ID: 1188652722

View in Genome Browser
Species Human (GRCh38)
Location X:32651903-32651925
Sequence CAGAAGGCGCAGAGTTCGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 74}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188652722 Original CRISPR CAGAAGGCGCAGAGTTCGAA TGG (reversed) Intronic
902127381 1:14227305-14227327 CAGAAGGAGCACAGTGAGAATGG + Intergenic
908708844 1:66992372-66992394 CAGAAGGCTCAGAGTGTGCAAGG - Intergenic
909871299 1:80742813-80742835 CAGCAGAGGCAGAGTTCAAATGG - Intergenic
914803598 1:150976895-150976917 CTGAAGGAGGAGAGTTCCAAGGG - Intergenic
1064287845 10:14008059-14008081 GAGAAGGCGCAGCGTTGAAAGGG - Intronic
1066317162 10:34259480-34259502 CAGAAGGGGCAGAGTCAGGAAGG - Intronic
1075989524 10:126823470-126823492 CAGAAGTCCCTGAGTTCCAATGG - Intergenic
1083795622 11:65014808-65014830 CAGAAGGCGCACAGGGCGCACGG - Intronic
1089439779 11:118505618-118505640 CAGAAGGGGCAATGTTTGAAGGG - Exonic
1091828129 12:3530614-3530636 CAGAAAGCTCAGAGGACGAAGGG + Intronic
1092118626 12:6027536-6027558 CAGGAGGGTCAGAGTTCAAAAGG + Intronic
1096995600 12:55836089-55836111 CAGAGGGGGAAGAGTTAGAATGG - Intronic
1097879159 12:64671417-64671439 CAGAAGGCTCAGAGTGAGTAAGG - Intronic
1103700299 12:122845731-122845753 CAGAAGGTGCAGATTTCAACAGG + Intronic
1104703583 12:130925631-130925653 CAGAAGGAACAGAGATCGCATGG - Intergenic
1104858510 12:131912944-131912966 CAGGAGGCGCAGAGTCCAAGTGG + Intronic
1109002176 13:56819101-56819123 CAGAAGGGGGAGAGTTGGAAGGG + Intergenic
1109062757 13:57639131-57639153 CAGAAGGCACAGAGTAAGAAAGG - Intronic
1111173984 13:84567952-84567974 CAGCAGCAGCAGAGTTTGAAAGG - Intergenic
1114734403 14:25029124-25029146 CAGCAGCAGCAGAGTTTGAAAGG + Intronic
1128654062 15:69446324-69446346 CAGATGGTGCAGAGTCTGAATGG + Exonic
1128747905 15:70127416-70127438 CAGAAGGTCTAGAGTTCAAAAGG + Intergenic
1128900057 15:71412236-71412258 CAGAAGGGGCAGGCTTCCAAAGG + Intronic
1129712570 15:77827997-77828019 CTGAAGGAGAAGAGTTGGAAGGG - Intergenic
1141168819 16:81678340-81678362 CAGAAGGCGCAGAGGTAAAGTGG - Exonic
1144153611 17:12475556-12475578 TAGAAGGGGGAGAGTTGGAAGGG + Intergenic
1156035481 18:32762039-32762061 CAGAAGTCTCGGAGTTCAAAGGG - Intronic
1157474404 18:48012123-48012145 CAGATGGAGCAGAGTGGGAAGGG + Intergenic
1162324669 19:9991967-9991989 CAGAAGGGTCAGAGGTCAAAGGG + Intronic
1162753055 19:12840617-12840639 CAGAAGGGGCGCAGTTTGAATGG + Intronic
1167187879 19:47959595-47959617 CAAATGGCGCAGAATTTGAAAGG + Intergenic
925111362 2:1341201-1341223 CAGAAAGCACAGAGTTCAAGGGG - Intronic
927604793 2:24477127-24477149 CTGTAGGAGCAGAGTTAGAAAGG - Intergenic
928327160 2:30328506-30328528 CAGGATGCTCAGAGTTGGAAGGG - Intergenic
928560826 2:32483289-32483311 CAGAAGGAGCAGCGTTGAAAAGG - Intronic
929175687 2:38973033-38973055 GAGAAGGTGCAGAGCTGGAATGG + Intronic
939411680 2:141834728-141834750 CAGAAGTTGCACAGTTGGAAAGG + Intronic
943396230 2:187338683-187338705 CAGAAGGGGCAGAGGTGGCAGGG + Intergenic
947669785 2:231928890-231928912 CAGAAGAAGCAGACTTCGTAAGG - Intergenic
1169071967 20:2738337-2738359 CAGAAGCCACAGAGCTGGAAGGG - Intronic
1183551460 22:38489303-38489325 CAGAAGGCGGAGTTTTCGAAAGG - Intronic
1183751844 22:39725360-39725382 CAGAAATGGCAGAGTTGGAAGGG + Intergenic
1185396312 22:50592116-50592138 CAGAAGGAGAAGAGATGGAATGG + Intronic
952978192 3:38713997-38714019 CAGAGCGCGAAGGGTTCGAAGGG + Exonic
956694958 3:71910509-71910531 CAGCAGGCGCAGAGATCACATGG - Intergenic
958484478 3:94686339-94686361 CAGAAGGGGGAGAGTGGGAAGGG + Intergenic
961827212 3:129605465-129605487 CGGAAGGCGCAGAGTGCGGCCGG + Exonic
963809677 3:149763573-149763595 CAGAAGGCTGAGAGTTTGAGTGG - Intronic
967311801 3:188113242-188113264 GAGAAGGCCCAGAGCTGGAAAGG + Intergenic
974771656 4:66422498-66422520 CAGAAGGAGCAGGTTTCCAAAGG + Intergenic
975363899 4:73505449-73505471 CTGAAGGTGCAGAGTGAGAAAGG + Intergenic
977427987 4:96893109-96893131 GAGAAGGAGCAGAGTTCTGATGG - Intergenic
981390246 4:144181649-144181671 GAGAAGGGGCAAAGCTCGAAGGG + Intergenic
983718239 4:170813475-170813497 CAGAAGTTGCAAAGTTCCAAAGG + Intergenic
985059513 4:186062647-186062669 AAGAAAGCCCAGAGTTGGAAGGG - Intergenic
985790768 5:1925941-1925963 CAGAAGGCACAGAGCTCCAGGGG - Intergenic
986060299 5:4182713-4182735 CAGAGGGCCCAGTGCTCGAAGGG - Intergenic
993809562 5:92458692-92458714 CAGAAAGGGCAGAGTACCAATGG - Intergenic
997307882 5:132852908-132852930 CAGAAGCCTCAGAGTTTCAAGGG + Intergenic
997353559 5:133247986-133248008 CACAAGTCTCAGAGTTGGAAGGG + Intronic
1001124302 5:169005792-169005814 CCAAAGGCGCAGAGTGCCAAAGG - Intronic
1004039421 6:11961068-11961090 CAGAGGGTGCAGGGTTAGAAAGG - Intergenic
1006455519 6:34129786-34129808 CACAAGGCTCAGAGCTGGAAGGG - Intronic
1006706954 6:36028400-36028422 CAGAACGGGCAGAGCTCGAAGGG - Intronic
1009605520 6:65862404-65862426 CAGAAGGCACATAGTTCCAAGGG + Intergenic
1009914182 6:69972227-69972249 CAGAAGGAGCAGATTTTGATTGG - Intronic
1019391217 7:787661-787683 CAGAAGCCACAGAGGTCAAAGGG - Intergenic
1034069680 7:148172209-148172231 CAGAAGGCACAGAGTTCAGAGGG - Intronic
1046754975 8:117963430-117963452 GAGAAGGCGCCGTGTTCAAAAGG - Intronic
1057173544 9:92977728-92977750 CAGAAGGCAGAGGGTTCGAGGGG + Intronic
1061538122 9:131261863-131261885 CAGAAGGCGCAGTGGGCGCAGGG - Intronic
1062718242 9:138022006-138022028 CAGAAGGCCCAGAATGCAAAGGG + Intronic
1186430696 X:9501913-9501935 CAGAAGGCGCGGAGGGCGGAGGG - Intronic
1187489770 X:19739989-19740011 CAGAAGACACAGAGATAGAAAGG + Intronic
1188652722 X:32651903-32651925 CAGAAGGCGCAGAGTTCGAATGG - Intronic
1189873600 X:45410323-45410345 CAGAAGGGGGAAAGTTGGAAGGG + Intergenic
1192349370 X:70344049-70344071 CAAAAGGCACAGAGCTAGAAAGG - Intronic
1194258302 X:91662384-91662406 CAGGAGGGGCAGAGGTGGAAAGG + Intergenic
1195259587 X:103118827-103118849 CAGAAGGGGGAGAGTGGGAAGGG - Intergenic
1197800145 X:130339773-130339795 CGGAAGCGGCAGAGTTCTAAAGG - Intergenic
1198089520 X:133313629-133313651 CAGAAGTCTTAGAGTTGGAAGGG + Intronic