ID: 1188648830

View in Genome Browser
Species Human (GRCh38)
Location X:32604470-32604492
Sequence TTGTAGTTCTTGGGGGAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 352}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188648830_1188648842 25 Left 1188648830 X:32604470-32604492 CCCCCCTCCCCCAAGAACTACAA 0: 1
1: 0
2: 2
3: 23
4: 352
Right 1188648842 X:32604518-32604540 GCTCCAATTCAACATAGTACTGG 0: 1
1: 19
2: 579
3: 4820
4: 13485

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188648830 Original CRISPR TTGTAGTTCTTGGGGGAGGG GGG (reversed) Intronic
900857454 1:5197404-5197426 GTGTATTTGGTGGGGGAGGGGGG + Intergenic
901558208 1:10048362-10048384 TTGCAGTTCTTGGGGGAGGTTGG + Intronic
901770133 1:11525805-11525827 TTCTTTTTCTTGGGGGTGGGGGG + Intronic
902497461 1:16883694-16883716 TTGTTGTTTTGGGGGGTGGGAGG + Intronic
904217617 1:28935469-28935491 GCGTAGATCTTGGGGGGGGGGGG - Intronic
905178013 1:36150092-36150114 TAGCTGTTCTAGGGGGAGGGAGG - Intronic
905972520 1:42152899-42152921 ATGTGGGTCTTGGGGGAGTGGGG + Intergenic
908617018 1:65932985-65933007 TAGGAGTTCTTGGAGGAGAGAGG + Intronic
908925595 1:69250616-69250638 TTGGAGTTCTTGGGTGATTGTGG - Intergenic
909760147 1:79276281-79276303 TTCTACTTGATGGGGGAGGGTGG + Intergenic
910079207 1:83320386-83320408 TGGAAGTTCTAAGGGGAGGGAGG + Intergenic
910328532 1:86040460-86040482 TTGTAGGGGTGGGGGGAGGGGGG - Intronic
912236169 1:107853560-107853582 TTTTGGTTCTTGAGGGATGGGGG - Intronic
913653291 1:120938567-120938589 TTGGAGTTCTTAGGGGGTGGTGG - Intergenic
914167814 1:145190476-145190498 TTGGAGTTCTTAGGGGGTGGTGG + Intergenic
914518979 1:148398679-148398701 TTGGAGTTCTTAGGGGGTGGTGG - Intergenic
914643472 1:149632718-149632740 TTGGAGTTCTTAGGGGGTGGTGG - Intergenic
914676873 1:149912785-149912807 TTGGGGTGGTTGGGGGAGGGGGG - Intronic
915584712 1:156838158-156838180 TTGGAGTTCTCTGGGGAGAGAGG - Intronic
916846112 1:168651971-168651993 TTGAGGTTTTTGGGGGAGGAAGG - Intergenic
917434061 1:175000570-175000592 GTGTCGTTCTTGGTAGAGGGCGG + Intronic
917481727 1:175417999-175418021 TTGTAGTCTTTGGGTCAGGGCGG - Intronic
918169106 1:181978607-181978629 TTGTATTTCTTTGGGGTCGGTGG - Intergenic
918789449 1:188807629-188807651 TTGTAATTATTGAGGGTGGGAGG + Intergenic
919642583 1:200059916-200059938 TTGTTGTTCTTGGCTGTGGGTGG - Intronic
919763775 1:201114019-201114041 CTGTAAGCCTTGGGGGAGGGGGG - Exonic
920086831 1:203423526-203423548 TGGTAGATCTTGGGGGAAAGAGG + Intergenic
920552579 1:206875838-206875860 ATGTGTTTTTTGGGGGAGGGGGG - Intergenic
920749717 1:208662274-208662296 GTGTGTTTGTTGGGGGAGGGGGG - Intergenic
921579693 1:216881626-216881648 TTGTTGTTGTTGGGGGAGCTGGG - Intronic
922086086 1:222348106-222348128 TTTTAGGTCTTTAGGGAGGGGGG + Intergenic
923917701 1:238528013-238528035 TTATAGTTCGTGGGAGAGTGTGG + Intergenic
1063005565 10:1967132-1967154 TGGGTGTTCTTGGGGGAGGTGGG + Intergenic
1063199771 10:3776518-3776540 TTGTTTTTTTTGGGGGAAGGGGG - Exonic
1064682095 10:17820327-17820349 TTATAGATCTCGGGGGATGGTGG + Intronic
1064740383 10:18427372-18427394 TTGAAGATTTTGGGGGAGGGTGG + Intronic
1065010310 10:21415166-21415188 TTGTGTTTTTTGTGGGAGGGGGG + Intergenic
1065038499 10:21665291-21665313 TTGTTTTTTTTGGGGGGGGGGGG + Intronic
1065058859 10:21876281-21876303 TTGTATTTTTTGGTGGAGGTGGG + Intronic
1065135097 10:22659824-22659846 TTTTTGTTGTTGGGGGTGGGAGG - Intronic
1066179564 10:32946740-32946762 ATGTATTTCTGGGGGGGGGGGGG + Intronic
1067955953 10:50790808-50790830 TTGTGGTTGTTTGGGGAGAGGGG - Intronic
1070073818 10:73115788-73115810 GTTTAGTTCTTGGGGGAAGGGGG - Intronic
1070177047 10:73979633-73979655 TTTTACTTCATGGTGGAGGGAGG + Intergenic
1070250001 10:74765362-74765384 TTTTAATTTTTGGGGGAGGTGGG - Intergenic
1073213283 10:101821825-101821847 TTGTAGGTGTTGGGGGTGGGTGG - Intergenic
1074071148 10:110070971-110070993 TTGTTGTTTTTGGGGGGGGGGGG + Intronic
1075223450 10:120603872-120603894 TTGTGTGTGTTGGGGGAGGGGGG - Intergenic
1075471602 10:122694869-122694891 TTGGAGTTGGTGGGGGGGGGAGG - Intergenic
1076576311 10:131472039-131472061 TTGAAGTTCTTGGTGGGGGAAGG + Intergenic
1078011721 11:7577477-7577499 TTGGAGTTCTTGAGGGGGGAGGG + Intronic
1078116162 11:8453001-8453023 CTGGGGTTCTTGGGGGTGGGAGG + Intronic
1078252450 11:9627455-9627477 TTGTAGAGATTGGGGGGGGGGGG + Intergenic
1078259101 11:9687882-9687904 TAGGAGTTCATGGGGCAGGGTGG + Intronic
1078456521 11:11480047-11480069 TTGTAGATCTTGGAGCGGGGAGG + Intronic
1079975922 11:27091453-27091475 TTATACATTTTGGGGGAGGGAGG - Intronic
1081199511 11:40199389-40199411 TTGTGGTTGTTGGGGAAGGAGGG + Intronic
1083047062 11:59746674-59746696 TTTTCCTTCTTGGAGGAGGGTGG + Intronic
1083671735 11:64303849-64303871 TGGGAGTTCTTGGGGGTTGGCGG - Intronic
1086936790 11:92753976-92753998 TTGGAGGACTTGGGGGAAGGTGG + Intronic
1087251651 11:95907186-95907208 TTGTATTTCTTTGGGGTTGGTGG - Intronic
1087402532 11:97685170-97685192 TTGTAGTTGTTGTTGTAGGGGGG + Intergenic
1087545653 11:99580649-99580671 TTGTAGTTCTGTGGGGTCGGTGG + Intronic
1088592400 11:111414939-111414961 TTGCAGGTCTTTGGGGAGGCTGG + Intronic
1089275272 11:117331058-117331080 TTGTAATTGTTGGAGCAGGGTGG + Intronic
1090172620 11:124617986-124618008 TTGTATGTGTTGGGGGATGGGGG + Intronic
1091329523 11:134720298-134720320 TTCTTGTGGTTGGGGGAGGGGGG - Intergenic
1092394372 12:8112370-8112392 TTTTAAATGTTGGGGGAGGGAGG - Intergenic
1095421498 12:42028834-42028856 TGGTAGTTGCTGGGGGAGGCTGG + Intergenic
1095566208 12:43627021-43627043 GTGTAGTTATTGCTGGAGGGTGG + Intergenic
1095768319 12:45921831-45921853 TTGAATTTTGTGGGGGAGGGTGG + Exonic
1096019862 12:48314621-48314643 TTGTAGTTAATGGGAGAGGTGGG + Intergenic
1096820704 12:54231827-54231849 ATGTAGCTTTTGGGGGTGGGGGG + Exonic
1097138388 12:56878907-56878929 TTGTATTTTTTGGTGGAGAGGGG + Intergenic
1099386478 12:82019067-82019089 TTGTGGTGTTTGGAGGAGGGTGG - Intergenic
1099927991 12:89041196-89041218 TTACAGTTCTCGGGGGTGGGAGG - Intergenic
1101178845 12:102188166-102188188 TTGTAGTTGTGTGGGGAGGTAGG + Intronic
1101329507 12:103746112-103746134 ATGTAGTGCTTAGGGGAGGAGGG - Intronic
1102046477 12:109833079-109833101 TAGCAGGTCTGGGGGGAGGGCGG - Intronic
1102979513 12:117230291-117230313 TTTTAATTAATGGGGGAGGGTGG - Intronic
1103363504 12:120367735-120367757 TAGTACTTCTAGGGAGAGGGTGG + Intronic
1103943855 12:124515427-124515449 ATGTTATTCTTGGGGGAGGCTGG - Intronic
1104214209 12:126720189-126720211 TTGTAATACTTGGGGGAGAAGGG - Intergenic
1104257596 12:127153983-127154005 TTGAAGTTCTTGGGTGCTGGAGG - Intergenic
1104624602 12:130340622-130340644 TGGTGGTGGTTGGGGGAGGGGGG + Intronic
1104849620 12:131865786-131865808 TTGTAGAGATTGGGGGCGGGGGG - Intergenic
1105457439 13:20554527-20554549 TTCTTTTTTTTGGGGGAGGGGGG - Intergenic
1105572053 13:21611916-21611938 TTTTTGTTGTTGGGGGTGGGGGG + Intergenic
1105799812 13:23893427-23893449 TTGTTTTGCTTGCGGGAGGGAGG - Intronic
1107131869 13:36905095-36905117 TTGTTGTAACTGGGGGAGGGAGG + Intronic
1109105362 13:58243412-58243434 TTGTATTTCTTAGGGGTTGGTGG - Intergenic
1110192126 13:72742242-72742264 TTCTGGTTTTGGGGGGAGGGGGG + Intronic
1111004665 13:82232317-82232339 TTGTATTTCTTTGGGATGGGTGG - Intergenic
1115654534 14:35430835-35430857 TGGTTGTTCTAGGGGCAGGGAGG - Intergenic
1115810059 14:37097435-37097457 TTGATGTTCCTGGGGGAGGTAGG + Intronic
1116611029 14:47072090-47072112 TTGTTGTTGTTTGGGGGGGGGGG + Intronic
1116997475 14:51339133-51339155 TGGGAGTTCTTGGGGATGGGTGG - Intergenic
1117083645 14:52177582-52177604 TTGTATTTCTTGGGGAACAGGGG - Intergenic
1117737404 14:58781575-58781597 TTGACATTCTTGGAGGAGGGAGG + Intergenic
1119650191 14:76377666-76377688 TCGTGGTTCTTGGGGGGAGGGGG - Intronic
1120446973 14:84611036-84611058 TTGTTGTTGTTGGGGCAGGTTGG + Intergenic
1121374062 14:93389533-93389555 TTGGAGTTCTTGGAGGTGGAAGG + Intronic
1121765010 14:96478735-96478757 TTGTGGGGCTGGGGGGAGGGTGG + Intronic
1122778465 14:104133589-104133611 TCTGAGTGCTTGGGGGAGGGTGG - Intergenic
1122781611 14:104146183-104146205 TGGTTGTTTTTGGGGGTGGGTGG + Intronic
1123207966 14:106731979-106732001 TTGTGGGGGTTGGGGGAGGGGGG - Intergenic
1123957888 15:25358375-25358397 TTTTATTTTTTGGTGGAGGGAGG - Intronic
1125248180 15:37666956-37666978 TTGGATTTATTTGGGGAGGGGGG - Intergenic
1126141992 15:45446445-45446467 TTACTTTTCTTGGGGGAGGGGGG + Intronic
1126747655 15:51842770-51842792 TTGTACTTCATGAGGGAGGTGGG - Intronic
1127351811 15:58160665-58160687 TTATAGTTTTTGGGGGTGGGGGG + Intronic
1129103490 15:73288162-73288184 TTGTTGTTGTTGGGGGCAGGAGG + Intronic
1129461134 15:75700558-75700580 TTGGAGGTCTGGGAGGAGGGTGG + Intronic
1129591275 15:76916932-76916954 TTGTATTTGTTGGGGGGGGGGGG + Intergenic
1129723696 15:77891184-77891206 TTGGAGGTCTGGGAGGAGGGTGG - Intergenic
1130452295 15:84067939-84067961 TTGTTTTTTTTGGTGGAGGGTGG - Intergenic
1131095692 15:89653053-89653075 TTGGAGGGATTGGGGGAGGGTGG + Intronic
1132270239 15:100517774-100517796 TCCTAGTTCTTGGAGGAGGGTGG + Intronic
1132902666 16:2267013-2267035 TCTTAGTTCTTGGGGGGGTGGGG - Intronic
1133180150 16:4048123-4048145 CTGTCATTTTTGGGGGAGGGTGG + Intronic
1133257070 16:4523591-4523613 TTGTGGTTTTTTGGCGAGGGGGG - Intronic
1133691085 16:8216020-8216042 TCCTAGTTCTTCAGGGAGGGTGG - Intergenic
1133805682 16:9124524-9124546 TAGAACTACTTGGGGGAGGGGGG + Intergenic
1133966017 16:10532186-10532208 CTGTAGGTCTGGGGTGAGGGGGG + Exonic
1134680887 16:16124707-16124729 TTACAGCTCTTGGGGGAGGAAGG - Intronic
1134778150 16:16871047-16871069 TTGTTTTTTTTGGGGGGGGGGGG - Intergenic
1137735448 16:50719995-50720017 TTGCAGTTCCTGGGGTAGGTTGG + Exonic
1138854217 16:60668243-60668265 TTTTATTTTTTGGGGGAGTGTGG + Intergenic
1138989240 16:62370977-62370999 ATATGGTTCTCGGGGGAGGGGGG + Intergenic
1139323054 16:66130838-66130860 TTGTAGTTTTTTGGGGGGTGGGG - Intergenic
1139903113 16:70343578-70343600 TTGTTGTTGTTGGGGGAGACAGG - Intronic
1140054694 16:71515860-71515882 TTGTATTTTTTGGGGGACGGCGG - Intronic
1142230953 16:88900097-88900119 TTGCAGGTCCTGGGGGACGGCGG - Intronic
1142875814 17:2851741-2851763 TTGTAGTTGTTTGGAGAGGTGGG + Intronic
1143660918 17:8324189-8324211 GTGTATGTTTTGGGGGAGGGTGG + Intergenic
1144166434 17:12615656-12615678 TTCTAGCACTTGGGGGAGTGGGG + Intergenic
1144516302 17:15919539-15919561 TTGTAGTCCCTGGTTGAGGGTGG - Intergenic
1144890479 17:18491364-18491386 GTTTAGTTCTTGGGGAAGGAGGG - Intronic
1145141738 17:20452954-20452976 GTTTAGTTCTTGGGGAAGGAGGG + Intronic
1145997497 17:29113072-29113094 TTGTGGTTCCCGGGAGAGGGGGG - Intronic
1146320869 17:31845305-31845327 TTTTTGTTGTTGGGGGTGGGGGG + Intergenic
1146713943 17:35067913-35067935 TTGTGGTTCTTGTGGGTGAGCGG - Intronic
1147050205 17:37788672-37788694 TTGGCATTCTTGGGAGAGGGGGG + Intergenic
1147190181 17:38733869-38733891 CTGTAGTTCTTTGGGGTGGAGGG - Exonic
1147467851 17:40625502-40625524 TGGTAGTGCTTGGGGGTGGAGGG + Exonic
1148435436 17:47680699-47680721 TTCTACTTCCTGGAGGAGGGGGG + Intronic
1148498547 17:48070992-48071014 GTGTATTATTTGGGGGAGGGAGG - Exonic
1149173860 17:53845736-53845758 TGGTAGTATTTGTGGGAGGGGGG + Intergenic
1149370032 17:55984862-55984884 TTGCAATTTTGGGGGGAGGGCGG - Intergenic
1149526041 17:57356516-57356538 TTTTCGTCTTTGGGGGAGGGGGG - Intronic
1150354292 17:64469959-64469981 TGGTGGTTCCTGGGGGATGGGGG + Intergenic
1150461037 17:65352213-65352235 TTCTACTTTGTGGGGGAGGGAGG - Intergenic
1151148579 17:72064380-72064402 TTGGCGTTTTTGTGGGAGGGGGG + Intergenic
1151555780 17:74846062-74846084 TTGCAGTTCCTGGGGGACGGTGG - Exonic
1152284586 17:79404708-79404730 GGATGGTTCTTGGGGGAGGGAGG - Intronic
1152343575 17:79738316-79738338 TTCTGGCTTTTGGGGGAGGGTGG - Intronic
1153177434 18:2394059-2394081 TTGTTGTTCTTGGTCAAGGGAGG - Intergenic
1153607689 18:6851132-6851154 TTATAGTTGTGGGGGGATGGTGG + Intronic
1154132808 18:11751224-11751246 GTGTTGTACTTGGGGGAAGGAGG - Intronic
1156024537 18:32636815-32636837 CTTAGGTTCTTGGGGGAGGGAGG + Intergenic
1156256520 18:35402802-35402824 TTGTAGTTTTTGTGGGGTGGGGG - Intergenic
1157459134 18:47870426-47870448 TTAGAGATCTTGTGGGAGGGGGG - Intronic
1158225457 18:55196670-55196692 TTGTTTTTCTTGGGAGAGGTGGG + Intergenic
1159383318 18:67690760-67690782 TTAGAGTTGTTGGGGGTGGGGGG - Intergenic
1160032556 18:75275423-75275445 TTGTAGTTCTTGGTGATGGCTGG + Intronic
1160058196 18:75506116-75506138 TTGTAGGGCTTGGGGGTGTGGGG + Intergenic
1160659043 19:289955-289977 TTGGAGTTGCTGGGGCAGGGAGG - Intronic
1163188697 19:15659206-15659228 ATGCAGTTCCTTGGGGAGGGAGG - Exonic
1163216094 19:15878928-15878950 ATGCAGTTCCTAGGGGAGGGAGG + Exonic
1164883905 19:31760693-31760715 GTGTATTCCTTGGGGTAGGGGGG + Intergenic
1165170597 19:33889171-33889193 TTTTGGTTCTTGGCGGAGGGTGG + Intergenic
1166297894 19:41897596-41897618 TGGGGGGTCTTGGGGGAGGGGGG - Intronic
1166399352 19:42466680-42466702 TTGTTCCTTTTGGGGGAGGGAGG - Intergenic
1166976314 19:46607139-46607161 TTGTTGTTCTTGGGGAGGGCAGG - Intronic
925054172 2:843290-843312 TCGTAGTTCCTGGGGGACTGGGG - Intergenic
926422176 2:12710721-12710743 TTGTTGTTCTTAGAGTAGGGTGG - Intergenic
926582748 2:14649187-14649209 GTGTAGGGGTTGGGGGAGGGGGG + Intronic
927786216 2:25977035-25977057 ATGTAGTGTCTGGGGGAGGGAGG - Intronic
930623065 2:53664849-53664871 TTGTATTTCTTTGGGATGGGAGG - Intronic
930892430 2:56406450-56406472 GTGCAGTTCTTGGCAGAGGGAGG + Intergenic
931148078 2:59541917-59541939 ATGGAGTACTTGGGGGAGAGGGG - Intergenic
931359002 2:61562307-61562329 TTGTGGCACTTGGGGTAGGGTGG + Intergenic
931371199 2:61664738-61664760 TTGTATTTCTTAGGGATGGGGGG + Intergenic
931653749 2:64491289-64491311 TTCTAGTGGTGGGGGGAGGGGGG + Intergenic
932087773 2:68776849-68776871 GTGTAGATATTGGGGGTGGGTGG + Intronic
933032884 2:77354418-77354440 TTGTATTTATTGGGTGGGGGTGG + Intronic
933176753 2:79182826-79182848 TTGTATTGCTTGGGCGTGGGAGG + Intergenic
934789198 2:97044056-97044078 TTGTATTTTTTGGGGTAGGCAGG - Intergenic
934817281 2:97338485-97338507 TTGTATTTTTTGGGGTAGGCAGG + Intergenic
934820415 2:97369999-97370021 TTGTATTTTTTGGGGTAGGCAGG - Intergenic
935098173 2:99967289-99967311 TTAAAGTGCTTGGGGGCGGGGGG - Intronic
936032864 2:109086259-109086281 CTGAGGTTGTTGGGGGAGGGGGG + Intergenic
940344144 2:152612114-152612136 TTTTAGTTCTTAGGAGAAGGAGG + Intronic
941763246 2:169267928-169267950 TTGTATTTCTTTGGGATGGGTGG - Intronic
941914229 2:170798675-170798697 ATGTATTTCTTGGTAGAGGGAGG + Intronic
941978952 2:171434213-171434235 TTGTAGTTCCTGGGAGAAGCCGG + Intronic
942569357 2:177297638-177297660 TTCTTTTTTTTGGGGGAGGGGGG + Intronic
945146834 2:206747365-206747387 ATGCAGTACTTGGGGGAGGAGGG - Intronic
945700257 2:213160707-213160729 ATGTAGCTCTTGGGGAAGAGAGG + Intergenic
946110682 2:217412654-217412676 TTGTTGGTCCTGGGGGTGGGTGG + Intronic
946540748 2:220681920-220681942 TTGTTGTTGTTGTTGGAGGGTGG + Intergenic
1168880378 20:1201435-1201457 CTGAAGTTCTTGGGGGAAGGGGG + Intergenic
1169107379 20:3008459-3008481 TAGTGGTTGCTGGGGGAGGGAGG + Intronic
1169331085 20:4717099-4717121 TGTTCGTTCTCGGGGGAGGGGGG - Intergenic
1170516011 20:17131033-17131055 TCTTACTTCTTGTGGGAGGGAGG - Intergenic
1172664901 20:36592335-36592357 TTGTAGTTTTTTTGGGTGGGTGG + Exonic
1172708588 20:36902132-36902154 TTGGAGTTCTGAGAGGAGGGAGG + Intronic
1173952325 20:47003119-47003141 TTGTGGTGTCTGGGGGAGGGTGG + Intronic
1174389626 20:50210122-50210144 TTGTAGATATTGGAGTAGGGAGG + Intergenic
1174894356 20:54433173-54433195 TGGTAGTTGTTGGGGGAGGAGGG - Intergenic
1175496222 20:59416234-59416256 TAGGAGTTCAAGGGGGAGGGAGG - Intergenic
1176253817 20:64140091-64140113 TTGTTTTCCTTGGTGGAGGGAGG + Intergenic
1176545797 21:8197729-8197751 TTGTAGTTTTTGAGGCAGGTTGG + Intergenic
1176564748 21:8380774-8380796 TTGTAGTTTTTGAGGCAGGTTGG + Intergenic
1177882165 21:26707229-26707251 TAATGGGTCTTGGGGGAGGGAGG - Intergenic
1180856945 22:19053427-19053449 TTGTTGTTCTGGGTGGAGGCTGG - Intronic
1182180879 22:28347089-28347111 TTGTATTTTTTGGGGGAGATGGG - Intronic
1182629289 22:31672485-31672507 TTGTATTTTTTGGTGGAGAGAGG + Intergenic
1184093398 22:42304027-42304049 TTGATGTTCTTGCGGCAGGGGGG - Intronic
1185342527 22:50298073-50298095 TTGGACTTGTTGGGGCAGGGCGG - Intronic
1203250668 22_KI270733v1_random:113966-113988 TTGTAGTTTTTGAGGCAGGTTGG + Intergenic
950898394 3:16474447-16474469 TTGTTTATCTTGGGGGAGGAGGG - Intronic
951509265 3:23483807-23483829 TTTTTGTTGTTGGGGCAGGGTGG + Intronic
951977088 3:28523474-28523496 GTGTTGTTTTTAGGGGAGGGTGG + Intronic
952971238 3:38651497-38651519 TGGAAGTTCTTAGGGGAGGTAGG - Intergenic
953253644 3:41268300-41268322 TTGTAGTCCAGTGGGGAGGGTGG - Intronic
953903936 3:46858785-46858807 TTGGGGATCTTGGGAGAGGGTGG + Intronic
954358341 3:50102170-50102192 TTCTTTTTCTTGGGGGTGGGAGG - Intronic
954578887 3:51692330-51692352 TTGTTCTGCTTGGGGGAGAGGGG - Intronic
954618100 3:51980581-51980603 GTGTAGTTCTGGGTGGAGGTGGG - Exonic
954672254 3:52297397-52297419 TTGTAGTGGCTGGAGGAGGGTGG + Intergenic
954719365 3:52547984-52548006 TTTTAGTTACTGGGGGTGGGGGG - Exonic
955767482 3:62360033-62360055 TTGGAGCTCTGGGGGAAGGGAGG + Intergenic
955983241 3:64548010-64548032 TTACGGTTCTTGGGTGAGGGTGG + Intronic
956870132 3:73408572-73408594 TTGGGATTCTTGGAGGAGGGGGG + Intronic
957955833 3:87185703-87185725 TTGTAGTCCTGGGTGAAGGGGGG - Intergenic
958501514 3:94915746-94915768 TTGTTGTTGTTGGGGGAGACAGG + Intergenic
960117161 3:113907208-113907230 TGGAAGTTCTTGGGGGAGGGTGG - Intronic
960433187 3:117594973-117594995 GTATAGTTCTTAAGGGAGGGTGG + Intergenic
960502189 3:118451386-118451408 TTGTAGTTCTGTGGGGTGAGTGG + Intergenic
962445696 3:135462203-135462225 TAATAGTTCTTGGAGGAGGGTGG + Intergenic
962973346 3:140425165-140425187 TGGGAGTGCTTGGGGGAGGTGGG - Intronic
963579562 3:147108478-147108500 TTGTTGTGGGTGGGGGAGGGGGG - Intergenic
965335097 3:167424769-167424791 TTGAAGTTCTTGTGTGATGGAGG - Intergenic
965665942 3:171093716-171093738 GGGGAATTCTTGGGGGAGGGAGG - Intronic
965733073 3:171792761-171792783 TTGCAAATCTGGGGGGAGGGTGG - Intronic
966535777 3:181032394-181032416 TTGTCTTTTTTGGGGGAGTGGGG + Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967732479 3:192918521-192918543 TTGGAGTTCTTGGGATAGAGAGG - Intergenic
968864911 4:3202570-3202592 TTGATGTGGTTGGGGGAGGGGGG - Intronic
970001639 4:11370935-11370957 CTTTAGTTCTTGGGGGGGTGGGG + Intergenic
971949628 4:33327949-33327971 TTGTAGGTGTTTGGTGAGGGTGG - Intergenic
972234579 4:37116055-37116077 TCGTAATTCTAGGGGGAGGGCGG + Intergenic
972945176 4:44244838-44244860 CTGTAGTTGTGGGGGGGGGGGGG + Intronic
973212586 4:47632951-47632973 TTGTACTTTTTGGTGGAGGTGGG + Intronic
973781105 4:54288938-54288960 CTGTGGGTCTAGGGGGAGGGAGG + Intronic
973901790 4:55482247-55482269 TTGAAATTTTTGGAGGAGGGTGG - Intronic
974077883 4:57184370-57184392 TTCTACCTCTTGGGGGATGGGGG + Intergenic
974156558 4:58081116-58081138 TTCTAGTTCTTGGAAGAGTGTGG + Intergenic
975796045 4:78007710-78007732 TTGTATTTTTTGGTGGAGAGGGG - Intergenic
976583414 4:86767102-86767124 TTGTAGAGATTGGGGGCGGGGGG + Intronic
977135885 4:93303448-93303470 TTGTCATTCTTGGGGTAGGATGG + Intronic
977272603 4:94936494-94936516 TTGTTGTTGTTGGGGGTGAGGGG + Intronic
977398726 4:96504172-96504194 TTGTATTTAGTGGGGGATGGAGG - Intergenic
978619294 4:110622788-110622810 GAGGGGTTCTTGGGGGAGGGAGG - Exonic
980254846 4:130365889-130365911 TTGTTGTTCTAGGGGTTGGGGGG - Intergenic
980455276 4:133032236-133032258 TTGTTGTTGTGGGGGGCGGGGGG + Intergenic
982438804 4:155409658-155409680 TTGTATTTCTTAGTGGAGAGGGG + Intergenic
984658615 4:182348192-182348214 TTTCAGTTCTTGGTGGAGGCTGG + Intronic
986845982 5:11753995-11754017 TTGTATTTCTTGGGGGTCAGTGG + Intronic
987565523 5:19579896-19579918 TTATATTTCTTTGGGGGGGGTGG - Intronic
990221243 5:53591451-53591473 TTGTTTTTTTTGGGGGGGGGGGG + Intronic
990525815 5:56626368-56626390 CTGTTGTTGATGGGGGAGGGTGG - Intergenic
992171450 5:74105818-74105840 TTGAGGTGGTTGGGGGAGGGGGG - Intergenic
992269102 5:75047776-75047798 TTTTAGAGCTTGGGGGAGGTAGG + Intergenic
992454362 5:76902688-76902710 TTGCTGTCCTTGGGGGAGGCAGG + Intronic
995137557 5:108696367-108696389 GTATGGTTCATGGGGGAGGGAGG - Intergenic
997164093 5:131640086-131640108 TTGTATTTTTGGGGGGGGGGCGG + Intronic
1001519974 5:172384522-172384544 TGGTGGTTGCTGGGGGAGGGTGG - Intronic
1002032513 5:176441024-176441046 ATGCTGTTCTTGTGGGAGGGAGG - Intergenic
1003342363 6:5233997-5234019 TTGTAGTTGTTGGGGAGGAGGGG - Intronic
1003834777 6:10059095-10059117 TTTTAGGTAGTGGGGGAGGGTGG - Intronic
1004373643 6:15073846-15073868 TTGGAATTATTGGGGGACGGGGG + Intergenic
1005512632 6:26525135-26525157 CTGTAATGCTTGGGGGCGGGGGG - Intergenic
1007027781 6:38595681-38595703 TGCTAGGTCCTGGGGGAGGGTGG - Intronic
1007705823 6:43790571-43790593 TTTCAGTTCTTGTGGGAGGGAGG - Intergenic
1007726230 6:43917433-43917455 TTATAGTCCCTGGGGGAAGGAGG + Intergenic
1008434165 6:51455775-51455797 TTATGGTTCTTGGGGGATAGAGG + Intergenic
1008709110 6:54201667-54201689 TTGTAGATTTTGGGGCATGGAGG + Intronic
1010119332 6:72355814-72355836 TTGTTATTGTTGGGGGAGGAAGG - Intronic
1010331661 6:74630134-74630156 TTCTAGGTGTTTGGGGAGGGAGG - Intergenic
1011259768 6:85458813-85458835 TTCTACTTGTTTGGGGAGGGGGG - Intronic
1012076981 6:94701078-94701100 TTTAACTTATTGGGGGAGGGAGG - Intergenic
1012549994 6:100457320-100457342 TTGTAGGCAATGGGGGAGGGTGG + Intronic
1015214206 6:130731438-130731460 TTGAAATACTTGGGGCAGGGTGG + Intergenic
1015706928 6:136098123-136098145 CTTTAGTTCCTGGGGGGGGGGGG + Intronic
1017670878 6:156768529-156768551 TTGTATTTTTTGGTGGGGGGCGG + Intergenic
1018003180 6:159597501-159597523 ATGGAGTTCCTGGGGCAGGGAGG - Intergenic
1018634449 6:165848593-165848615 TGAAAGTTGTTGGGGGAGGGTGG + Intronic
1019705690 7:2496161-2496183 TTGTGTGTGTTGGGGGAGGGGGG + Intergenic
1020358597 7:7303639-7303661 TTGTTGCTATTGGGGGTGGGGGG - Intergenic
1021055897 7:16045787-16045809 TTTTGGTTTTTGGGGGAAGGTGG - Intergenic
1023517998 7:41021615-41021637 CTCTAGTTCTTGGGGGTGGGGGG - Intergenic
1023931827 7:44711017-44711039 CAGTAGTACTTGGGTGAGGGGGG - Intergenic
1023945637 7:44800781-44800803 TGTTTGTTTTTGGGGGAGGGGGG + Intronic
1024294797 7:47833434-47833456 TTGTACCCCTTGGGGGACGGTGG + Intronic
1024343420 7:48289530-48289552 TTGTATTTCTTGGTAGAGGTGGG + Intronic
1027593512 7:80143331-80143353 TTGTTGATCTTGGGGGGTGGAGG + Intronic
1027814905 7:82955964-82955986 TTGTAGTTACTGGAGGAGGAGGG - Exonic
1028757323 7:94452679-94452701 GAGAAGTTCCTGGGGGAGGGGGG - Intergenic
1028774639 7:94663485-94663507 TTGTTGTTGTTGGGGGGAGGGGG - Exonic
1029036449 7:97527385-97527407 ATGAATTTGTTGGGGGAGGGAGG - Intergenic
1029996859 7:105014589-105014611 TTGTGTTTCAAGGGGGAGGGAGG + Intronic
1030702712 7:112659060-112659082 TTGTATTTCTGTGGGGTGGGTGG + Intergenic
1030893132 7:115025242-115025264 TTGTGGTCGTGGGGGGAGGGGGG - Intergenic
1031133603 7:117861627-117861649 TGGTACATCTTGGGGGAGTGGGG + Intronic
1031455272 7:121971453-121971475 TTGTTTTTCTTAGGGGAGAGTGG + Intronic
1033299134 7:140171054-140171076 TTGTTGTTGTTGGGGGATGGGGG - Intronic
1033437795 7:141349758-141349780 TTTTAATTCTTGGGTGAGGTAGG + Intronic
1033653072 7:143356467-143356489 CTGTACTGCTGGGGGGAGGGAGG + Exonic
1033908409 7:146235255-146235277 TGGTGGGTTTTGGGGGAGGGTGG + Intronic
1035520153 8:269359-269381 CTTTTTTTCTTGGGGGAGGGTGG - Intergenic
1035886571 8:3297723-3297745 TTGTATAGCTTTGGGGAGGGAGG + Intronic
1036484694 8:9169031-9169053 TTGAAGTTCTTGGGGAATGTCGG - Intergenic
1036677251 8:10844845-10844867 TTGTAGACATTGGGGGAGGCAGG + Intergenic
1037506216 8:19532283-19532305 TTGTTGTTTTGGGAGGAGGGTGG - Intronic
1037730895 8:21523304-21523326 CTGAACTTCTTGGGGGTGGGGGG + Intergenic
1038153896 8:24968869-24968891 TTGTATTTTTTGGTGGAGGTGGG - Intergenic
1039154523 8:34540422-34540444 TTGCACTTCCTGGGTGAGGGAGG - Intergenic
1039438511 8:37578388-37578410 GTGTGGTTTTTGGGGGTGGGGGG - Intergenic
1039932422 8:42005924-42005946 TTTCAGTTCTTGGGGGAAGAAGG + Intronic
1042426009 8:68649689-68649711 TTGTGATTCATAGGGGAGGGAGG + Intronic
1042522216 8:69725608-69725630 TTGTAAGTCGTGGGGGATGGTGG + Intronic
1045583210 8:103500726-103500748 CTGCTTTTCTTGGGGGAGGGGGG + Intronic
1045662546 8:104453038-104453060 TGGAAGCTGTTGGGGGAGGGTGG - Intronic
1048615846 8:136074807-136074829 TTTTATTTCATGGGGGAGGGAGG + Intergenic
1049831575 8:144704539-144704561 GGGTAGTGATTGGGGGAGGGAGG + Intergenic
1050650862 9:7775258-7775280 TTGTTGTTTTTGGGGAAGGGGGG - Intergenic
1051103112 9:13545550-13545572 TTGTTGTTGCAGGGGGAGGGTGG + Intergenic
1051730750 9:20140245-20140267 TTGTCTTTTGTGGGGGAGGGAGG + Intergenic
1051867082 9:21695337-21695359 TTGAAGTCCTTGGGGGACGATGG - Intergenic
1051949117 9:22609429-22609451 TTGCTGTTGTTGGGGCAGGGTGG + Intergenic
1052168252 9:25359920-25359942 TTGTAGATTTTCGGGGAAGGAGG + Intergenic
1052234614 9:26195021-26195043 TTGTAGGGGTTGTGGGAGGGAGG - Intergenic
1052698593 9:31910358-31910380 TTGTATTTCTTGGGAGAGGAGGG + Intergenic
1052850410 9:33374959-33374981 TTGGAGTTCCTGGGGCAGAGTGG + Intergenic
1054726872 9:68661250-68661272 TTGTAGTTTTTGGTAGAGGCAGG + Intergenic
1056408041 9:86295345-86295367 TGTAATTTCTTGGGGGAGGGGGG - Intronic
1057666001 9:97045983-97046005 TTGTTGTTGTTTGGGGAGGGTGG - Intergenic
1059735483 9:117095649-117095671 TTGTAGTTCTTAGAAGAGGCTGG - Intronic
1060447494 9:123704616-123704638 TTGTAGGAATTGGGGGAGTGGGG - Intronic
1060736401 9:126069107-126069129 CTGTTGTCCTTCGGGGAGGGAGG - Intergenic
1061230619 9:129313689-129313711 TCTTTGATCTTGGGGGAGGGAGG + Intergenic
1061393924 9:130333015-130333037 TGGAAGGTCTGGGGGGAGGGAGG + Intronic
1061643565 9:131980068-131980090 TGTTATTTCTTGGGGGATGGGGG + Intronic
1061649347 9:132034407-132034429 TTGTAGTTCTTGGAGACGTGAGG - Intronic
1061713285 9:132502267-132502289 TTTTTTTTTTTGGGGGAGGGGGG + Intronic
1203467069 Un_GL000220v1:97238-97260 TTGTAGTTTTTGAGGCAGGTTGG + Intergenic
1186882371 X:13879184-13879206 ATCTACTTGTTGGGGGAGGGAGG - Intronic
1188051891 X:25497802-25497824 TAGTAATTCTTGGGGGAATGTGG + Intergenic
1188648830 X:32604470-32604492 TTGTAGTTCTTGGGGGAGGGGGG - Intronic
1189220042 X:39363727-39363749 GTGTACTTGATGGGGGAGGGTGG + Intergenic
1190279494 X:48919720-48919742 GGGTGGTTCTTGGGGGATGGGGG + Intergenic
1190322675 X:49187855-49187877 TTGTTCTTCCTTGGGGAGGGGGG + Exonic
1191628744 X:63298678-63298700 GTGTATTATTTGGGGGAGGGAGG - Intergenic
1191671450 X:63752194-63752216 TTGAAGTTGTGGGGGGTGGGGGG - Intronic
1192086015 X:68098106-68098128 TTGTAGATGTAGGGAGAGGGGGG - Intronic
1192477228 X:71453388-71453410 TTGTAGAGATTGGGGGTGGGGGG - Intronic
1193224741 X:78969162-78969184 TTGCATTCCTTGGGGGAGGGGGG - Intergenic
1193719182 X:84968190-84968212 TTGTATTTCTTCGGGGTCGGTGG + Intergenic
1196303247 X:114070482-114070504 TTCTACTTGATGGGGGAGGGTGG - Intergenic
1197279063 X:124513975-124513997 TTCTAGGACTTGGGGGAGGGAGG + Intronic
1197743522 X:129914582-129914604 TTCTTTTTTTTGGGGGAGGGCGG - Intronic
1198201795 X:134428284-134428306 TCTTTGTTCCTGGGGGAGGGGGG + Exonic
1198211644 X:134521842-134521864 TAGTGTTTCTTGGGGGAGGTAGG + Intergenic
1198616413 X:138463149-138463171 TTGGTGTTGTTGGGGGATGGGGG + Intergenic
1200958324 Y:8972869-8972891 GTGTTGTTCTTGTGGGTGGGTGG + Intergenic
1201572736 Y:15431905-15431927 TTGTGGGAGTTGGGGGAGGGGGG + Intergenic