ID: 1188640792

View in Genome Browser
Species Human (GRCh38)
Location X:32501754-32501776
Sequence CTGGTGGAACAGATGGTGAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 292}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188640792_1188640798 -3 Left 1188640792 X:32501754-32501776 CCATTCACCATCTGTTCCACCAG 0: 1
1: 0
2: 1
3: 26
4: 292
Right 1188640798 X:32501774-32501796 CAGGGCCTGAGCTGATCTGCTGG 0: 1
1: 0
2: 0
3: 23
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188640792 Original CRISPR CTGGTGGAACAGATGGTGAA TGG (reversed) Exonic
900921828 1:5677438-5677460 AAGGTGGAACAGGAGGTGAAAGG + Intergenic
901821554 1:11833612-11833634 CTGGTGGAAGAGCTGGAGGATGG - Exonic
902742153 1:18446092-18446114 GTGCTGGAACAGAAGGTGCAAGG - Intergenic
903209946 1:21812327-21812349 CTGGTGGGACACAAGGAGAAGGG - Exonic
905537328 1:38732731-38732753 CTTGTGGAACAGGTGCTGGAAGG - Intergenic
905975479 1:42170991-42171013 GAGGGGGAGCAGATGGTGAACGG - Intergenic
907425299 1:54375663-54375685 CTGGTGGAAAGGATGGTGAGGGG + Intronic
907946798 1:59142938-59142960 TAGGTGGATAAGATGGTGAAGGG + Intergenic
910491993 1:87782933-87782955 CTGGTGGAAGAGACGATGTAGGG - Intergenic
910853994 1:91676403-91676425 TTGGTGTAGCAGATGTTGAAGGG - Intergenic
913117974 1:115713950-115713972 GAGGTGGAGGAGATGGTGAAGGG + Intronic
914847900 1:151292919-151292941 CTGGTGGAGCAGATGGTGGATGG - Exonic
916677264 1:167074472-167074494 CTGTTGGAACTGATGCTGAGGGG + Intronic
917143378 1:171860791-171860813 CTGATGGACTAGATGGGGAAGGG + Intronic
918479816 1:184966402-184966424 CTGGTGGATCAGCTGGTGGCTGG - Intronic
919122290 1:193356331-193356353 CTGGTGGAAAGCATGGTGCAAGG - Intergenic
919988603 1:202693014-202693036 TTGGGGGAACAGATGGTGTTTGG + Intronic
922978161 1:229802204-229802226 TTGGGGGAACAGATGGTGTTTGG - Intergenic
1062940218 10:1415185-1415207 GTGGGTGAACAGATGGTGGATGG + Intronic
1063110266 10:3029579-3029601 GTAGTGTAACAGATGGTGACCGG + Intergenic
1063202526 10:3797737-3797759 CTGGTGGGACTTCTGGTGAAAGG - Intergenic
1063217823 10:3939716-3939738 CTGGTTGGACAGATGGGAAAAGG - Intergenic
1063470507 10:6280827-6280849 TTGGGGGAACAGATGGTGTTTGG + Intergenic
1063821293 10:9839391-9839413 TTGGGGGAACAGATGGTGTTTGG - Intergenic
1064444921 10:15384592-15384614 CAGGAGGAGGAGATGGTGAAAGG + Intergenic
1064817517 10:19283509-19283531 GTGGTGGAAGAGATGGAAAAGGG - Intronic
1066039758 10:31536630-31536652 CTGGTGGAAGAGAAGGAGACAGG + Intergenic
1066622679 10:37374772-37374794 CTGGGGGAGCAGACAGTGAATGG - Intronic
1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG + Intergenic
1067291522 10:44946992-44947014 CTGGTCACACAGCTGGTGAAGGG - Intergenic
1067683113 10:48452413-48452435 CTGGTGGTACAGATGCTTGAGGG - Intronic
1067713622 10:48670788-48670810 CTGGTGGAGGGGAAGGTGAAGGG - Intergenic
1068047405 10:51905261-51905283 CTGGTGCAACAGATGGTCCTGGG + Intronic
1068979934 10:63051540-63051562 ATTGTGAAACAGAGGGTGAATGG + Intergenic
1069779450 10:70945647-70945669 CTGCTGGAACTCATGGTGCAGGG - Intergenic
1070335709 10:75453697-75453719 TTGGTGGAGCAGAAGGTGAGAGG + Intronic
1070392759 10:75985563-75985585 CTTGTGGAACTGCTGGTGAGAGG - Intronic
1070660252 10:78300585-78300607 CTGGGGAAACAGAAAGTGAAGGG - Intergenic
1071195819 10:83158004-83158026 GTGGAGGAACAGGAGGTGAATGG + Intergenic
1071229164 10:83564924-83564946 CTGGTTTAACAGTTGGTGAACGG + Intergenic
1073136439 10:101223038-101223060 CTGGGGGAACAGATGGGCAAAGG + Intergenic
1077234502 11:1473353-1473375 CTCGAGGAGCAGATGCTGAAAGG - Intronic
1081232150 11:40598790-40598812 CTTGTGGAACAGAGGGTGCTGGG + Intronic
1081726408 11:45332587-45332609 CTAGTGGACGAGATGGTGAATGG + Intergenic
1082116761 11:48337447-48337469 CAGCTGGAACAGATGGTGGCTGG - Intergenic
1082257036 11:50042863-50042885 CAGCTGGAACAGATGGTGGCTGG + Intergenic
1082728877 11:56770928-56770950 TTGGGGGAACAGATGGTGTTTGG + Intergenic
1083049273 11:59762565-59762587 CTTGTGGGACAGAGGCTGAAAGG + Intronic
1084568568 11:69945417-69945439 ATGGATGAACAGATGATGAATGG + Intergenic
1085115523 11:73928232-73928254 CTAGAGGAAGAGATGGTGGAGGG + Intergenic
1085226886 11:74929617-74929639 CTGCTGGAGCAGATGTGGAATGG - Intronic
1085656284 11:78318220-78318242 CTGGTGGAACAGAGGCAGAAGGG + Intronic
1086378962 11:86231722-86231744 CTGGTTGAAAAGATGGCAAAAGG + Intergenic
1087775295 11:102251276-102251298 ATGGTAGTAGAGATGGTGAAAGG + Intergenic
1088385567 11:109250848-109250870 AGGGTGGCACAGATGGTGAAGGG + Intergenic
1088634554 11:111807354-111807376 CTGAGGGAACAGCTAGTGAAAGG - Intronic
1088871694 11:113895799-113895821 CTGGGTGAAGAGAGGGTGAACGG - Intergenic
1089441141 11:118518299-118518321 CTGCTGGCATTGATGGTGAAAGG - Intronic
1090867744 11:130716924-130716946 CAGGTGGAGGAGAAGGTGAAGGG - Exonic
1091319048 11:134636843-134636865 CTGGATGAACAGCTTGTGAAGGG + Intergenic
1092202210 12:6592818-6592840 CTGGTGAAGCAGATGGAGAAAGG + Intronic
1095048524 12:37535738-37535760 CAGGTGCACCAGAAGGTGAAGGG - Intergenic
1095675028 12:44906696-44906718 CTAGAGGAAGAGATGGAGAAAGG + Intronic
1097068695 12:56339192-56339214 CTAGTGGGACACATGGTGAGTGG + Exonic
1097456571 12:59805944-59805966 TTGGTGGAAGTGATGGTGAAAGG - Intergenic
1098008855 12:66028875-66028897 CACATGGAACAGGTGGTGAAAGG - Intergenic
1099047910 12:77746600-77746622 TTGGAGGAAGAGATGGAGAAAGG + Intergenic
1099322527 12:81168198-81168220 CTTGTGGAACAGAAAATGAAGGG + Intronic
1100785532 12:98074022-98074044 CTGCAGGGAGAGATGGTGAAGGG - Intergenic
1101749743 12:107573511-107573533 TAGATGGAACAGATGGTGAGTGG + Intronic
1105652025 13:22389429-22389451 TTGGGGGAAGAGATGGTGAAGGG + Intergenic
1106213496 13:27673226-27673248 CTGGTTGAACAGGTGGTGTTTGG - Intergenic
1106346637 13:28885986-28886008 CTTGTGGAGCAGTTGGGGAAGGG + Intronic
1110755760 13:79171990-79172012 TTGGGGGAACAGATGGTGTTTGG + Intergenic
1110816804 13:79870277-79870299 CTGCTGGAACTGTTGGAGAAAGG - Intergenic
1113499520 13:110762059-110762081 CTGCTGGCACAGAGGCTGAAAGG - Intergenic
1113537024 13:111076217-111076239 CAGGTGGCAGTGATGGTGAATGG + Intergenic
1114220663 14:20693553-20693575 GTGTTGGAAGAGATGGTGATGGG + Exonic
1118201672 14:63679870-63679892 CAGGAGGAAGAGAAGGTGAAGGG + Intergenic
1118492071 14:66270701-66270723 CTGGTGGGACACATTGGGAAAGG + Intergenic
1118737215 14:68710634-68710656 CTGGTGGAGCAGCTGGGGAAGGG - Intronic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1120252137 14:82070744-82070766 CTGGTGGAAAAGAAGGTGCTTGG - Intergenic
1121528472 14:94636360-94636382 TTGGTGGAACAGGTGGTGTTTGG - Intergenic
1125823675 15:42656973-42656995 TTGGAGGAACAGATGGTGTCTGG - Intronic
1126907636 15:53384745-53384767 CAGGTGGGACAGATGGTTAGAGG + Intergenic
1126994916 15:54430864-54430886 CTGAGGGAACAGTTGGTGAGTGG + Intronic
1127195183 15:56576580-56576602 TTGGTGGAACAGGTGGTGTTTGG - Intergenic
1127500439 15:59549537-59549559 CTGGTGAGACAGGAGGTGAAAGG + Intergenic
1129457656 15:75684170-75684192 CTGGTGGAACAGAAAGGGCATGG - Intronic
1129726145 15:77902789-77902811 CTGGTGGAACAGAAAGGGCATGG + Intergenic
1129944142 15:79524590-79524612 CTGGGGGAACACAAGGTCAATGG - Intergenic
1130151374 15:81314308-81314330 CAGGTGGCACAGATGCTGACTGG + Intronic
1130274201 15:82468152-82468174 CTGGTGGAACAGAAAGGGCATGG + Intergenic
1130466546 15:84195526-84195548 CTGGTGGAACAGAAAGGGCATGG + Intergenic
1130497718 15:84478010-84478032 CTGGTGGAACAGAAAGGGCATGG - Intergenic
1130588843 15:85200119-85200141 CTGGTGGAACAGAAAGGGCATGG + Intergenic
1134420093 16:14078763-14078785 CTGGTGATGGAGATGGTGAAAGG + Intronic
1134810911 16:17166346-17166368 CTGGAGGAACAGATGGGAATTGG - Intronic
1135162935 16:20113572-20113594 TTGGGGGAACAGATGGTGTTTGG - Intergenic
1136498178 16:30656494-30656516 CTGGTGCTAGAGATGGTGACAGG + Intergenic
1137671895 16:50284049-50284071 CTGGTGGAAGAACTGGTGATTGG + Intronic
1137933856 16:52614555-52614577 CTAGTGCAAGAGATGGAGAAGGG + Intergenic
1138063585 16:53917011-53917033 CTGGTGGAAGAAGTGGTGACTGG - Intronic
1142810740 17:2394540-2394562 CTGGTGGGACGGAGGGTGACAGG - Intronic
1143052240 17:4135748-4135770 CTGGTGGAAAGAATGGAGAAGGG - Intronic
1143501913 17:7344109-7344131 CTGCTGAAACAGAAGGTGAGGGG + Exonic
1145411788 17:22671918-22671940 CAGGTGCACCAGAAGGTGAAGGG - Intergenic
1147210288 17:38869433-38869455 GTGGTGTAACAGAAGGAGAAAGG + Intergenic
1147458774 17:40555187-40555209 CAGGTGGCCCAGATGGTGATCGG - Exonic
1147980173 17:44269283-44269305 CTTGTGGTGCAGATAGTGAATGG - Intergenic
1151920226 17:77149044-77149066 CTGGAGAGACAGATGGGGAATGG - Intronic
1152251609 17:79215473-79215495 CTCAAGGAACAGATGGAGAAAGG - Intronic
1152447267 17:80353081-80353103 CTGGGGGAGCAGGTGGTGGAAGG + Intronic
1153660943 18:7325732-7325754 CTGAGGGAACAGAAGGTGCAAGG + Intergenic
1153676001 18:7456117-7456139 CTGGTGATGCAGATGGTGACGGG - Intergenic
1153712349 18:7812427-7812449 TTTGTGGGACTGATGGTGAATGG + Intronic
1155890282 18:31260030-31260052 TTGGTGGAACAGGTGGTGTTTGG + Intergenic
1157718727 18:49907159-49907181 CTGGGGGAACTGAAGGTGATTGG + Intronic
1159696800 18:71569013-71569035 TTGGGTGAACTGATGGTGAATGG + Intergenic
1161687817 19:5712071-5712093 CTGGTGGCACAGGTGGTCCAAGG + Intronic
1162155547 19:8675888-8675910 ATGGAGGAATAGATGGTGGATGG + Intergenic
1163364734 19:16869614-16869636 CTGGTGCAGCAGCTGGTGGATGG - Exonic
1163585573 19:18161660-18161682 GTCGTGGGACAGAAGGTGAAGGG + Intronic
1165604948 19:37093817-37093839 GAGGTAGAACAGATGGAGAATGG + Intronic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167711248 19:51112544-51112566 CTGGTGGAAGATATGGTGGCTGG + Intergenic
1167851285 19:52204347-52204369 CTGGGAGATCAGATGGTGTAGGG + Intronic
1168216889 19:54932898-54932920 ATTGGGGAACAGGTGGTGAATGG - Intronic
1168441554 19:56372017-56372039 CTGTTGTTACAGATGGTGCAAGG + Intergenic
1168475704 19:56673573-56673595 CTAGGGGAACAGATGGTGCTGGG + Intergenic
925513143 2:4649818-4649840 CTGGTGGTAATGATGGTGATAGG - Intergenic
926126868 2:10277426-10277448 GTGGTGGACCAGATGGAGGACGG + Intergenic
927366283 2:22300592-22300614 CTGGTGGAATAGATGCTGTTTGG - Intergenic
927589444 2:24340572-24340594 CTGGTGGGACAGAGGCTGGAAGG - Intronic
928172463 2:29012312-29012334 CTGGTGGGGCAGTTGGCGAAGGG + Intronic
928677085 2:33660889-33660911 CTGCTGGATCAGCTGGTGAGTGG - Intergenic
929418984 2:41771667-41771689 CTGGTGAAGCAGATGGGAAAGGG + Intergenic
929554328 2:42915981-42916003 CTGATGGAGCTGATGGTGATGGG - Intergenic
930331517 2:49991188-49991210 ATGTTGAAACAGTTGGTGAAAGG - Intronic
931392424 2:61855219-61855241 ATGCTGGAACAGATGCTGACTGG + Intergenic
931766256 2:65459164-65459186 CTGCTGGAAGAGACTGTGAAGGG - Intergenic
932557079 2:72833931-72833953 TTGGATGAAAAGATGGTGAAGGG - Intergenic
932668830 2:73719346-73719368 CAGGTGGACCTGATGGTGGATGG + Intergenic
933035720 2:77394910-77394932 CTTGTGGAACAGGGGGTGGAGGG + Intronic
933372953 2:81440513-81440535 CTGGGGGCACAGGTGGTGAATGG - Intergenic
933601354 2:84334677-84334699 TTGGGGGAACAGATGGTGTTTGG - Intergenic
934968979 2:98748003-98748025 AAGATGGAACAGATGATGAATGG + Intergenic
935498468 2:103809638-103809660 CGGGAGGAAGAGATAGTGAAGGG - Intergenic
935676686 2:105600523-105600545 ATGGTGGAAAAGATGGGGATGGG + Intergenic
936946475 2:117935517-117935539 CAGATGGAACAGATTGTGGAAGG - Exonic
937793469 2:125987992-125988014 TTGGGGGAACAGATGGTGTTTGG + Intergenic
940647083 2:156402968-156402990 CTGGTGGAACTGAGGGAGCAGGG + Intergenic
941862200 2:170294834-170294856 CTGGTGGAAGATATTGAGAATGG + Intronic
942440876 2:176035166-176035188 CTGGTGAAACAAATGGCCAATGG - Intergenic
942598661 2:177618277-177618299 CTGGTGGAGCAGCTGCTGAGTGG - Exonic
943174295 2:184449962-184449984 CAGGTAGAGCAGATGGTGACTGG - Intergenic
946211390 2:218150108-218150130 ATGGGGGAAGAGATGGTGAAAGG - Intergenic
946462436 2:219881058-219881080 CTGGGGGAAAAAATGGTCAAGGG - Intergenic
946537650 2:220648642-220648664 CAGGTGGAATAGATGGTGAGAGG - Intergenic
946552849 2:220822564-220822586 CTGGAGGGACAGATGAGGAAGGG - Intergenic
948223315 2:236290311-236290333 CTGGTGGAACAGGTGAGGGAAGG - Intergenic
948229103 2:236336714-236336736 TTGGTGTTACAGATGGTGGAGGG - Intronic
1169676596 20:8161441-8161463 CTGGTTGTACAGTTGGTTAATGG + Intronic
1169740564 20:8889182-8889204 GTGGTGGAAGTGATGGTGCATGG - Intronic
1170647828 20:18212573-18212595 CAGGTGGAACAGAGAGAGAAAGG + Intergenic
1170873179 20:20226916-20226938 AGGGTGGAACAGATGTTGAGAGG + Intronic
1171846102 20:30275861-30275883 CAGGTGCACCAGAAGGTGAAGGG - Intergenic
1172333834 20:34097294-34097316 ATGGTGGAACAGATGCAGAGAGG - Intronic
1172981002 20:38941636-38941658 GTGGAGGAATAGAAGGTGAATGG + Intronic
1173066097 20:39713600-39713622 CTGGTGGAACAGAAGGTTAGTGG + Intergenic
1177807871 21:25892203-25892225 CAGGTGGAACATTTGGTGAGTGG + Intronic
1177973273 21:27816839-27816861 CAGGTGGAAGACAGGGTGAAGGG + Intergenic
1179937421 21:44614183-44614205 CTGGCGTCACAGATCGTGAATGG - Intronic
1180047032 21:45311682-45311704 GTGGTGGAGCAGAGGGTGCATGG - Intergenic
1180614690 22:17119881-17119903 CTGGTGGAGCTGATGCTGGAGGG - Exonic
1180956688 22:19744430-19744452 CTGGTGGAGGGGAAGGTGAAGGG - Intergenic
1182248312 22:28978565-28978587 CTGCTGGAACACTTGGAGAAAGG + Intronic
1183964650 22:41434494-41434516 CTAGGGGAACAGATGGTGCTGGG + Exonic
1185332270 22:50257089-50257111 CTCGTGTACCAGATGCTGAAGGG - Exonic
950156674 3:10726201-10726223 CGGGTGGAAGAGAGGTTGAAGGG - Intergenic
951787819 3:26442413-26442435 CTGGTGAAAAAGATGGACAAGGG - Intergenic
953211875 3:40883042-40883064 ATGGAGGAACAGCTGGTGAGTGG + Intergenic
953215865 3:40917507-40917529 CTGGGGGACAGGATGGTGAACGG - Intergenic
954418615 3:50406633-50406655 ATGGTGGAGCTGATGGTGATGGG - Intronic
955236514 3:57144340-57144362 GAGGAGGAAGAGATGGTGAACGG - Intronic
958702433 3:97610810-97610832 GTGGTGGAATATATGGAGAATGG + Exonic
958733940 3:97988704-97988726 GTGGTGGGACTGTTGGTGAATGG + Intronic
958904479 3:99927005-99927027 CAGGAGGTTCAGATGGTGAAGGG - Intronic
959314800 3:104789524-104789546 CTGGAGGTACAGATGCTGATGGG + Intergenic
959808714 3:110591660-110591682 CTGGTGTATCACATGGTGAAAGG + Intergenic
959878868 3:111419475-111419497 GTGGTGGTACAGGTGGTGCAAGG + Intronic
962353521 3:134673713-134673735 CTGGTGGAGGGGATGGGGAAGGG - Intronic
963001739 3:140688027-140688049 CTGGTGGACCAGATCGAGGACGG + Exonic
965117452 3:164510361-164510383 CTGGTGTGCCAGTTGGTGAATGG + Intergenic
965303793 3:167038249-167038271 CTAGTGGAGGAGATGGAGAAAGG + Intergenic
965664540 3:171078913-171078935 CTGCTGCAACAGAAGATGAAAGG - Intronic
967413577 3:189192750-189192772 CTGGTAGAACAGATACTCAAAGG - Intronic
968527693 4:1071882-1071904 ATGCTGGATCAGATGGTGAGAGG - Intronic
969847417 4:9930235-9930257 CTGATGAAAGTGATGGTGAAGGG - Intronic
971509239 4:27403583-27403605 TTGGGGGAACAGATGGTGTTTGG - Intergenic
972407411 4:38760152-38760174 TTGGTGGAACAGATTGTGTTTGG + Intergenic
975177557 4:71305606-71305628 CTAGTGGTAAAGATGGGGAAAGG - Intronic
975714078 4:77188997-77189019 CCAGGGGAACAGGTGGTGAAAGG - Intronic
976903682 4:90209362-90209384 GTAGTGGAACAGATGGTGGAGGG + Intronic
979150275 4:117304485-117304507 CAGGTGAAAGAGAAGGTGAAAGG + Intergenic
980464215 4:133152160-133152182 CTGGTGGTTCAGCTGGTGGATGG + Exonic
980846907 4:138334710-138334732 CTGATGGAACAGGTGGTGTAAGG - Intergenic
981884965 4:149663920-149663942 CTGGGGGAAGAAATGGAGAAGGG - Intergenic
984496347 4:180502814-180502836 CAGGTGGAAGAGGAGGTGAAAGG + Intergenic
984925768 4:184805519-184805541 TTGGTGGCACAGATGGTGAGTGG - Intronic
986445992 5:7821813-7821835 CTGATGGAGCAGAAGGGGAAGGG + Intronic
987183523 5:15390327-15390349 TTGTTCGAACAGTTGGTGAAAGG - Intergenic
988479800 5:31620169-31620191 CAGGTGGTAGAGATGGTAAATGG + Intergenic
990516256 5:56533659-56533681 TTGGTGCAACAGTTGGAGAAAGG + Intronic
990653634 5:57930401-57930423 CTGGTGGATCTGCTTGTGAACGG + Intergenic
992846606 5:80755647-80755669 CTGAGGGAACAGATGGAAAAAGG + Intronic
993054185 5:82962404-82962426 CGGGTGGAACAGATGATAATAGG - Intergenic
993100140 5:83528179-83528201 ATGGTGTGACAGATTGTGAATGG + Intronic
993499540 5:88649646-88649668 TTGGGGGAACAGATGGTGTTTGG - Intergenic
996601497 5:125269412-125269434 CTGCTTGAAAAGGTGGTGAATGG + Intergenic
997377598 5:133408473-133408495 CTGGTGGAGCAGAGGGAGAAGGG + Intronic
997610118 5:135209915-135209937 CTGGTGGGACAGACAGAGAATGG - Intronic
1000217854 5:159181051-159181073 CTGGGGGAACACATGGTGTTTGG - Intronic
1000905975 5:166966202-166966224 CTTGTGGAACTGATGGGGATTGG + Intergenic
1002108799 5:176894206-176894228 CTGGTGGAAGGGGTGGGGAAGGG + Intronic
1003528586 6:6918744-6918766 CTGGTGGAGCAGATGTTGATGGG + Intergenic
1006718587 6:36135832-36135854 CTGGTGTATCAGATGCTCAAAGG + Exonic
1007051840 6:38839259-38839281 CTGTTGGTCCAGATGGTAAATGG - Intronic
1008231975 6:48994305-48994327 TTGGGGGAACAGATGGTGTTTGG - Intergenic
1008271437 6:49494949-49494971 CTAGTGGAGCAGATGGAGCAGGG + Intergenic
1009744637 6:67797168-67797190 TTGGTGGAACAGGTGGTGTTTGG - Intergenic
1012442108 6:99270423-99270445 CTGGTGGCACAGCTTGGGAAGGG - Intergenic
1012544689 6:100404608-100404630 TGGGAAGAACAGATGGTGAAAGG + Intronic
1012602195 6:101112358-101112380 CCTGTGGGAAAGATGGTGAATGG + Intergenic
1013570883 6:111424371-111424393 ATGGAGGAACAGATATTGAAAGG - Intronic
1015529616 6:134208404-134208426 TTTGGGGAACAGATGGTGTATGG + Intronic
1016034333 6:139370620-139370642 CTGGCAGAATAAATGGTGAAGGG + Intergenic
1016604748 6:145907529-145907551 CTAGGGGACCAGATGTTGAAGGG - Intronic
1018009174 6:159654098-159654120 CTACTGGAACAATTGGTGAATGG + Intergenic
1018060938 6:160089174-160089196 CAGGAGGTGCAGATGGTGAATGG + Exonic
1018687570 6:166315894-166315916 CTGCTGGATCATCTGGTGAATGG - Intergenic
1019710278 7:2515291-2515313 CTGGTTGAACTGATGGTGGGGGG - Intronic
1019834639 7:3370674-3370696 CTGGTGAAACAGATTGCGAATGG + Intronic
1020331848 7:7026519-7026541 TTGGAGGAACAGATGGTGTTTGG + Intergenic
1020403135 7:7800465-7800487 TTGGGGGAACAGATGGTGTTTGG + Intronic
1022953374 7:35359899-35359921 CTGGGGGAACAGGTGGTGCTTGG + Intergenic
1023503983 7:40881066-40881088 GTGGAGGATGAGATGGTGAAGGG - Intergenic
1024956384 7:54925856-54925878 GTGGAGGAACAAATGGTGTAAGG - Intergenic
1025294436 7:57764322-57764344 CAGGTGCACCAGAAGGTGAAGGG - Intergenic
1026487000 7:70830247-70830269 CTTGTGAAGCAGATGGTGAAGGG - Intergenic
1026659382 7:72286267-72286289 GTGGTGGAAGAGATGGTGGTGGG - Intronic
1026903473 7:74049625-74049647 ATGGAGGAATAGATGGTGGATGG - Intronic
1027231571 7:76275746-76275768 CAAGTGGAAAAGATGGTGGAAGG - Intronic
1029072317 7:97909937-97909959 TCAGTGGAACAGATGCTGAATGG - Intergenic
1030746165 7:113169352-113169374 ATGGTGAAATACATGGTGAAGGG - Intergenic
1031339424 7:120580430-120580452 CTTGTGGAGCAGAAGGTGGAAGG - Intronic
1032927779 7:136628764-136628786 ATGGTGGAACAGATTGTTAGTGG - Intergenic
1035049530 7:155990509-155990531 CTGGAGGAGCAGCTGGGGAAGGG + Intergenic
1035078588 7:156198037-156198059 CTGGAGGAACACATGGAGAGAGG - Intergenic
1035290828 7:157837432-157837454 CTGATGGAAGAGGTGGTGGAGGG + Intronic
1035405498 7:158594487-158594509 ATGGTGGTACTGATGGTGATGGG + Intergenic
1037619472 8:20550848-20550870 ATGGTGCCACAGATGGTGCAGGG - Intergenic
1039449367 8:37659381-37659403 GTGCTGGAAAAGATGCTGAAAGG + Intergenic
1039823262 8:41152460-41152482 ATGGTGGAACAAATGTTGACCGG - Intergenic
1040352964 8:46587029-46587051 CTGGTGAGACAGAAGGTGTAAGG - Intergenic
1041741148 8:61158311-61158333 CTGGAGGAACAGACTGGGAAGGG + Intronic
1042181428 8:66091492-66091514 CTTGTGGATAAGATGGTGAATGG + Intronic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1043438766 8:80258624-80258646 CTGGGGGAGAAGATGTTGAAAGG + Intergenic
1044512340 8:93097065-93097087 AAGGTGGAAAAGATGGAGAAAGG - Intergenic
1045968745 8:108055992-108056014 CTGAGGGACCAGAGGGTGAATGG - Intronic
1048006217 8:130421368-130421390 GTGCTGCCACAGATGGTGAATGG - Intronic
1049008357 8:139871957-139871979 CTGGTGGATAAGCTGGTGGATGG + Intronic
1049364272 8:142229175-142229197 ATGGATGGACAGATGGTGAATGG + Intronic
1051062758 9:13064099-13064121 CTGAGTGAACAGATGGTGTAGGG + Intergenic
1051595801 9:18823527-18823549 AGGGTGGAACAGAGGGAGAAGGG - Intronic
1054161984 9:61679981-61680003 CAGGTGCACCAGAAGGTGAAGGG + Intergenic
1054941018 9:70741939-70741961 TTGGGGGAACAGATGGTGTTTGG - Intronic
1055503462 9:76924816-76924838 CTGGTGGAAGAGATGGTTTTTGG - Intergenic
1055634986 9:78268215-78268237 CTGGTGAATAAGAAGGTGAAGGG + Intronic
1056117697 9:83457332-83457354 CTGGTGAAAAAGATGAAGAAAGG + Intronic
1056901260 9:90601913-90601935 TTGGGGGAACAGATGGTGTTTGG + Intergenic
1057392709 9:94652901-94652923 CTGGGGGGCCAGATGGTGCAGGG - Intergenic
1058151121 9:101464761-101464783 CTGGTAGAACTGACGGTGAATGG + Intergenic
1058633339 9:107011637-107011659 CTGCTGGGCAAGATGGTGAATGG + Exonic
1059576231 9:115491733-115491755 CAGGAGGAGCAGTTGGTGAAGGG + Intergenic
1060115439 9:120936611-120936633 CTGGTGGAAAAAATGAAGAAAGG - Intergenic
1060968932 9:127727054-127727076 CAGCTGGAGCAGATGGTGGAGGG + Exonic
1061622645 9:131821583-131821605 CTGGTGGAAGAAGTGGTGGAAGG + Intergenic
1186524741 X:10238212-10238234 CTGGGGGTACAGCTGGGGAAAGG + Intergenic
1186791602 X:13004795-13004817 CAGGTGGAAAAGGTGGTTAATGG - Intergenic
1187723669 X:22179347-22179369 TTGGGGGAACAGATGGTGGTTGG + Intronic
1188640792 X:32501754-32501776 CTGGTGGAACAGATGGTGAATGG - Exonic
1190048236 X:47129576-47129598 CTGGTGCAACAGATGATGTCCGG - Intergenic
1190177397 X:48162208-48162230 CTGCTGGAAAAGATGGTGTGGGG - Intergenic
1190738519 X:53271885-53271907 TTGGTGGAAGAGATGGTCCATGG - Intronic
1192530893 X:71883701-71883723 TTGGGGGAACAGATGGTGTTTGG + Intergenic
1192661810 X:73049708-73049730 CTTGTGAAATAGATCGTGAAGGG - Intergenic
1193430145 X:81392057-81392079 CTGGTGGAACAGCTGGGAGATGG + Intergenic
1194754299 X:97719524-97719546 CTGGTGGAAGAGAGAATGAATGG - Intergenic
1194915265 X:99699377-99699399 GGGGTGGCAAAGATGGTGAAAGG - Intergenic
1196244489 X:113384381-113384403 CTGGTGGAGCTAATGGAGAAAGG + Intergenic
1196950810 X:120874792-120874814 CTGGTGAAGCGGGTGGTGAAGGG - Intronic
1196951652 X:120931194-120931216 CTGGTGAAGCGGGTGGTGAAGGG - Intronic
1196952336 X:120936055-120936077 CTGGTGAAGCGGGTGGTGAAGGG - Intronic
1196953021 X:120940916-120940938 CTGGTGAAGCGGGTGGTGAAGGG - Intronic
1196953706 X:120945776-120945798 CTGGTGAAGCGGGTGGTGAAGGG - Intronic
1196954391 X:120950637-120950659 CTGGTGAAGCGGGTGGTGAAGGG - Intronic
1196955074 X:120955497-120955519 CTGGTGAAGCGGGTGGTGAAGGG - Intronic
1196955762 X:120960380-120960402 CTGGTGAAGCGGGTGGTGAAGGG - Intronic
1196956443 X:120965241-120965263 CTGGTGAAGCGGGTGGTGAAGGG - Intronic
1196957125 X:120970101-120970123 CTGGTGAAGCGGGTGGTGAAGGG - Intronic
1196957807 X:120974961-120974983 CTGGTGAAGCGGGTGGTGAAGGG - Intronic
1196958489 X:120979821-120979843 CTGGTGAAGCGGGTGGTGAAGGG - Intronic
1196959170 X:120984681-120984703 CTGGTGAAGCGGGTGGTGAAGGG - Intronic
1197440112 X:126477130-126477152 CTGGAGAAAGAGAAGGTGAAGGG + Intergenic
1197516432 X:127435751-127435773 CTGCTGCAACAAATTGTGAAGGG + Intergenic
1198512900 X:137372083-137372105 TTGGTGGAACTGGTGTTGAAAGG + Intergenic
1199843589 X:151674943-151674965 CTGGTGGCACAGTTAGTCAAGGG - Intronic