ID: 1188641491

View in Genome Browser
Species Human (GRCh38)
Location X:32510969-32510991
Sequence ACATACACACACATAGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3332
Summary {0: 2, 1: 5, 2: 64, 3: 439, 4: 2822}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188641491 Original CRISPR ACATACACACACATAGAGAG AGG (reversed) Intronic
Too many off-targets to display for this crispr