ID: 1188649713

View in Genome Browser
Species Human (GRCh38)
Location X:32617058-32617080
Sequence CTGAATCCACAGACAGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 491
Summary {0: 1, 1: 0, 2: 5, 3: 64, 4: 421}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188649711_1188649713 6 Left 1188649711 X:32617029-32617051 CCGCTGTTCATGTTTGGCTCCTC 0: 1
1: 0
2: 2
3: 14
4: 209
Right 1188649713 X:32617058-32617080 CTGAATCCACAGACAGAGAAAGG 0: 1
1: 0
2: 5
3: 64
4: 421

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188649713 Original CRISPR CTGAATCCACAGACAGAGAA AGG Intronic
901152488 1:7113192-7113214 CAGAAGCCACAGACAGAGGCTGG + Intronic
901454909 1:9357708-9357730 CTGCATTCACAGTCTGAGAAAGG - Intronic
902173736 1:14633729-14633751 CTGAATCCTCAGAGAGAGGATGG - Intronic
905197952 1:36295783-36295805 CTGAGTCCAAAGAGAGACAATGG - Intronic
905270180 1:36782450-36782472 CTGAGTGCTCAGAAAGAGAAGGG + Intergenic
905388751 1:37622905-37622927 CAGAGATCACAGACAGAGAAGGG + Intronic
905442545 1:38004680-38004702 TTGGATGCAGAGACAGAGAAAGG - Intronic
906153885 1:43602967-43602989 ATGCATGCACAGACAGAGCAAGG - Intronic
906511544 1:46412963-46412985 CTGTGTCTACAGCCAGAGAAAGG - Intronic
906693305 1:47807208-47807230 CTGAGTCAACAGGCAAAGAAGGG + Intronic
908851246 1:68378570-68378592 CAGAAACCAAAGACAGAGCAGGG + Intergenic
909040399 1:70642727-70642749 GTGAATCCACAAACAGAAAATGG + Intergenic
909278921 1:73723797-73723819 CAGAATCAACATGCAGAGAAGGG + Intergenic
909437424 1:75658950-75658972 CTGATACCACAGACATATAAAGG + Intergenic
909450380 1:75791748-75791770 ACGAATCCACCGACAGAGAAAGG - Intronic
909459653 1:75895167-75895189 CTGAATCAACAGGCAAAGAAGGG + Intronic
910141742 1:84033739-84033761 CTGAATCAACAAGCAAAGAAGGG + Intergenic
910318195 1:85913611-85913633 CTGAATCAACAGCCAAAGAAGGG + Intronic
911091869 1:94023585-94023607 CTGAATACACATGCAGAGAAAGG + Intronic
913551597 1:119922071-119922093 CTGAAACCACAGTCAGAGCGTGG - Intronic
916015331 1:160744345-160744367 CTGAACCCACATTCCGAGAATGG + Intronic
916017108 1:160759945-160759967 CTGAATCAACAGGCAAAGAAGGG - Intergenic
916448323 1:164894570-164894592 CTGATACCCCAGACAGAGATGGG - Intronic
916611824 1:166398863-166398885 CTGAGTCCCCACACAGAGACAGG - Intergenic
917496526 1:175545476-175545498 TTGAAACCACAGACTGAGGAGGG + Intronic
917501699 1:175591527-175591549 CTTAACCCACAGCCTGAGAAGGG + Intronic
917742461 1:177974301-177974323 TTGAAGCCACAGACACAGACAGG + Intronic
917829867 1:178870740-178870762 CTGAATCAACAGACACAAAAAGG - Exonic
918270905 1:182898331-182898353 CTGAAGCCAAAAACTGAGAAAGG + Intergenic
919487053 1:198157926-198157948 CTGAGGCCAAAGTCAGAGAAGGG + Intronic
919793953 1:201309996-201310018 CTCACCCCACAGACATAGAATGG - Intronic
919794429 1:201312689-201312711 CTCACCCCACAGACACAGAACGG - Intronic
919838322 1:201591800-201591822 CTGAATCGTGAGACAGGGAAAGG + Intergenic
920560613 1:206935819-206935841 CTGGAAGCACAGACAGAGATGGG + Intronic
920591909 1:207228309-207228331 CTGAAACCAGAGACAGAAAATGG + Intergenic
920803328 1:209209476-209209498 CTGAATTCACATTCAGAAAATGG - Intergenic
921207680 1:212862368-212862390 GTCAATCCACAGAAAGAGAAGGG - Intronic
922863853 1:228842211-228842233 CTGAAGACAGTGACAGAGAAAGG + Intergenic
924278364 1:242410861-242410883 CACTACCCACAGACAGAGAATGG + Intronic
924444066 1:244112295-244112317 CTGAAGCCACAGTGAGAAAACGG + Intergenic
1064824780 10:19385555-19385577 CTGATTCCATAGACACATAAAGG - Intronic
1065858587 10:29851067-29851089 ATGAATCCACTGAGAGATAATGG + Intergenic
1066393809 10:34999818-34999840 CTGAATCAACAGGCAAAGAAGGG + Intergenic
1066739058 10:38504137-38504159 CTGGATCCAAAGACATGGAATGG + Intergenic
1067165865 10:43866073-43866095 GTGACTCCACAGACACGGAAAGG - Intergenic
1067436095 10:46279417-46279439 ATGAACCCACAGAAAGTGAAAGG - Intergenic
1067657690 10:48209376-48209398 GTGAATCTACAGACAGACTATGG + Intronic
1067666352 10:48282914-48282936 CTGAATCAACAGGCAAAGATGGG - Intergenic
1068457356 10:57273936-57273958 CTGAAACCACAGAAATACAAAGG + Intergenic
1068489645 10:57706967-57706989 CAGAGCCAACAGACAGAGAAGGG + Intergenic
1068856865 10:61806577-61806599 CTGAATCAACAGGGAAAGAAGGG + Intergenic
1069139134 10:64802183-64802205 CTGAATCAACAGGTAAAGAAGGG - Intergenic
1070172360 10:73942233-73942255 CTGAATCCACAGCCATGGCAAGG - Intergenic
1070803244 10:79255630-79255652 CAGAATGCAGAGACAGAGATAGG - Intronic
1070854671 10:79597442-79597464 CTGATACCACAGAAAGACAAAGG + Intergenic
1071344687 10:84681848-84681870 CAAAGTCCAGAGACAGAGAAGGG - Intergenic
1072833247 10:98682210-98682232 CAGAAACAAGAGACAGAGAAGGG - Intronic
1073936470 10:108638539-108638561 TAGAAACCACTGACAGAGAATGG - Intergenic
1074335799 10:112573621-112573643 CTAAAGCCATAGACAGTGAATGG - Intronic
1075177549 10:120179760-120179782 GTGAGTCCACAGAAAGAGCAAGG + Intergenic
1075855548 10:125626460-125626482 ATGAATGCACAGACAAAGAAAGG - Intronic
1075966277 10:126614515-126614537 CTCAATCCACAGGCAGGGGAAGG - Intronic
1076197803 10:128532696-128532718 GTGGATCCACAAACAGAGGAGGG + Intergenic
1076271540 10:129156502-129156524 CTAAATCAACAGGCAAAGAAGGG + Intergenic
1077063627 11:628134-628156 CTGAATCCACAGACAGAAAGTGG - Intergenic
1078586307 11:12593024-12593046 CTGAATCGATAGGCAGATAATGG + Intergenic
1079120470 11:17680485-17680507 CTGAAGGCACAGACTGAGATTGG - Intergenic
1079326555 11:19497720-19497742 CTAAAGCCACAGACAGAAAATGG + Intronic
1080799802 11:35599649-35599671 CAGAACCCACAGATAGAGAGGGG - Intergenic
1081521251 11:43883342-43883364 AAGAATCCCCAGACATAGAAAGG - Intronic
1081532857 11:43975553-43975575 CAGAAGCCCAAGACAGAGAAGGG + Intergenic
1081780093 11:45704371-45704393 CTGACTCCACAGTCAGATACAGG + Intergenic
1084665609 11:70574616-70574638 CTGCATGCAGAGTCAGAGAAGGG - Intronic
1084861301 11:72020070-72020092 CGGAAACCACGGAAAGAGAAGGG - Intronic
1084875854 11:72132718-72132740 CTGAATCCTGGGCCAGAGAAAGG + Intronic
1085466293 11:76725855-76725877 CTGAATCAACGGACAGAGAAGGG - Intergenic
1086602909 11:88657348-88657370 CTGATTCCACAGCCAAAGAAAGG - Intronic
1086829695 11:91544668-91544690 CTGAAACCAAAGCCAGATAAGGG + Intergenic
1086867304 11:91995701-91995723 CGTCATCCACAGAAAGAGAAAGG + Intergenic
1086964316 11:93011867-93011889 CAGAATCCACAGAGAGGGAGAGG - Intergenic
1086990006 11:93292378-93292400 CTGAATCAACTGGCAAAGAAGGG + Intergenic
1087116631 11:94532299-94532321 CTAAATCCAGATACAGATAATGG + Intergenic
1087714277 11:101590283-101590305 CTGATTCCAAAGCCAGACAAAGG + Intronic
1089151790 11:116370022-116370044 CTGAAACCAAAAACAGACAACGG + Intergenic
1089659873 11:119978823-119978845 CTGAGCCGGCAGACAGAGAAGGG + Intergenic
1091215637 11:133899699-133899721 CAGAGTCCACAGAAAGAGAGGGG + Intergenic
1091336799 11:134776319-134776341 CTGATTCCACAGCTAGATAAGGG + Intergenic
1091401792 12:185646-185668 ATGATGCCACAGACAGAGAGGGG - Intergenic
1092272607 12:7035354-7035376 CTGAATCAACAGGCAAAGAAGGG + Intronic
1092514267 12:9192199-9192221 CTGACTCCACAGGCAGAGTGTGG + Exonic
1092754854 12:11753665-11753687 CTGAATTACCAGAGAGAGAAAGG - Intronic
1094019127 12:25895634-25895656 CAGAATGAACAGAGAGAGAAGGG + Intergenic
1094086168 12:26594366-26594388 CTGAGTCTACAGGCAGTGAAAGG + Intronic
1094734169 12:33214934-33214956 CTGAAACCACAGAAGTAGAAAGG + Intergenic
1095190461 12:39251802-39251824 CCAAATCAACAGACAAAGAAAGG + Intergenic
1095194195 12:39293842-39293864 CTTAATCTACTAACAGAGAAGGG - Intronic
1095535273 12:43238557-43238579 CTGAATACACAAACAGATAATGG - Intergenic
1095656132 12:44671590-44671612 CTGATACCACAGAAATAGAAAGG + Intronic
1096735238 12:53648130-53648152 CTGAATCAACAGCCAAAGAAGGG + Intronic
1096874374 12:54615714-54615736 CAGAGTCCACAGTCAGAGGATGG + Intergenic
1097314211 12:58154831-58154853 CTGAAATAACAAACAGAGAAAGG - Intergenic
1098158584 12:67625216-67625238 CTGAATCAACAGACCAAGAAGGG + Intergenic
1098664159 12:73139418-73139440 AGGACTTCACAGACAGAGAAAGG + Intergenic
1098938001 12:76502433-76502455 CTGAATCAGCAGGCAAAGAAGGG + Intronic
1098992569 12:77080117-77080139 CTGAATATACAGACAAAAAAAGG - Intergenic
1099479403 12:83147503-83147525 CTGAATCAACAGACAAACAAGGG - Intergenic
1099613266 12:84903651-84903673 CTGACTACAGAAACAGAGAATGG - Intronic
1099996162 12:89781356-89781378 CTCTATACACAGACTGAGAAGGG - Intergenic
1100139553 12:91600339-91600361 CTGGCTTCAAAGACAGAGAAAGG - Intergenic
1101190936 12:102331625-102331647 CTGAATCAGCAGAAAAAGAAGGG + Intergenic
1101526115 12:105532679-105532701 GTGAACCTTCAGACAGAGAAAGG - Intergenic
1102016442 12:109650997-109651019 CCGAAGCCACAGACAGGGGAGGG - Intergenic
1103141218 12:118550013-118550035 CTCCACCCACAGACAGAAAAAGG - Intergenic
1104308325 12:127630739-127630761 ATGCTTACACAGACAGAGAAGGG - Intergenic
1104577695 12:129982893-129982915 CTGAATCCCCAAACCTAGAAAGG + Intergenic
1104947688 12:132423919-132423941 CTGGATCCACAGAGAGAACATGG + Intergenic
1105042987 12:132976478-132976500 CTGATACCACAGACATACAAAGG + Intergenic
1105253764 13:18725725-18725747 CTGAATCCATGGAGAGAAAAAGG - Intergenic
1105321463 13:19326740-19326762 CTGATACCACAGAAATAGAAAGG + Intergenic
1105706562 13:22971099-22971121 CTGCATCCACAGCCAGGGAGAGG - Intergenic
1109020839 13:57090431-57090453 CTGAGTCCATAGATAGAGAAGGG - Intergenic
1109069658 13:57748266-57748288 CTGAGTCAACAGACAAAGAAAGG + Intergenic
1110871151 13:80453492-80453514 CTGATACCACAGAAATAGAAAGG + Intergenic
1111010627 13:82309759-82309781 CTGAATCAACAGAAATACAAAGG - Intergenic
1111391176 13:87596798-87596820 CTGAATCAACAGGCAAATAAAGG + Intergenic
1111748568 13:92298280-92298302 CAGAATCCACAGTCAGGGGAAGG - Intronic
1112630151 13:101152129-101152151 CTGAAGCCACAGATAGAAATTGG + Intronic
1115873469 14:37833756-37833778 CTGAAACAACAGACACACAAAGG - Intronic
1115905517 14:38199020-38199042 CAGGAACCAAAGACAGAGAAAGG - Intergenic
1116082545 14:40193377-40193399 CTGATGCCACAGAAATAGAAGGG + Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116226570 14:42161159-42161181 CTGAATCAACAGACAAATAAAGG - Intergenic
1116531239 14:45976570-45976592 CTAAGTCAACAGACAAAGAATGG - Intergenic
1116632891 14:47356632-47356654 CACAACCCACAGACAGGGAAGGG - Intronic
1116917989 14:50543971-50543993 CTAAATCAACAGTTAGAGAAGGG + Intronic
1116981200 14:51172585-51172607 GTGAATTCACAGAGATAGAAAGG - Intergenic
1117654916 14:57945231-57945253 ATGCATCCACAAACAGACAATGG + Intronic
1118022188 14:61729049-61729071 CTGATTCCAAAGACAGAGTTAGG - Intronic
1119566242 14:75631551-75631573 CAGAATCCACAGAAAAAGAAAGG - Intronic
1119946027 14:78695370-78695392 TTGAATCTACAAAAAGAGAAAGG - Intronic
1120038672 14:79727861-79727883 CTCAATCTAGAGACTGAGAAGGG - Intronic
1122391592 14:101391823-101391845 CTAAAATCACAGAAAGAGAAGGG - Intergenic
1122622356 14:103066664-103066686 CTGAACCAACAGGCAGAGAAGGG + Intergenic
1122754062 14:103963587-103963609 ATTAATCAACAGGCAGAGAAAGG - Intronic
1122809775 14:104282162-104282184 CTCATTCCCCAGACACAGAATGG - Intergenic
1123037481 14:105477379-105477401 AGGAATCCACAGACAGATGAGGG + Intronic
1123846801 15:24311518-24311540 CTCACTTCACAGACAAAGAAGGG - Intergenic
1124645965 15:31437719-31437741 CAGAACCCACATGCAGAGAATGG + Intergenic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1124821502 15:33050901-33050923 CTGTATGCACTGACATAGAAAGG + Intronic
1125008560 15:34845347-34845369 CTAAATACAAAGACACAGAAAGG + Intergenic
1125164042 15:36681918-36681940 TTGAATCCAAAAGCAGAGAATGG + Intronic
1127967705 15:63935639-63935661 ATGCATCCACAGACACAGAAAGG - Intronic
1128500411 15:68223308-68223330 CTGGAGCCAGAGAAAGAGAAGGG + Intronic
1128643036 15:69353909-69353931 CTGAATCAACAGGCTAAGAAGGG + Intronic
1128788635 15:70416463-70416485 CTGTATCCACTGGCAGATAAGGG + Intergenic
1128944385 15:71811188-71811210 CTGAAGCCACCCACAGAGAAGGG + Intronic
1129951291 15:79593911-79593933 CTGAATCAAGGGACAGATAAAGG + Intergenic
1131557656 15:93413735-93413757 CAGAAGTCACAGGCAGAGAAAGG - Intergenic
1131662694 15:94535498-94535520 CTGAATCAACAGGCAAAGCAGGG - Intergenic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1132059839 15:98683072-98683094 CTATAACCACAGAAAGAGAAAGG - Intronic
1132371767 15:101304546-101304568 CTGAAGACACAGACAGAACACGG + Exonic
1134367766 16:13595172-13595194 CTGACTTCTCAGACACAGAAAGG + Intergenic
1135971644 16:27076203-27076225 ATGAAACCACAGAGAGTGAAAGG - Intergenic
1136002285 16:27303863-27303885 CTGAAGCCCCAGACAGTTAAGGG - Intergenic
1136691794 16:32038234-32038256 TGGAATCCAGAGACAGAGATGGG + Intergenic
1136792382 16:32981797-32981819 TGGAATCCAGAGACAGAGATGGG + Intergenic
1136877435 16:33872111-33872133 TGGAATCCAGAGACAGAGATGGG - Intergenic
1137477337 16:48820621-48820643 CGGTATTCACAGACAGAAAAAGG - Intergenic
1137652445 16:50132144-50132166 CTGAATCAACAAAAAAAGAAGGG - Intergenic
1137723622 16:50642232-50642254 GGGAATCCACAGACAGAGCCTGG - Intergenic
1139021099 16:62750633-62750655 CTTAAGCCAAAGTCAGAGAAGGG - Intergenic
1139080416 16:63511789-63511811 TTGAATCCAAAGAGAGATAATGG - Intergenic
1140174972 16:72649452-72649474 CTGAATCAACAGGCAAAGAAAGG + Intergenic
1141017125 16:80461126-80461148 CAGAATCCAGAGAGAGAGAGAGG + Intergenic
1141328819 16:83089091-83089113 CTAAATCCATAGACATGGAAAGG - Intronic
1141595140 16:85092786-85092808 CTAAGACCACAGACAGAGCAGGG + Exonic
1142175847 16:88644922-88644944 TCAAATCCACAGTCAGAGAAGGG + Intronic
1203094588 16_KI270728v1_random:1243261-1243283 TGGAATCCAGAGACAGAGATGGG + Intergenic
1143034524 17:3986791-3986813 CTGAGTCCCCAGACAGTCAAAGG - Intergenic
1146089645 17:29863504-29863526 CTGCATCCAAAGGCATAGAAAGG - Intronic
1146096786 17:29937654-29937676 CTTATTCCAGAGTCAGAGAAAGG + Intronic
1147219523 17:38920219-38920241 CTGTAGCCCCAGACAGAGATGGG - Exonic
1147839380 17:43360088-43360110 GCTACTCCACAGACAGAGAAGGG + Intergenic
1147885188 17:43679553-43679575 CTGAGTCCACAGAGAGGAAAGGG + Intergenic
1148956058 17:51354715-51354737 CTGAATCCAGAGGTAGAAAATGG - Intergenic
1150570820 17:66385506-66385528 ATGAAACCAGAGACAGAGAGAGG - Intronic
1151583788 17:74995958-74995980 CTTAATCCAGAGACGGAGAAGGG - Intronic
1152167064 17:78716395-78716417 CTGACTCCAAGGACACAGAAGGG - Intronic
1153260947 18:3224400-3224422 CAGAATCCACAGACTGGGAGGGG + Intergenic
1154399551 18:14023532-14023554 CTGTGTCCAGAGACAGAGGAGGG + Intergenic
1155733056 18:29185689-29185711 CTGAATCAAAAGGCAAAGAAGGG - Intergenic
1156118659 18:33817372-33817394 TTGAATCAACAGCCAAAGAAGGG + Intergenic
1157939241 18:51908890-51908912 CTGAGTCAACAGACAAATAAGGG + Intergenic
1158578086 18:58657251-58657273 CAGAAACAAGAGACAGAGAAAGG - Intergenic
1159157570 18:64604313-64604335 CTGCAACAACAGACAAAGAAAGG + Intergenic
1159262079 18:66027097-66027119 TTGAATCCACAGGCAAAGAAGGG - Intergenic
1159340134 18:67124125-67124147 CTGAGTCAACAGGCAGAGAATGG + Intergenic
1160465904 18:79075747-79075769 ATCAATCCAAAGACAGACAATGG - Intronic
1160529982 18:79557094-79557116 CTGACTCCACAGACGAGGAAAGG + Intergenic
1161588214 19:5117066-5117088 CTCAATGCACAGACACAGCAAGG - Intronic
1163643145 19:18473212-18473234 GTGAATCCACCGGGAGAGAAGGG + Intronic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1164840799 19:31390730-31390752 ATGAATACACAGGCAGAGACTGG - Intergenic
1164843728 19:31414155-31414177 CAGAATGCACAGAGAGAGATGGG + Intergenic
1166316030 19:41990824-41990846 CAGATTCCAGAGACAGAGAGAGG - Intronic
1166654379 19:44599442-44599464 CTGTATCCACTTCCAGAGAAGGG + Intergenic
1166899333 19:46046440-46046462 CTGAATTAAAAGACACAGAATGG + Intronic
1166917465 19:46205249-46205271 ATCAAGCCACAGACATAGAAAGG + Intergenic
1167781294 19:51600974-51600996 CAGGATCCAGAGACAGAGAGGGG - Intergenic
1167805546 19:51781347-51781369 CTGAATCAGCAGGCAAAGAAGGG + Intronic
1168576525 19:57516177-57516199 CTGAATGCAAAGACAGAACAAGG + Intronic
1168680540 19:58312289-58312311 CTGAATGCAAAGACAGAACAAGG + Exonic
925714544 2:6772382-6772404 CTGAACACAGAGACAGAGGAAGG - Intergenic
926006812 2:9378951-9378973 CTGGATAAACAGACAGGGAAAGG + Exonic
926574118 2:14561568-14561590 CTGCCTCCACACACAGAGAAGGG - Intergenic
926659996 2:15454371-15454393 CTGTATCCTCAAACAGAAAAAGG + Intronic
928327702 2:30333256-30333278 CTGAACGCACAGCCAGAGCAGGG - Intergenic
930439321 2:51386825-51386847 CTAAATCAACAGCCAAAGAACGG - Intergenic
931228807 2:60356681-60356703 CTGCATCCCCAGAAAGAGAGAGG - Intergenic
931439852 2:62281116-62281138 CAGAATCCACAGAAAAACAATGG - Intergenic
932336128 2:70932464-70932486 ATGGATCGACAGACAGAGAATGG - Intronic
933493491 2:83018634-83018656 CTGAATCCATGAACAGAGATGGG + Intergenic
934488006 2:94735928-94735950 CTGAATCCATGGAGAGAAAAAGG - Intergenic
935514062 2:104012882-104012904 TTGAATCCAAAGAAAGTGAAAGG - Intergenic
935730333 2:106059867-106059889 CTGAAGCCAAAGTCAGGGAAAGG - Intergenic
936147493 2:109990457-109990479 CTGAATAGACAGGCAAAGAAGGG - Intergenic
936197199 2:110380984-110381006 CTGAATAGACAGGCAAAGAAGGG + Intergenic
936250774 2:110866710-110866732 GTGAATACAGAGACAGACAAAGG - Intronic
936396503 2:112135878-112135900 CTGAGGACAAAGACAGAGAAAGG + Intergenic
937006353 2:118520262-118520284 CTGAGTCCAAGGCCAGAGAAGGG + Intergenic
937829896 2:126408270-126408292 CTGAATGCTCAGCCAGACAATGG + Intergenic
938284957 2:130104763-130104785 TAGCATCCACAGACATAGAATGG - Intronic
938335601 2:130493310-130493332 TAGCATCCACAGACATAGAATGG - Intronic
938354223 2:130627353-130627375 TAGCATCCACAGACATAGAATGG + Intronic
939114029 2:138040163-138040185 CTCATTCCACAGAAACAGAAAGG - Intergenic
939925633 2:148170815-148170837 CTGATTCTACAGAAACAGAATGG + Intronic
941252097 2:163178733-163178755 CTGTATCCACCCACAGAGGATGG + Intergenic
941618109 2:167745793-167745815 ATGCATCCACAGATAGATAATGG - Intergenic
941908164 2:170737049-170737071 CTGAATATACATACAGACAATGG + Intergenic
943139535 2:183963346-183963368 CTTAATTCACAGAAAGAGATGGG + Intergenic
943207371 2:184918207-184918229 CTGAATCAACAGGCAAAGGAGGG - Intronic
943889606 2:193270322-193270344 TTGATTGCACAGAAAGAGAATGG - Intergenic
944178320 2:196858877-196858899 CTGATACCACAGAAATAGAAAGG + Intronic
944294116 2:198042852-198042874 TTGCATAAACAGACAGAGAAAGG + Intronic
944752090 2:202719969-202719991 CTTGATCCACAGGCACAGAAAGG - Intronic
945620577 2:212131569-212131591 TTGAATCAACAGGCAAAGAAAGG + Intronic
946285845 2:218701900-218701922 CTGATTCCCCAGAGAGAGCAAGG - Exonic
946873325 2:224104796-224104818 CTGAGTCAACAGGCAAAGAAGGG - Intergenic
948074882 2:235158289-235158311 CTGAAGCAAGAGACAGAGATGGG - Intergenic
948340223 2:237244702-237244724 CTGAATCAGCAGGCAAAGAAGGG - Intergenic
1169031164 20:2408228-2408250 CTGGTTCCACAGACAGAGCAAGG - Intronic
1169469457 20:5871679-5871701 CTGAAACCACAGACAGGCATAGG + Intergenic
1169626634 20:7578654-7578676 CTAAATCAACAGGCAAAGAAGGG - Intergenic
1171329854 20:24327949-24327971 CTGAATCCACAGGCAAAGAAAGG - Intergenic
1172584644 20:36074298-36074320 TTGAATCCACTGACCTAGAATGG - Intergenic
1173008778 20:39161839-39161861 CTGATGCCACAGACATAAAAAGG - Intergenic
1173495079 20:43513047-43513069 CTGAATCCCCAGAGGGAGGAGGG + Intronic
1173581285 20:44148629-44148651 CAGAACCCACACACAGAGAAGGG - Intronic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1174060813 20:47831630-47831652 CTGGACACACAGACAGAGAGGGG - Intergenic
1174071085 20:47899740-47899762 CTGGACACACAGACAGAGAGGGG + Intergenic
1174301553 20:49585906-49585928 CAGAATCCAGAGAAAGAGGAAGG + Intergenic
1175464074 20:59177903-59177925 CAGAAGCCACAGAAACAGAAAGG + Intergenic
1175838857 20:62014226-62014248 GTGAAGCCACAGGGAGAGAAGGG + Intronic
1176684699 21:9837816-9837838 ATGAAACCACAGACGGAGACGGG - Intergenic
1176839273 21:13825721-13825743 CTGAATCCATGGAGAGAAAAAGG - Intergenic
1178743007 21:35220824-35220846 CAGAATCCAGATACAGATAAAGG + Intronic
1179037401 21:37770406-37770428 GTGAATCAACAGGCAAAGAAGGG + Intronic
1179159737 21:38884470-38884492 CAGATTCCACAGAGAGAGACTGG - Intergenic
1179314054 21:40225544-40225566 TTGAGTCCACACACAAAGAAGGG - Intronic
1179489211 21:41729360-41729382 GTGAATCCACAGAGACAGACTGG - Intergenic
1179501353 21:41811078-41811100 CTGAAAACACAGACAGAAAGTGG + Intronic
1180631280 22:17231862-17231884 CTGAATCCAAAGACAAAAGATGG + Intergenic
1181040587 22:20190685-20190707 CGGAATCCACAGACAGGCACTGG + Intergenic
1181839043 22:25638748-25638770 CTGAATCAGCAGGCAGAGAAGGG - Intronic
1182509516 22:30809001-30809023 GTGAAGACACAGACAGAGAGGGG + Intronic
1183601134 22:38841262-38841284 CAGCAGCCACAGACAGAGAAGGG - Intronic
1183620702 22:38970610-38970632 CTGAATCCTGAGGGAGAGAAGGG - Intronic
1183624651 22:38994197-38994219 CTGAATCCTGAGGAAGAGAAGGG - Intergenic
1183965061 22:41436628-41436650 GTGAATGCATAGACAGAGAGAGG + Exonic
1185410421 22:50678746-50678768 CTGGGTTCACAGACAGATAAGGG - Intergenic
949897317 3:8777899-8777921 ATAAATCCACCCACAGAGAATGG + Intronic
950104871 3:10381764-10381786 CTGACTCCAGATACAGAGAAGGG - Intronic
950658031 3:14449375-14449397 CTGAGTTCACAGACAAAGAAAGG + Intronic
953152729 3:40339953-40339975 CTGAACCAAAAGACAGAGAGGGG + Intergenic
955418411 3:58714190-58714212 CTGAGTCAACAGGCGGAGAAGGG - Intergenic
955676884 3:61458202-61458224 CAGAACCCACAGACACAAAAGGG + Intergenic
956289673 3:67648289-67648311 CTGAAGCCAGAGAGAGAGGAAGG + Intronic
956524951 3:70148641-70148663 AGGAATCAAGAGACAGAGAAGGG + Intergenic
957167127 3:76689814-76689836 CTGACTACACACAGAGAGAACGG - Intronic
957298282 3:78359674-78359696 CTGAATTATAAGACAGAGAAAGG - Intergenic
957480537 3:80787792-80787814 CTGAATCAACAGAAAAAGAAGGG + Intergenic
957610138 3:82455271-82455293 CAGAATCCATAAACAGAGAGCGG + Intergenic
957918007 3:86710641-86710663 ATGAATTCATATACAGAGAATGG + Intergenic
958694860 3:97514255-97514277 ATGACTTCAAAGACAGAGAAGGG - Intronic
959352136 3:105279160-105279182 CTGAATCAACAGGCAAAGAAGGG - Intergenic
959436097 3:106317085-106317107 CAGAATCCACAGGCAGCGGAAGG + Intergenic
959793478 3:110393473-110393495 CTGAATCTATAGATAAAGAAGGG - Intergenic
960152154 3:114261456-114261478 ATAAATACACAGACAGATAAAGG + Intergenic
961229792 3:125294291-125294313 TTGAATCCTCAAACAGAAAAAGG + Intronic
961471931 3:127120612-127120634 CTGAATCTACAGGCAAACAATGG - Intergenic
961630861 3:128297353-128297375 CTCAATCCACAAATAAAGAAAGG - Intronic
961657188 3:128449663-128449685 CTGTGTCCACAGAAAGTGAAGGG + Intergenic
962027419 3:131563024-131563046 CTGAATCCAGAGACACAGGCAGG + Intronic
962496169 3:135941468-135941490 CTGATGCCACAGAAAAAGAAAGG - Intergenic
962557381 3:136568149-136568171 CTGTATTCACAAGCAGAGAATGG + Intronic
964507637 3:157416984-157417006 TTGAATCCATAGAAAGAGCAAGG + Intronic
964692749 3:159470339-159470361 CTGTATACACAGACAGTCAAAGG + Intronic
965115264 3:164480338-164480360 ATGAATCAACATACAGATAATGG - Intergenic
965354025 3:167651553-167651575 CAGACTCAACAGCCAGAGAATGG - Intronic
965536722 3:169831127-169831149 ATGAATGTACAGACAAAGAATGG - Intronic
965892966 3:173537919-173537941 TTGAATCAACAGACAAAGAAGGG - Intronic
966294601 3:178404702-178404724 CTGGAACCACAAAAAGAGAAAGG - Intergenic
966661610 3:182420734-182420756 CTGAATCAACAGGAAAAGAAGGG + Intergenic
967108988 3:186276564-186276586 GTGAAAAGACAGACAGAGAAAGG + Intronic
967863245 3:194169366-194169388 CTGAACCCACAGAAAGAGAATGG - Intergenic
968577336 4:1374064-1374086 CGGAATCCACGGAAAGAAAACGG - Intronic
969098198 4:4750208-4750230 CTGAAACCACAGAAAGGGAAAGG + Intergenic
969359463 4:6653285-6653307 GTAAATCCACAGAGACAGAAAGG + Intergenic
969924519 4:10573820-10573842 CTGTACCCACAGACACAGAAGGG - Intronic
970314744 4:14818461-14818483 CTGAATCCATAGACAATGATTGG + Intergenic
971740126 4:30508550-30508572 CTGAATCAACAGCCAAAGAAGGG - Intergenic
972093414 4:35317541-35317563 CTGAATCAACAGGTAAAGAAGGG + Intergenic
972251395 4:37306157-37306179 CTGATACCACAGACACAAAAAGG - Intronic
972498070 4:39652464-39652486 CTGGCTTTACAGACAGAGAAGGG - Intergenic
973539664 4:51923487-51923509 CTGAATCGACAGGCAAATAAGGG - Intergenic
974097195 4:57376197-57376219 TTGAATCCAAAGACAGAAAAAGG - Intergenic
974211262 4:58779241-58779263 TTGAATCTACATACAGAGGAAGG - Intergenic
974500646 4:62697095-62697117 TTGTATACACAGGCAGAGAAAGG - Intergenic
975920953 4:79386922-79386944 CTGATTCCAAAAACAAAGAATGG - Intergenic
977089275 4:92650558-92650580 CTGAATCAACAGGCAAAGAAGGG - Intronic
977626785 4:99196491-99196513 CTGCAGCCCCAGAAAGAGAATGG - Intergenic
977752945 4:100631671-100631693 CTAAATCAACAGGCAAAGAAGGG - Intronic
978431709 4:108639840-108639862 CTGGAACCAGAGAAAGAGAATGG - Intergenic
978485706 4:109251568-109251590 CTGAATCAACAGGCAAAGAAGGG - Intronic
978675289 4:111307156-111307178 CTCAATCAAAAGACATAGAATGG - Intergenic
979010232 4:115357646-115357668 CTGAAGACTCAGACAGAGATTGG + Intergenic
979184109 4:117766520-117766542 CTGTATTCACAGACAGAAAAAGG - Intergenic
979458309 4:120951379-120951401 CTGAGTCCTCAGACAGTGGAGGG + Intergenic
980784821 4:137538500-137538522 TTAAATTCACAGAAAGAGAAGGG + Intergenic
981809058 4:148752628-148752650 CTCAATTCACAGACAGAAACAGG - Intergenic
982187589 4:152818652-152818674 CTGCTTCCACAGACTGGGAATGG + Intronic
982772190 4:159406916-159406938 CTGAGTCGACAGGCAAAGAAGGG + Intergenic
984418060 4:179486020-179486042 CTGAATCAACAGGCAAACAAGGG - Intergenic
985190679 4:187369475-187369497 CGGAATCCATATACAGAGACTGG + Intergenic
987252737 5:16117172-16117194 CTAACTCCACACACAGAGGAGGG + Intronic
987646160 5:20675304-20675326 CTGAATCAACAGGCGAAGAAAGG - Intergenic
987691667 5:21274847-21274869 CTGAATACACTAACAGACAATGG - Intergenic
989726672 5:44595749-44595771 CTTCATCCACAGAAACAGAATGG - Intergenic
990254118 5:53947274-53947296 ATTAATCCACAGACAGGGAAGGG - Intronic
990455638 5:55984474-55984496 GTGAATACACAGGCAGAGATTGG + Intronic
991234357 5:64376783-64376805 CTGAATGAACAGACAAATAAGGG + Intergenic
991427511 5:66506800-66506822 CTAAATCAACAGACAATGAAGGG - Intergenic
991748710 5:69775290-69775312 CTGAATACACTAACAGACAATGG + Intergenic
991800288 5:70355102-70355124 CTGAATACACTAACAGACAATGG + Intergenic
991828312 5:70654939-70654961 CTGAATACACTAACAGACAATGG - Intergenic
991892646 5:71354542-71354564 CTGAATACACTAACAGACAATGG + Intergenic
991958286 5:72017263-72017285 CTGGTTCCAAAGTCAGAGAAAGG + Intergenic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
992726167 5:79609351-79609373 CTGCAGCCCCAGAAAGAGAATGG - Intergenic
995483441 5:112615175-112615197 CTGAATCAACAGGAAAAGAAGGG - Intergenic
995751316 5:115455991-115456013 CTGAATACACAGAGAGGAAAGGG - Intergenic
995856703 5:116600430-116600452 CTGACTCTGAAGACAGAGAAAGG - Intergenic
996167185 5:120238772-120238794 TTGAACCCAAAGAAAGAGAAAGG - Intergenic
997240097 5:132300710-132300732 CTGACTGCAGAGACAGATAAAGG - Intronic
997464484 5:134078250-134078272 CTGCACACACAGACAGAGGAGGG + Intergenic
998340438 5:141413091-141413113 CTGAAGCCACAGAAAGACAAAGG + Intronic
998804580 5:145906156-145906178 CACACTCCACAGACTGAGAAGGG - Intergenic
999050234 5:148515907-148515929 TTGAATTCAGAGAGAGAGAATGG - Intronic
1000773831 5:165391766-165391788 CTGATACCACAGAAATAGAAAGG + Intergenic
1001370800 5:171198829-171198851 CTGAAGAAACAGGCAGAGAAAGG - Intronic
1003164853 6:3667869-3667891 CTGATACCACACACAGACAAAGG + Intergenic
1003613334 6:7632589-7632611 CTGAGACCACACAGAGAGAAAGG + Intergenic
1004089196 6:12482563-12482585 CTGAATGCACAGGCACAGAGGGG + Intergenic
1004298800 6:14438323-14438345 CTGAATCAACAGGCAAAGAAAGG + Intergenic
1005816818 6:29559719-29559741 CAGAAACCAGAGACAGAAAAAGG + Exonic
1006040225 6:31246423-31246445 CTGAATCAACAGACAAAGGAAGG - Intergenic
1007213951 6:40221371-40221393 CTGAATCAACAAGCAAAGAATGG + Intergenic
1007214190 6:40223736-40223758 CTGAATCAACAAGCAAAGAATGG - Intergenic
1008219493 6:48838154-48838176 GCTAATCCACAGACAGAGTAGGG + Intergenic
1008393754 6:50983225-50983247 CTGAACCAACAGACAAAGTATGG + Intergenic
1008823305 6:55660163-55660185 CTGAAACCATAGACAGAGTCTGG - Intergenic
1009741169 6:67747960-67747982 CTGAACCATCAGACAAAGAAGGG + Intergenic
1009805676 6:68599037-68599059 TGGAAGGCACAGACAGAGAAAGG + Intergenic
1010542089 6:77103912-77103934 CTGAACCAACAGGCAGAGAGAGG + Intergenic
1010806389 6:80241986-80242008 CACAAGCCACAGACTGAGAAAGG - Intronic
1012202283 6:96421465-96421487 CTTAATCCACAGACAAGGAAAGG + Intergenic
1012964332 6:105657017-105657039 CTGAATCCATAGTTATAGAAGGG + Intergenic
1013491651 6:110652747-110652769 ATGAAGACACAGAGAGAGAAAGG + Intronic
1014097913 6:117480695-117480717 CTGAATCCTGAGCCAGATAAGGG - Intronic
1016001509 6:139046464-139046486 CTGCATACAAAGTCAGAGAAAGG + Intergenic
1016503873 6:144754562-144754584 CTGATACCAGAGACAGAGAAGGG + Intronic
1017452563 6:154567336-154567358 CTGAATCAACAAACAAACAAGGG + Intergenic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1018096441 6:160390987-160391009 ATGAAGCCAGAGACAGAGATTGG - Intronic
1018306919 6:162467592-162467614 CTGATTCAAAAGACAGATAATGG - Intronic
1018363890 6:163099058-163099080 CTGCATCCCCAGACAGTGAAGGG - Intronic
1019222091 6:170480952-170480974 CTGAATCAACAGACAAAGAAAGG + Intergenic
1019419047 7:942262-942284 CAGAATCCACTGAGAGAGAGAGG + Intronic
1020484278 7:8702438-8702460 GTGAATCCAAGGACAGAGCATGG - Intronic
1021769275 7:23982685-23982707 CTGAATCTAAAGATTGAGAAAGG + Intergenic
1021807305 7:24370079-24370101 TTGAATCCATAGACTGAGAAAGG + Intergenic
1022625633 7:32033099-32033121 CTGAATCCCCAGGCAGGGCAAGG + Intronic
1023034614 7:36119528-36119550 CAAAATCCACCAACAGAGAATGG + Intergenic
1023964555 7:44956219-44956241 CTACCTACACAGACAGAGAACGG + Intergenic
1024216121 7:47249641-47249663 ATAAATCCACAGAGATAGAAAGG - Intergenic
1024955854 7:54918762-54918784 CAGAATCAAAAGACAGAGAGAGG + Intergenic
1024966968 7:55032317-55032339 CTGCGTCCTCAGACAGAGATGGG - Intronic
1025150760 7:56545907-56545929 CTGCTACCACAGACATAGAAAGG + Intergenic
1026262543 7:68767729-68767751 ATGACACCACAGCCAGAGAATGG - Intergenic
1029926251 7:104321911-104321933 CTGAATCCATTGTCAGAGGATGG - Intergenic
1030512469 7:110500634-110500656 CTGTGTCCACAGACAAATAATGG - Intergenic
1031489181 7:122366759-122366781 CTGGATTCACAGAAAGAGGATGG - Intronic
1031628959 7:124022750-124022772 CTGAATCAACAGGCAAAAAAGGG + Intergenic
1031972565 7:128075038-128075060 CTGAGGGCACTGACAGAGAAGGG - Intronic
1033392497 7:140941108-140941130 CTGAACCAACAGACTAAGAAGGG + Intergenic
1033576453 7:142690049-142690071 CTAATGCCACAGACAGAGAAAGG + Intergenic
1034822133 7:154225851-154225873 CTGACTCCACAGAGAGAGGGTGG - Intronic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1036664162 8:10728151-10728173 TTGAGACCACAGACAGAGTATGG - Intronic
1037305552 8:17499419-17499441 CTGAACACACAGAGAGAGAAGGG - Intronic
1037383357 8:18311914-18311936 ATGTATCCACAGACAAAGAAGGG + Intergenic
1037619816 8:20553782-20553804 CTGGATCCTCAAACAGAAAAAGG - Intergenic
1038456992 8:27680386-27680408 TAGAATCAACAGACAGTGAAGGG + Intergenic
1038812595 8:30865144-30865166 CTGAAACCACAGAAATACAAAGG + Intronic
1038958642 8:32494792-32494814 CTGGATGCACAGACACAAAAGGG - Intronic
1039092400 8:33846175-33846197 CTGAAGCCACAGAGAAAAAAGGG + Intergenic
1039628761 8:39085126-39085148 CTTAATTGAAAGACAGAGAATGG - Intronic
1041774201 8:61506275-61506297 TTAAATTCACAGAGAGAGAAAGG + Intronic
1042450047 8:68933553-68933575 CAGAATCCACATACAGAAAGAGG + Intergenic
1042593169 8:70417892-70417914 CTGAATTAGCAGACAAAGAAGGG - Intergenic
1043325629 8:79047522-79047544 CTGAATCAACAGGCAAAGATGGG - Intergenic
1043780765 8:84332345-84332367 AAGAATCCATAGACTGAGAAAGG + Intronic
1043992521 8:86773538-86773560 CTGAATCAATAGACAAGGAAGGG + Intergenic
1044422926 8:92019387-92019409 GTGGTTGCACAGACAGAGAAAGG + Intronic
1044786631 8:95800720-95800742 TTGAAAGCACAGACAGACAAAGG - Intergenic
1044848463 8:96405084-96405106 CTAAATCCACACTAAGAGAATGG + Intergenic
1045507274 8:102787705-102787727 CTGAAGACAGAGACAGAGATTGG - Intergenic
1045724202 8:105151960-105151982 CTGAATCATCAGTTAGAGAAGGG - Intronic
1046122763 8:109866188-109866210 CACAATCCAGAAACAGAGAAAGG + Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1049798781 8:144508380-144508402 CTGAAGCCACAGACACAGCAAGG + Intergenic
1051104365 9:13562000-13562022 CTGAGACCACAGAAAGTGAAAGG + Intergenic
1051730687 9:20139752-20139774 CTGAATCCACACACTAAGACTGG + Intergenic
1053520910 9:38778575-38778597 CTGATGCCACAGAAATAGAAAGG + Intergenic
1053523750 9:38808174-38808196 CTGAATCAACTGGCAAAGAAGGG - Intergenic
1053669791 9:40348491-40348513 CTGAATCCATGGAGAGAAAAAGG + Intergenic
1053919588 9:42974746-42974768 CTGAATCCATGGAGAGAAAAAGG + Intergenic
1054193066 9:62002568-62002590 CTGATGCCACAGAAATAGAAAGG + Intergenic
1054195979 9:62032588-62032610 CTGAATCAACTGGCAAAGAAGGG - Intergenic
1054514821 9:66027805-66027827 CTGAATCCATGGAGAGAAAAAGG - Intergenic
1054642426 9:67556101-67556123 CTGAATCAACTGGCAAAGAAGGG + Intergenic
1054645342 9:67586123-67586145 CTGATGCCACAGAAATAGAAAGG - Intergenic
1054799381 9:69332004-69332026 CAGAATTCACAGACGGGGAAAGG - Intronic
1056110107 9:83386780-83386802 CTGGATTCACAGTCAGAGATTGG - Intronic
1056217491 9:84418833-84418855 CTGTATCCTCACACAGTGAAAGG - Intergenic
1056347012 9:85706906-85706928 CTCAATTAAAAGACAGAGAAGGG + Intronic
1056520077 9:87393027-87393049 CTGAATACACAAACAGATGATGG + Intergenic
1056602016 9:88053874-88053896 CTGAGTACACAAACAGACAATGG + Intergenic
1057583199 9:96306043-96306065 CTGAATTCACAGTCAGATATTGG - Intergenic
1058272458 9:102989548-102989570 CTGAAACCACAGAAATACAAAGG + Intergenic
1059862723 9:118483012-118483034 ATGAATCCAGAGACAGTGCAGGG - Intergenic
1059989922 9:119855220-119855242 CTCCATCTACAGGCAGAGAAAGG + Intergenic
1060442816 9:123657219-123657241 CTAAATCCAGACAAAGAGAAAGG + Intronic
1061854602 9:133434824-133434846 GTCAATCCACAGAGACAGAAGGG - Intronic
1187352692 X:18535582-18535604 CTGAATCCATAGACAGACCACGG - Intronic
1187992780 X:24893946-24893968 CTGAAGGCAGAGACAGAAAAAGG - Intronic
1188190658 X:27168142-27168164 GTGAGTCCACAGAAAGAGAATGG + Intergenic
1188285865 X:28324841-28324863 CTAAATCCACAGACAGAAGAGGG + Intergenic
1188649713 X:32617058-32617080 CTGAATCCACAGACAGAGAAAGG + Intronic
1189870342 X:45375306-45375328 CTGATACCACAGAAATAGAAAGG + Intergenic
1190765914 X:53475581-53475603 TTGAATCAACAGGCAAAGAAGGG + Intergenic
1190922392 X:54867096-54867118 CTGAAACCACAGAAATACAAAGG - Intergenic
1192051903 X:67732231-67732253 CTGAAGGCACAGACAGTGCATGG - Intergenic
1193876209 X:86865596-86865618 CTGAATTAACAGGCAAAGAAGGG + Intergenic
1194153494 X:90356733-90356755 ATGAATACACACACAGACAAGGG + Intergenic
1194424216 X:93716994-93717016 CTAAATCAACAGGCACAGAAGGG - Intergenic
1194791321 X:98154324-98154346 CTCAATCCAAAGATATAGAATGG - Intergenic
1195286611 X:103391447-103391469 CTGAAGCCACAGAAATAAAAAGG + Intergenic
1195386152 X:104315039-104315061 CTGTATTCACACAGAGAGAAGGG - Intergenic
1196006964 X:110847061-110847083 CTGAATCCCCAAACTGAGATGGG + Intergenic
1196980036 X:121202783-121202805 CTGACTCCACAGAAATACAAAGG - Intergenic
1197030346 X:121805501-121805523 CTGATACCACAGACACACAAAGG - Intergenic
1197540588 X:127755343-127755365 CTGAATCAACAGGCAAATAAGGG + Intergenic
1198190332 X:134298456-134298478 CTGATACCAAAGCCAGAGAAAGG + Intergenic
1198805466 X:140490018-140490040 CTGAATAAACATACAGAAAATGG + Intergenic
1199222332 X:145331776-145331798 TTTAATTCACACACAGAGAAAGG - Intergenic
1200499830 Y:3933529-3933551 ATGAATACACACACAGACAACGG + Intergenic
1200849637 Y:7869726-7869748 ATGAATACACAGAGAGAAAAAGG + Intergenic