9:116762532-116762554 AACAGGCAGAAGTCTGGATTTGG - Intronic
1060194367 9:121613869-121613891 CACAGGGAGAAGTCTTCAGATGG + Intronic
1188637422 X:32451736-32451758 CACAGGTAGAAGTCTGGACAAGG + Intronic
1191996097 X:67096589-67096611 GAAAGGCAGAAGTCTTGACAAGG - Intergenic
1192816817 X:74602439-74602461 TACATGTAGAAGGCCGGACACGG + Intronic
1194043220 X:88969800-88969822 CACATGTAGGAGTAGGGACATGG - Intergenic
1194917226 X:99721468-99721490 CACTGGTAAAAGTCAGCACAAGG + Intergenic
1195333873 X:103831034-103831056 CACTGTTGGAAGTCTGTACAGGG + Intronic
1195451634 X:105020428-105020450 GACAGACAGAATTCTGGACAGGG + Intronic
1195997488 X:110745649-110745671 CTCTGGTAGAAGTGTGGACAAGG - Intronic
1196698483 X:118640133-118640155 GACAGGTTGAAGTATTGACAAGG + Intronic
1198084055 X:133266154-133266176 CACAGGCAAAAGTCGGGATAAGG + Intergenic
1198087174 X:133292718-133292740 CACAGGTTGGAGCCTGGGCAGGG - Intergenic
1198416373 X:136424285-136424307 CTCAGGGAGAAGTCTGTACTGGG + Intergenic
1199759782 X:150896593-150896615 CACAGGAAGAACTCAGGAGATGG + Intronic
1202580495 Y:26375779-26375801 CACAGGTATAACTGTGGAAATGG + Intergenic