ID: 1188656827

View in Genome Browser
Species Human (GRCh38)
Location X:32707433-32707455
Sequence GCAAATGCACAGAAGCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 210}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188656823_1188656827 -6 Left 1188656823 X:32707416-32707438 CCTGAGAGTGCCTCAGAGCAAAT 0: 1
1: 0
2: 0
3: 5
4: 150
Right 1188656827 X:32707433-32707455 GCAAATGCACAGAAGCTGGTGGG 0: 1
1: 0
2: 0
3: 22
4: 210
1188656822_1188656827 2 Left 1188656822 X:32707408-32707430 CCAAACATCCTGAGAGTGCCTCA 0: 1
1: 0
2: 0
3: 13
4: 141
Right 1188656827 X:32707433-32707455 GCAAATGCACAGAAGCTGGTGGG 0: 1
1: 0
2: 0
3: 22
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188656827 Original CRISPR GCAAATGCACAGAAGCTGGT GGG Intronic
900501796 1:3009488-3009510 GCAGATCCTCAGAAGCTGGGTGG + Intergenic
905516386 1:38564959-38564981 GCAAGTGCACAGACCATGGTGGG - Intergenic
906554477 1:46697570-46697592 ACAAGTGCCCAGAAACTGGTGGG - Intronic
907457625 1:54585646-54585668 GCAGATATACAGAAGATGGTCGG + Intronic
908465318 1:64387853-64387875 GCAAATGGCCAGAAGCTGCTGGG + Intergenic
908589483 1:65614409-65614431 GCAACTTCACTGAAGGTGGTGGG + Intronic
908831136 1:68179641-68179663 GAAAATGCTGAGAAGCTGGAGGG + Intronic
910262445 1:85305428-85305450 GCAAGTGAAGAGAAGCTGTTGGG - Intergenic
912687419 1:111778336-111778358 GCACATGCACAGAACCAGGCCGG + Intronic
913465050 1:119132026-119132048 GCCACTGCACAGCACCTGGTAGG - Intronic
914708105 1:150188083-150188105 CCAAATGCAGAGAATGTGGTAGG + Intergenic
916821481 1:168403115-168403137 AAAAATGCAAAGAAGCTGGGAGG - Intergenic
918379566 1:183940650-183940672 GAAGGAGCACAGAAGCTGGTTGG - Exonic
920208303 1:204309248-204309270 GAAAATGCTCAGTAGGTGGTTGG - Intronic
921606783 1:217165337-217165359 GTAAATGCACAGAGGCAAGTTGG + Intergenic
923053869 1:230410095-230410117 GCAAATGCAAAGAAGAAGGCAGG + Intronic
923369976 1:233300105-233300127 ACACATGCACATAATCTGGTGGG + Intergenic
923419188 1:233795897-233795919 GAAAAGGCAGGGAAGCTGGTGGG + Intergenic
1064336568 10:14448538-14448560 CCAAATGCACAGAAGAAAGTGGG - Intronic
1066023177 10:31321645-31321667 GCAGCTGCACAGACGCTGGGTGG - Intronic
1067054777 10:43044194-43044216 GCAGCTGCACAGAGGCTGGTGGG + Intergenic
1067073815 10:43160821-43160843 GCAAATACACAGAAGGTGAGTGG - Intronic
1067461982 10:46465085-46465107 GCAAAGGCACAGAGGCAGGAAGG + Intronic
1067625213 10:47919513-47919535 GCAAAGGCACAGAGGCAGGAAGG - Intergenic
1068846843 10:61685857-61685879 GCAAAAGAATAGAAGCTGGCTGG - Intronic
1069775709 10:70925995-70926017 CCAAGTGGACAGGAGCTGGTGGG - Intergenic
1073108379 10:101046599-101046621 GCAAAGGCACAGTACCTGGTGGG - Intergenic
1073929170 10:108554805-108554827 GGAAATTCACAGAAACTTGTTGG + Intergenic
1076191438 10:128486171-128486193 GCAAATCCCCAGAAACAGGTTGG + Intergenic
1076224694 10:128764746-128764768 GAAAATGCCCAAAAGGTGGTCGG - Intergenic
1078620019 11:12898728-12898750 GCTAATGCTCAGAAGGTGCTTGG - Intronic
1080058803 11:27934937-27934959 ACAAATCCACAGAAGCCGGAAGG + Intergenic
1086064989 11:82734235-82734257 GCAAGCGCCCAGAAGCTGGTGGG - Intergenic
1087192187 11:95266698-95266720 GCAAAAGTACAGAAGCAGGAAGG + Intergenic
1088605911 11:111531943-111531965 GCAAAGCCCCAGAAGCTGCTGGG - Intronic
1089187683 11:116631326-116631348 GGAACAGCGCAGAAGCTGGTGGG - Intergenic
1089752565 11:120661739-120661761 GCAAATGCAGAGGAGCTGATTGG + Intronic
1090421458 11:126578273-126578295 GCATTTGCAGAGAAGCTGGAGGG - Intronic
1091370997 11:135057718-135057740 GAAAAGACACAGAAGCTGCTGGG - Intergenic
1092230881 12:6774668-6774690 ACCAATGCACAGAGGCTGGGCGG - Exonic
1094092499 12:26666424-26666446 GCAACTGCACACGAGTTGGTAGG + Intronic
1095557409 12:43523626-43523648 CCAAGTGCACAGGAGCTGGGTGG + Intronic
1100176063 12:92032192-92032214 ATGAAGGCACAGAAGCTGGTTGG + Intronic
1101033402 12:100681519-100681541 GACAAGGCACAGAAGCGGGTAGG - Intergenic
1102722803 12:115032690-115032712 GCAAATGACCAGAAGCTAGAGGG + Intergenic
1103273384 12:119691467-119691489 GCAGATGCTCAGAAGGTGGATGG + Intronic
1103412528 12:120722656-120722678 GCAAAGGAACAGAAGCAGGAGGG - Exonic
1105928609 13:25031902-25031924 GGAATTGCACAGAAGGTGGCTGG + Intergenic
1106053078 13:26209712-26209734 GGAATTGCACAGAAGGTGGCTGG + Intronic
1108126098 13:47244592-47244614 GTAAATGGACAGCAGATGGTAGG - Intergenic
1113579169 13:111416808-111416830 GCATCTGCACAGGAGCTGGGTGG + Intergenic
1114416807 14:22550399-22550421 GGATATGCACAGAAGCTGCAAGG + Intergenic
1116516409 14:45811920-45811942 GCAAATGCACAGAAATTGAGAGG - Intergenic
1118699811 14:68422165-68422187 GCAAATTCAAAGAACATGGTGGG + Intronic
1119464361 14:74843102-74843124 GCAAATTAAGAGAAGATGGTAGG - Intronic
1121576160 14:94989819-94989841 GCAAATGGACAAAAGCAGGTTGG + Intergenic
1130422774 15:83764678-83764700 TCAAATCCACAGAATCTGGCTGG + Intronic
1132252687 15:100346059-100346081 GCAAGTGAAGAGAGGCTGGTGGG - Intergenic
1133440961 16:5820561-5820583 GCAAAAACACAAAAGCAGGTGGG - Intergenic
1133678188 16:8095658-8095680 GCAGGTGCAGAGAGGCTGGTTGG - Intergenic
1137927545 16:52555031-52555053 GCAAATGAACAGCAGCTGATGGG - Intergenic
1142346556 16:89557788-89557810 TCTAATGCAGAGGAGCTGGTGGG + Intergenic
1142479787 17:211944-211966 CCAAATGCACAGAACTTGGAGGG - Intergenic
1145102252 17:20086812-20086834 TCAAATGCACGGAAGCATGTTGG + Intronic
1147137175 17:38441143-38441165 GCAAATACACAGCAGCAGGCAGG - Intronic
1147196063 17:38767639-38767661 CCAAATGCAGAGAAGCCGGTAGG + Exonic
1148373307 17:47117635-47117657 GCAAATTCGCAGCTGCTGGTTGG + Intergenic
1149102302 17:52921588-52921610 CTAAATGCACAGAAGCTTTTAGG - Intergenic
1151086855 17:71389984-71390006 ATGAATGCACAGAAACTGGTAGG + Intergenic
1151162274 17:72175665-72175687 GCAAAGGCAGAGAAGCAGGGAGG - Intergenic
1152041026 17:77903105-77903127 GCAACATCACAGAAGTTGGTGGG - Intergenic
1152242953 17:79169654-79169676 GCAAATCCACAGAGGCTGGCAGG + Intronic
1161018935 19:1998789-1998811 GCAGGGGCACAGACGCTGGTGGG + Intronic
1162958843 19:14114418-14114440 GCCAAGGCACAGAAGGTGTTTGG + Intronic
1165225805 19:34353717-34353739 GCACATGGACAGCAGCTGGCTGG - Exonic
1167376153 19:49113334-49113356 GCCAAAGCACAGAAGATGGGTGG - Intergenic
1168249131 19:55131493-55131515 GCAAATCCACAGAAGTAGGAAGG - Intergenic
1168722872 19:58563824-58563846 GCAAATGCAGGGAAGTGGGTGGG + Intronic
925844179 2:8020645-8020667 GGAAACGAGCAGAAGCTGGTGGG - Intergenic
926693886 2:15757143-15757165 GTAAATCCACAAAAGCAGGTTGG + Intergenic
926933428 2:18063086-18063108 ACAAATGCACAGAGCCTGGCCGG - Intronic
926943108 2:18158842-18158864 GCAAAAGCACAGATGGTGGCTGG + Intronic
928688772 2:33777172-33777194 GGAAATGGACAGAAGCTGAGGGG - Intergenic
929870009 2:45751096-45751118 GCAAAGGCACAGAGGCTGAAAGG - Intronic
930324606 2:49899648-49899670 GCAGATACACAGAATCTGTTTGG - Intergenic
932713025 2:74081602-74081624 GCAAAGGCAGAGAGGCTGGGTGG + Intronic
933523603 2:83407372-83407394 GCAGATGCACTCAATCTGGTGGG + Intergenic
934938235 2:98480664-98480686 GCAAATGCACGGGAGCTAGCTGG - Intronic
939962989 2:148582525-148582547 GCAAATGTTGAGAAGCTAGTTGG + Intergenic
940720009 2:157271675-157271697 GGAAATGCAGAGGAGCTGGTTGG + Intronic
940857931 2:158744225-158744247 TCCAATTCACAGAAGGTGGTGGG + Intergenic
946874048 2:224110559-224110581 CCAAGTGCATAGGAGCTGGTGGG + Intergenic
947907375 2:233775245-233775267 GCAAATGAACATGAGCTGGCTGG - Intergenic
948138451 2:235655197-235655219 TTAAATGTACAGAAGCTGGAAGG + Intronic
1170055617 20:12199683-12199705 GCAAAGGGAGAGCAGCTGGTAGG + Intergenic
1170379844 20:15745819-15745841 GAAAGAGCACAGAAGCTGATGGG - Intronic
1171019061 20:21568621-21568643 GCAGAAGCAGAGAAGCTGGTAGG - Intergenic
1172624388 20:36338895-36338917 GCAAAGGCACCGAGGCAGGTGGG + Intronic
1172651710 20:36507657-36507679 GCAAAGACACAGAAGCAGGAAGG + Intronic
1173739172 20:45384593-45384615 GCAAATGCACAGAAAAAGGAAGG - Intronic
1173938640 20:46891239-46891261 GCAGATGAGCAGAAGCTGATAGG - Intergenic
1173953798 20:47015093-47015115 GCATATGCACAGAACCTGTCTGG + Intronic
1174662594 20:52227127-52227149 TGAAATGCACAGCAGCTGGATGG - Intergenic
1175486451 20:59350262-59350284 GCAAACACACAGAAGCCGGGTGG + Intergenic
1176310315 21:5145777-5145799 CAAACTCCACAGAAGCTGGTGGG + Intronic
1177519593 21:22201364-22201386 CCAGCTGCATAGAAGCTGGTAGG - Intergenic
1178357253 21:31919384-31919406 GCATTTGCACAGAAGTTGGAAGG + Intronic
1179846740 21:44116258-44116280 CAAACTCCACAGAAGCTGGTGGG - Intronic
1182931215 22:34176084-34176106 GCAGATGCACAGCAGGTGGTGGG + Intergenic
1183308860 22:37098411-37098433 GCCAAAGCCCAGAAGATGGTAGG - Exonic
1184105954 22:42367747-42367769 GCAAAGGGACAGAAGGTGATGGG + Intergenic
1184382193 22:44151879-44151901 GCAAAACCACAGAAGCTGGGAGG - Intronic
1184806139 22:46796105-46796127 GCAAGGGCACTGAGGCTGGTGGG + Intronic
950662676 3:14476457-14476479 CCAAAGGAAAAGAAGCTGGTTGG - Intronic
950842301 3:15979193-15979215 GAAGATGCAAAGCAGCTGGTGGG - Intergenic
951584446 3:24201144-24201166 GAAAATGAAGAGAAGCAGGTAGG + Intronic
952901117 3:38112285-38112307 GTCAATGCACAGCTGCTGGTAGG - Exonic
953646745 3:44762255-44762277 AGAAATACGCAGAAGCTGGTGGG - Intronic
960460793 3:117932540-117932562 CCAAATGCAGAGAAGCTTTTTGG - Intergenic
962764836 3:138551991-138552013 GCAAATGGACAAAAGCGAGTAGG + Intronic
962886856 3:139635614-139635636 GCACTAGCACAGTAGCTGGTAGG - Intronic
962982389 3:140502287-140502309 GCAAATGAACACAGGCTTGTGGG + Intronic
964899491 3:161640996-161641018 GAAAAAGAACAGAAGTTGGTTGG - Intergenic
969000400 4:3976172-3976194 GAAAATGCAGGGAAGGTGGTTGG - Intergenic
969863272 4:10054255-10054277 CCAGAGGCACAGAAGCGGGTTGG - Intronic
973537392 4:51897021-51897043 GCAAAGGCCCAGAAGCAGATGGG - Intronic
973937900 4:55869069-55869091 TCAAATGCACAGCACCTGCTGGG + Intronic
974096983 4:57374469-57374491 GCAAAGACACAGGGGCTGGTGGG + Intergenic
974611976 4:64229316-64229338 GCAAGTGCCCAGAAGCAGGCTGG + Intergenic
976799294 4:88970910-88970932 GAAAAAGCACAGAAGTTGGCCGG + Intronic
977316592 4:95456987-95457009 GCAAATGCACAGAATTTTCTGGG - Intronic
977475284 4:97499716-97499738 GCAAATGAACAAAGGCTGGAAGG + Intronic
979006744 4:115308731-115308753 GTGCATGCACAGAAGGTGGTGGG + Intergenic
979692824 4:123578341-123578363 CAAAATCCACAGAAGATGGTTGG - Intergenic
981264645 4:142767827-142767849 ACAGATGCACAGGAGCTGGTGGG - Intronic
981520696 4:145659247-145659269 GCAAATCCACAGAAGCTTCATGG - Exonic
985471696 5:50793-50815 GCACAAGCACCGAAGCGGGTGGG - Intergenic
992849461 5:80791819-80791841 ATAAATGCACAGAAGAAGGTTGG + Intronic
992879174 5:81088181-81088203 GGAAAGGCACAGAGGCTGGCAGG - Intronic
993468714 5:88280338-88280360 CCAAATGGAAAGAAGCTTGTGGG - Intergenic
993938170 5:94027957-94027979 GCAAATGGACACCAGCTGGGGGG - Intronic
995987605 5:118198358-118198380 GCAAATGCATAAATCCTGGTAGG + Intergenic
996022783 5:118610191-118610213 TCTGATGCACAGAAGCTGGATGG + Intergenic
996507720 5:124287018-124287040 TCAAATGAAAAGAAGCTGGAAGG - Intergenic
996975192 5:129424165-129424187 GCAGATTCACAGAAGGTAGTGGG - Intergenic
997430102 5:133831732-133831754 GCAAAAGCACAAGAGCTGTTTGG + Intergenic
998419811 5:141973532-141973554 GAAAATGCACAGAGGCTGGCCGG - Intronic
999245837 5:150154241-150154263 GCAAATGCCCACAAGCAGGATGG + Intronic
999702761 5:154243284-154243306 GCAAATGCTCAGAAGTGAGTGGG - Intronic
1000488190 5:161875089-161875111 CCAAATGCATAGAAGAAGGTAGG - Intronic
1000644107 5:163740291-163740313 GTAAATGGACAGCAGATGGTGGG - Intergenic
1000880750 5:166694075-166694097 AAAAGGGCACAGAAGCTGGTAGG - Intergenic
1001550298 5:172597940-172597962 GCAAATGGAAATAAGCTGGATGG - Intergenic
1002614337 5:180441542-180441564 GCAAAAGCACACAAGCCTGTGGG + Intergenic
1003082184 6:3030068-3030090 GCAAATACTCAAAAGCAGGTAGG + Intergenic
1003238732 6:4322792-4322814 GGAAAGGCAAAGAAGCTGCTGGG - Intergenic
1003728766 6:8796339-8796361 ACAAATGCGCAGAAGAAGGTGGG + Intergenic
1006714667 6:36108962-36108984 GCTAGTGCACAGAAGCCAGTTGG - Exonic
1007961038 6:45959796-45959818 GGAAATGCACATAAGCTCTTTGG - Intronic
1008092687 6:47309121-47309143 TCAAATGCGCAGAAGCTGGGCGG + Intronic
1008731201 6:54484711-54484733 GAAAATGCACAGGAGCTGGGAGG - Intergenic
1010669077 6:78665354-78665376 GTAAATGGATAGTAGCTGGTGGG + Intergenic
1011173815 6:84537713-84537735 GAAAGTGTACAGAATCTGGTAGG + Intergenic
1011527692 6:88282792-88282814 GTAAAGGCAGAGAAGGTGGTGGG + Intergenic
1011986278 6:93450760-93450782 GTAATTGCAGAGAAGCTGGAAGG + Intergenic
1013000151 6:106013793-106013815 GCAAGTGAACAGAGGCTGGGAGG - Intergenic
1014411036 6:121121315-121121337 GCAAATGCGCAGAATGTGTTTGG + Intronic
1016366416 6:143323366-143323388 CCAAATGTACAGAATCTGGGAGG - Intronic
1016377010 6:143431585-143431607 TCAAATGCACAGAAGTTGATAGG + Intronic
1019079042 6:169415738-169415760 ACAATTGCACAAAAGATGGTGGG + Intergenic
1019831838 7:3338099-3338121 GCAAATTAACAGAAGATGGTTGG - Intronic
1020997306 7:15280285-15280307 CCAAATGCATGGAAGCTGGGTGG + Intronic
1021728414 7:23572631-23572653 GCAAATGCACCTCAGCTGCTAGG - Intergenic
1021781970 7:24115066-24115088 TAAAAAGCACAGAAGCTGGAGGG + Intergenic
1023447221 7:40244338-40244360 ACAAATGCAGAGAAGCAGGAAGG + Intronic
1023858873 7:44204660-44204682 GCACACGCACAGAAGTTGGAGGG - Intronic
1026844359 7:73689630-73689652 GCAGAGGCACAGATGCCGGTGGG + Intronic
1028648096 7:93120554-93120576 ACAAATGCACTGGAGGTGGTTGG + Intergenic
1028733002 7:94174654-94174676 GCAAATTCACAGAACCTGAAGGG + Intergenic
1028879501 7:95864296-95864318 ACAAATGGACAGAACCTGGGTGG + Intronic
1030232907 7:107226580-107226602 ACAACTGCAAAGAAGCTGGCAGG + Intronic
1033604841 7:142919297-142919319 ACAAATGCACACAATGTGGTAGG + Intronic
1033668409 7:143465605-143465627 AAAAATGCACAAAATCTGGTAGG - Intergenic
1034231301 7:149530686-149530708 GCAACTGCTCAGAAGCAGGCTGG - Intergenic
1037116531 8:15236047-15236069 GCAAAAACACAGAAACTTGTTGG + Intronic
1038325281 8:26568182-26568204 GGAAGTGCCCAGAAGCTGGAGGG + Intronic
1038627564 8:29208918-29208940 GCAGATGCACAGAGGCAGGCAGG - Intronic
1041289760 8:56297570-56297592 GCAAATGCACAGAAGGAGCTTGG + Intergenic
1042957971 8:74271988-74272010 GCAACTGCACAGAAACTCGAGGG + Intronic
1043994334 8:86794165-86794187 CCAAATGCACAAAACCTAGTAGG - Intergenic
1044206022 8:89492729-89492751 GCAAGAGTACAGAAGCAGGTTGG + Intergenic
1045660503 8:104432626-104432648 GCAAATACATAGAAGCAGCTTGG + Intronic
1045812940 8:106245056-106245078 GCAATTGCACAGAGACTTGTAGG - Intergenic
1047991196 8:130288466-130288488 GTAAATGCACAGCTGCAGGTAGG - Intronic
1048630847 8:136240723-136240745 GAAAATGAGCAGAAGCTGGCTGG - Intergenic
1049035745 8:140074507-140074529 GGAGATGCACAGAAGATGGCAGG + Intronic
1049185834 8:141252640-141252662 GGAAATTCACAGACGCAGGTGGG - Intronic
1049185846 8:141252744-141252766 GGAAATTCACAGACGCAGGTGGG - Intronic
1049443816 8:142620992-142621014 TCAATTGCACAGAGGGTGGTGGG - Intergenic
1050023741 9:1311467-1311489 GCAAGGGCACTGATGCTGGTTGG + Intergenic
1051606695 9:18923798-18923820 GTCTATGGACAGAAGCTGGTGGG + Intergenic
1051746545 9:20300075-20300097 GTAAATACACAGATGATGGTTGG + Intergenic
1052575211 9:30282402-30282424 GCAAATGCCCAGAAGCAGGGTGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1054957321 9:70927718-70927740 GCAAAGTCACAGCATCTGGTAGG + Intronic
1056204916 9:84310462-84310484 CCAATGGTACAGAAGCTGGTGGG + Intronic
1056338688 9:85602747-85602769 GGAAATGCACTGAAGAGGGTAGG + Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058426781 9:104882378-104882400 GCAAGGGGACAGAGGCTGGTGGG - Intronic
1059518093 9:114914312-114914334 GGGTATGCAGAGAAGCTGGTAGG - Intronic
1059739438 9:117135385-117135407 CCAAATGCTCAGTAGATGGTAGG + Intronic
1059846250 9:118280245-118280267 GTAATAGCACAGAACCTGGTCGG + Intergenic
1059887978 9:118768249-118768271 GCAAAGGCACAGAGGCAGGAAGG - Intergenic
1060154662 9:121310924-121310946 ACAAATGCATAGATGCAGGTGGG + Intronic
1060394694 9:123307232-123307254 GCAAAAGCACAGATGCCGGGGGG + Intergenic
1062227814 9:135463457-135463479 GCCAATGCACAGCTGCTGCTGGG + Intergenic
1188656827 X:32707433-32707455 GCAAATGCACAGAAGCTGGTGGG + Intronic
1189080335 X:37964329-37964351 ACAAAAGAACATAAGCTGGTTGG - Intronic
1189950265 X:46222606-46222628 ACAATTGCACAGAAGTTGGGAGG + Intergenic
1190117046 X:47632492-47632514 GCAAATACATAGTAGCAGGTAGG - Intergenic
1190457567 X:50640768-50640790 GCAAAGGCACAGAATCAGGAAGG - Intronic
1192126032 X:68501696-68501718 ACAAAGGCACAGAAGTTGGAAGG + Intronic
1192689452 X:73346897-73346919 GTCAATGCACAGAAGCTCTTTGG + Intergenic
1193179307 X:78434827-78434849 GCAAAGGCACAAAAGCAGGAAGG + Intergenic
1195981606 X:110584252-110584274 GCAAATCCACAGCAGCTCATAGG + Intergenic
1196007472 X:110851617-110851639 GCAGATGCCCAGAGGATGGTAGG + Intergenic
1196360616 X:114851723-114851745 GCAAATGCTCAAAAGCTGATGGG - Intronic
1196783338 X:119401587-119401609 GCAAATGCACAGAGGTGGGAAGG + Intronic
1199859981 X:151792695-151792717 GCAAAGGCACAGTAGCAGGGAGG - Intergenic
1200324313 X:155221778-155221800 GCAAAGGTACAGAAGTTTGTAGG + Intronic