ID: 1188657244

View in Genome Browser
Species Human (GRCh38)
Location X:32713525-32713547
Sequence ATATAGTAGCTGAAAGGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 449
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 408}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188657244 Original CRISPR ATATAGTAGCTGAAAGGAAA GGG (reversed) Intronic
901894545 1:12299406-12299428 AAATACTAGCTGAACGGAAAAGG - Intronic
902185054 1:14718793-14718815 AGATAAAAGCAGAAAGGAAAGGG - Intronic
903729069 1:25476821-25476843 AAATAGTGGCTGAAGGGAACAGG - Intronic
904164523 1:28545167-28545189 AGATAGGAGCTGAAGGGACACGG - Intergenic
905468318 1:38172745-38172767 ATAAAGCACCTTAAAGGAAATGG - Intergenic
907168777 1:52441162-52441184 ATCTAGTAGCAGAAAGCTAAAGG + Intronic
907256875 1:53185959-53185981 AGATAGGAGCTGAAGGGACATGG - Intergenic
907294921 1:53444674-53444696 AGATAGGAGCTGAAGGGACACGG + Intergenic
907771608 1:57470872-57470894 AAATTGTAGCTCACAGGAAATGG + Intronic
907884622 1:58581298-58581320 ATAATGTAGTTGAAAGAAAATGG + Intergenic
909112562 1:71498126-71498148 ATCTAATAGTTGAAAGGTAATGG + Intronic
909209074 1:72799554-72799576 ATATAATAAATGAAAGGACAAGG - Intergenic
909477841 1:76101588-76101610 AGAAAGTAGAAGAAAGGAAATGG - Intronic
910228556 1:84962648-84962670 AAATAGTACCTGAAAGGTGAGGG + Intronic
910484336 1:87696269-87696291 ATACAGCAACTGAAAGCAAAAGG + Intergenic
910534367 1:88279600-88279622 ATGTAGCAGCTGGAAAGAAATGG - Intergenic
910630707 1:89350961-89350983 GTATAGTATGTGAAAGGAGAAGG - Intergenic
911068268 1:93811526-93811548 ATAGAGAAGCATAAAGGAAAGGG - Intronic
911232125 1:95372648-95372670 ATTGAGTATCTGAAAGGAAAGGG + Intergenic
911373210 1:97019304-97019326 ATATAGTAGCTAAAACAACATGG + Intergenic
911403507 1:97406959-97406981 ATATAGTACCTGCAAGGTTATGG + Intronic
912029616 1:105223458-105223480 ATATAGTAACTGCAAAGATATGG + Intergenic
912206720 1:107517019-107517041 ACATAGTAGCAGAAAGGAGTTGG - Intergenic
912446152 1:109738358-109738380 GTAGGGCAGCTGAAAGGAAAAGG + Exonic
912484479 1:110014257-110014279 GTAAAGTAGAAGAAAGGAAAAGG - Intronic
912659356 1:111514600-111514622 ATATACTAGCAGTAAGGTAATGG - Intronic
913505637 1:119514108-119514130 TTATACTAGCAGAAAGGAATCGG - Exonic
914197421 1:145454673-145454695 ATATAATATCTGTAAGGACAAGG - Intergenic
914444105 1:147734833-147734855 ATATACTGACTGAAAGTAAAGGG - Intergenic
914451404 1:147795474-147795496 ATACAGTCGCTGAAAGCAAATGG - Intergenic
914476521 1:148027696-148027718 ATATAATATCTGTAAGGACAAGG - Intergenic
915747662 1:158177221-158177243 ATACAGTTCCTGAGAGGAAAAGG - Intergenic
916126183 1:161573518-161573540 ATATAGTAGCTCAGAGAAACAGG - Intergenic
916136101 1:161655358-161655380 ATATAGTAGCTCAGAGAAACAGG - Intronic
916609902 1:166381452-166381474 CTAGAGTAACTGACAGGAAAAGG + Intergenic
919959081 1:202448953-202448975 AGATACAAGCAGAAAGGAAATGG - Intronic
921014955 1:211181050-211181072 ATATAGCAGCTGCCAGTAAATGG + Intergenic
921145213 1:212349175-212349197 ATATGCTAGCTAAAAGGTAAGGG - Exonic
921564967 1:216705913-216705935 ATAATGTACCTGGAAGGAAAAGG - Intronic
921776489 1:219106288-219106310 ATATAGTAACTGAAGCCAAATGG - Intergenic
922641823 1:227240761-227240783 ATATAGTAGCTAAAAATAGAAGG + Intronic
923587935 1:235291853-235291875 ATTTACAAGCTGAAAGTAAAGGG + Intronic
923625974 1:235614171-235614193 ATTCAGCAGCTGAAATGAAATGG - Intronic
924048547 1:240057411-240057433 ATATATTAGTTGAACTGAAACGG - Intronic
924354878 1:243161942-243161964 CTATAATAGCTGTATGGAAAAGG - Intronic
1064063493 10:12159937-12159959 ATATATTAGTTGAAGGGAATAGG + Intronic
1066493890 10:35921639-35921661 ACTTAGTAGCAGAAATGAAAAGG - Intergenic
1068017477 10:51535608-51535630 ATGTAGTAGCTTAAATGAGAAGG + Intronic
1068177132 10:53475818-53475840 ATAAAGCATCTGAAAGGAGAAGG - Intergenic
1068721296 10:60249164-60249186 ATATAGCAGTTGAATGGAAAGGG + Intronic
1068853835 10:61776071-61776093 ATATTTCAGCAGAAAGGAAATGG - Intergenic
1068917705 10:62450588-62450610 ATAAAGCAGCAGAAAGGAATAGG - Intronic
1069941128 10:71956186-71956208 AGATAGGAGCTGAAGGGACATGG + Intergenic
1070033671 10:72701439-72701461 CTAAAGGAGCAGAAAGGAAAAGG - Intronic
1071135979 10:82455166-82455188 ATATATTATCTGAAAGTAAATGG - Intronic
1072529934 10:96309559-96309581 ATATAATGACTGAATGGAAAGGG - Intronic
1073054713 10:100691999-100692021 ATAGAGTGTGTGAAAGGAAAGGG + Intergenic
1073674230 10:105627138-105627160 ATATTGTAGGAGAAAGGTAAAGG - Intergenic
1073807873 10:107119139-107119161 ATATAGGAAGTGAAAGGAAAAGG + Intronic
1074623780 10:115155162-115155184 ATATAGAGGCTGAAAATAAAGGG - Intronic
1075324323 10:121518615-121518637 ATATAGAAGCTGAAAAGACTTGG - Intronic
1075488215 10:122844934-122844956 AAATAGAAGAGGAAAGGAAAAGG - Intronic
1076414241 10:130273853-130273875 ATATTTTAGTTGACAGGAAAAGG + Intergenic
1076862274 10:133143972-133143994 AGATAGGAGCTGAAGGGACATGG + Intergenic
1077639746 11:3870850-3870872 AAAGAGTAGCTGATAGGATATGG - Intronic
1078041733 11:7870637-7870659 AGATGGTAGATGAAATGAAATGG - Intergenic
1078806105 11:14706297-14706319 ATACAGTACCTGAAACTAAAAGG + Intronic
1078896126 11:15598877-15598899 ATATGGTAGCTGGATGGAGAAGG - Intergenic
1078941848 11:16015099-16015121 AGATAGAAACTGGAAGGAAATGG - Intronic
1079495905 11:21043794-21043816 ATATAGTAGGGTAAAGGAGAGGG + Intronic
1079496188 11:21047237-21047259 ATATAGCAACTGAAAAGAAAGGG - Intronic
1079671053 11:23171811-23171833 TTATATTAGCTGAAAGGGAACGG + Intergenic
1080053437 11:27880732-27880754 ATAAAGTTACTGAAAGGAAAGGG + Intergenic
1080755769 11:35196612-35196634 ATATAGATGGTGAAAAGAAAGGG - Intronic
1082130453 11:48482196-48482218 TCTTAGTACCTGAAAGGAAATGG - Intergenic
1082186314 11:49186010-49186032 TTATAGTAGCAAAAAGAAAAGGG - Intronic
1082563961 11:54653095-54653117 TCTTAGTACCTGAAAGGAAATGG - Intergenic
1083288621 11:61677353-61677375 AAATGTTAGGTGAAAGGAAAAGG - Intergenic
1085798435 11:79565012-79565034 ATGTGGAAGCTGAAAAGAAAAGG - Intergenic
1085847348 11:80081523-80081545 CTGAAGCAGCTGAAAGGAAAGGG + Intergenic
1085931578 11:81089526-81089548 ATTAAGTAGCTGAAAGCTAAAGG - Intergenic
1086283157 11:85214190-85214212 AAGTAGCAGCTGAAAGGAGAGGG - Intronic
1086680020 11:89659361-89659383 TTATAGTAGCAAAAAGAAAAGGG + Intergenic
1086721307 11:90124746-90124768 AGATACTTGCTGAAAGCAAAGGG + Intergenic
1087010870 11:93512951-93512973 ATCTAGAAGCTGAAAGGCAGTGG + Intronic
1087250863 11:95898053-95898075 ATGTAGTATTTGAAAGAAAAAGG - Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1087684088 11:101244191-101244213 AAATACTAACTGAAAAGAAAAGG + Intergenic
1088050867 11:105514183-105514205 ATATATAAGCTGAAAGATAATGG + Intergenic
1088062667 11:105675047-105675069 TTATAGTAGCTGACAGGCAGAGG + Intronic
1089074087 11:115723549-115723571 GCAGAGTAGCTGAAAGCAAAGGG - Intergenic
1090325249 11:125880612-125880634 AATTAGTAGCAAAAAGGAAATGG + Intergenic
1090467466 11:126947534-126947556 ACAGCGTAGCTAAAAGGAAAAGG + Intronic
1091495516 12:969175-969197 ATACAGTTGCTGATATGAAATGG - Intronic
1091863017 12:3803879-3803901 TTATAGTAACTGCTAGGAAAAGG - Intronic
1092694849 12:11159936-11159958 ATATAGTAGCTGACTGAAAGTGG - Intronic
1092940819 12:13405406-13405428 AGAGAGTGGCTGACAGGAAATGG + Intergenic
1093891436 12:24526219-24526241 GTGTAGTAGCTGGAAAGAAATGG + Intergenic
1094309019 12:29056961-29056983 ATGTATTAGCTTAAAGGTAAAGG - Intergenic
1094477307 12:30851191-30851213 AGATAGGAGCTGAAGGGACATGG + Intergenic
1094789908 12:33900543-33900565 ATATAGGAGGAGAAAGGAGAAGG - Intergenic
1095280845 12:40351147-40351169 TTCTAGTAGTTGAAAGGAACAGG - Intronic
1095321719 12:40837065-40837087 ATATTTTAGTTAAAAGGAAAGGG - Intronic
1095527306 12:43142657-43142679 ATCTTGTATCAGAAAGGAAAGGG - Intergenic
1097997323 12:65903132-65903154 ATAAAGCAGCTGAAGGGAAATGG - Intronic
1098073777 12:66704063-66704085 ATATAGTAGATGACAATAAAAGG + Intronic
1098661101 12:73094579-73094601 ACATAGTAGCAGAAAAGAGAAGG - Intergenic
1099387070 12:82027413-82027435 TAAAAGTAGCTTAAAGGAAAGGG + Intergenic
1100134586 12:91539386-91539408 ATATATTAGATGAAATAAAAGGG - Intergenic
1100669095 12:96790420-96790442 ATATAGTATTTGAAAGGTAATGG + Intronic
1105287080 13:19013255-19013277 AGATAGGAGCTGAAGGGACATGG + Intergenic
1105329302 13:19400145-19400167 ATATAGTATCTGCAATGAAAAGG + Intergenic
1105862552 13:24429124-24429146 ATATAGTATCTGCAATGAAAAGG - Intronic
1105890410 13:24678690-24678712 ATTTAGCATCTGAAAGGAACAGG + Intergenic
1106627702 13:31437480-31437502 ATACAGCTTCTGAAAGGAAAGGG + Intergenic
1106911808 13:34471124-34471146 ATATAGGAGCAGAAAAAAAAGGG + Intergenic
1107573623 13:41691459-41691481 AAACTGTATCTGAAAGGAAATGG + Intronic
1107579988 13:41772833-41772855 AGATAGTATCTGCAAGAAAAAGG + Intronic
1107788784 13:43980083-43980105 ATGCAGTAGCTGAAATGATATGG + Intergenic
1108307011 13:49147426-49147448 ATAGAGTAGCTGGGAGGTAAGGG + Intronic
1108932593 13:55846190-55846212 TTTTAATAACTGAAAGGAAATGG + Intergenic
1109091046 13:58046486-58046508 AGATGGTAGCTGAAAGTACAAGG + Intergenic
1109290855 13:60473681-60473703 AGATAGGAGCTGAAGGGACATGG + Intronic
1109598217 13:64586010-64586032 ACACATTAGCTCAAAGGAAATGG + Intergenic
1111159980 13:84382386-84382408 ATAAAGTTGCTGAAAGGGCAGGG + Intergenic
1111561711 13:89958725-89958747 ATAGAGTAATTGAAAGCAAAAGG - Intergenic
1111605390 13:90532014-90532036 CTATAGTGTCTGAAAGGACATGG - Intergenic
1112385634 13:98937166-98937188 ATTTATTAGCGGAATGGAAATGG - Intronic
1113820818 13:113211161-113211183 ATATAGTAACAGAAAGCAAATGG - Intronic
1114221324 14:20700184-20700206 ATATAGAAGCTCAAAGTTAAGGG + Exonic
1114301340 14:21381575-21381597 AGATGGAAGCTGAAAGCAAAAGG + Intronic
1115207449 14:30924862-30924884 ATATATTTACAGAAAGGAAAGGG + Intronic
1115236041 14:31209212-31209234 ATGTAGACACTGAAAGGAAAGGG + Intergenic
1115854285 14:37612778-37612800 ATATAGTAGCAGCAAGCAACTGG - Intronic
1115909536 14:38240379-38240401 ATAGAGTACCTGGATGGAAAAGG + Intergenic
1116185695 14:41598109-41598131 ATATTGTAACTGAAATGCAATGG - Intergenic
1116471268 14:45288456-45288478 ATATGCAAGATGAAAGGAAATGG + Intergenic
1116649853 14:47576170-47576192 AAATAGTATCTGTAATGAAATGG - Intronic
1117651592 14:57913130-57913152 ACAAAGTAGGTTAAAGGAAAGGG - Intronic
1118420865 14:65601628-65601650 ATTTAGTAGGTGATAGGCAACGG + Intronic
1118704997 14:68472176-68472198 ATCTGGCAGCAGAAAGGAAAGGG + Intronic
1119955326 14:78792216-78792238 ACAAATTATCTGAAAGGAAAAGG + Intronic
1120357194 14:83449774-83449796 CTCTAGAAGCTGGAAGGAAATGG + Intergenic
1120591697 14:86382083-86382105 ATACAGTAGCTGAATGGAAATGG - Intergenic
1121201890 14:92124332-92124354 AAAAACTAGATGAAAGGAAATGG + Intronic
1202844148 14_GL000009v2_random:151343-151365 ATTTAGGGGTTGAAAGGAAACGG + Intergenic
1202913538 14_GL000194v1_random:141586-141608 ATTTAGGGGTTGAAAGGAAATGG + Intergenic
1202890172 14_KI270722v1_random:149064-149086 AGATAGGAGCTGAAGGGACATGG - Intergenic
1123434835 15:20247596-20247618 ATAAAGGAGAGGAAAGGAAAGGG + Intergenic
1123818410 15:24002302-24002324 ATATAGTAGCTGCAATTAGAGGG + Intergenic
1127398196 15:58560145-58560167 ATTTAGTTACTGAAAGCAAATGG - Intronic
1127450085 15:59108120-59108142 AGATGATAGCTGACAGGAAAGGG + Intronic
1128539986 15:68520596-68520618 ATAGTGAAGCTGAAAGTAAACGG - Intergenic
1133108104 16:3527331-3527353 ATATAGGAGCTGAGGGGACATGG + Intronic
1133195844 16:4169624-4169646 TCATAGGAGCTGAAAGAAAATGG - Intergenic
1135330998 16:21559666-21559688 TTCTAGTATATGAAAGGAAAAGG + Intergenic
1139068926 16:63356158-63356180 AGATAGGAGCTGAAGGGACATGG - Intergenic
1141231705 16:82173362-82173384 ATATAGTAGTTGGCAGGAATTGG - Intergenic
1141355430 16:83340996-83341018 AAATACTTGCTCAAAGGAAATGG - Intronic
1143418058 17:6764692-6764714 AGATGGTAGCTTATAGGAAATGG - Intronic
1146628404 17:34452414-34452436 CTATGGTAGCTGAAAAGTAAAGG - Intergenic
1147836306 17:43334443-43334465 AGATAGGAGCTGAAAGGACACGG - Intergenic
1148424615 17:47583275-47583297 TTATAGTAACTAAAAGCAAAAGG + Intronic
1149944936 17:60914476-60914498 TTATAATATATGAAAGGAAAGGG + Intronic
1150963282 17:69938243-69938265 CTATAGTAGGTGATAGGGAAAGG + Intergenic
1155011638 18:21784661-21784683 ATATAGGAGCTGAAGGGACATGG + Intronic
1155670081 18:28359469-28359491 AGATAATAGCTGGAAGTAAAAGG - Intergenic
1155701402 18:28748466-28748488 ATTTCATAGCTGCAAGGAAAAGG - Intergenic
1155928989 18:31685721-31685743 ATGCTGTACCTGAAAGGAAAAGG + Intronic
1156064869 18:33128168-33128190 GTGTAGTAACTGAAAGGAATGGG - Intronic
1156239269 18:35236626-35236648 ATATAATAGGTGTAATGAAATGG + Intergenic
1156342737 18:36225846-36225868 AAATAGTAGCAGCAAGAAAATGG - Intronic
1156969941 18:43141952-43141974 ATATAGTAATTAAAAGGACAGGG - Intergenic
1157209924 18:45733658-45733680 CTACAGTGGCTGAGAGGAAAGGG - Intronic
1157366783 18:47072254-47072276 ATATAGTAAAAGAAAGGAAGAGG - Intronic
1158070409 18:53463221-53463243 ATATAAAAGACGAAAGGAAAAGG - Intronic
1158116639 18:54003621-54003643 AGATATGAGATGAAAGGAAAGGG + Intergenic
1158568646 18:58577338-58577360 ATAAAGTAGCTCAAAAGAAGTGG - Intronic
1159289829 18:66402264-66402286 ATATAGGAGCGGAATGAAAATGG - Intergenic
1160057468 18:75497039-75497061 ATATAGTAGTTGAAAGGGAGAGG - Intergenic
1161832692 19:6619724-6619746 ATATATGGGCTGAAAGTAAAAGG + Intergenic
1161834122 19:6633469-6633491 AGATAGGAGCTGAAGGGACATGG - Intergenic
1162008196 19:7793401-7793423 AGATAGGAGCTGAAGGGACATGG - Intergenic
1162236263 19:9312161-9312183 AGATAGGAGCTGAAGGGACATGG + Intergenic
1162281803 19:9704436-9704458 ATATATTAGCTAAAATTAAAGGG + Intergenic
1162638598 19:11989104-11989126 AGATAGGAGCTGAAGGGACACGG - Intergenic
1167845879 19:52163679-52163701 ATATAATCACTGAAAGGAACAGG + Intronic
1168039488 19:53746557-53746579 AGATAGGAGCTGAAGGGACACGG - Intergenic
1202665592 1_KI270708v1_random:115896-115918 AGATAGGAGCTGAAGGGACATGG - Intergenic
925103037 2:1265810-1265832 ATATGGCAGCAGAAAGGAAGGGG - Intronic
925834145 2:7927968-7927990 ATATAGTAGCTGAAACAATTTGG - Intergenic
925909055 2:8560306-8560328 ATACAGAAGCTGAAAGTGAAGGG + Intergenic
928422403 2:31148836-31148858 TTATAGAAACTGAATGGAAATGG + Intronic
928970759 2:37026223-37026245 ATATACAAGCTGGAAAGAAAAGG + Intronic
929969107 2:46558472-46558494 AAATAGAAGCTGAAAGACAATGG - Intronic
931155425 2:59623204-59623226 ATATAGTATCTGTTGGGAAAAGG + Intergenic
931639346 2:64368216-64368238 TTATAGTACATAAAAGGAAATGG + Intergenic
932355202 2:71062698-71062720 GTAAAGTTGCTGCAAGGAAATGG - Intergenic
932821026 2:74900790-74900812 AGTTAGTAGCTGAATGGCAACGG - Intergenic
935851551 2:107226491-107226513 AGATAGTAGAAGAAAGGAAATGG - Intergenic
936144372 2:109969965-109969987 AGATAGGAGCTGAAGGGACACGG + Intergenic
936181055 2:110267925-110267947 AGATAGGAGCTGAAGGGACACGG + Intergenic
936200316 2:110401504-110401526 AGATAGGAGCTGAAGGGACACGG - Intergenic
936225260 2:110643489-110643511 ATATATGAGCTAAAAGGAAATGG - Intronic
937051089 2:118890858-118890880 AGTTATTAACTGAAAGGAAAAGG + Intergenic
938172862 2:129096985-129097007 ATATAGTAAAAGAAATGAAAAGG - Intergenic
939261792 2:139820228-139820250 ATATACCTTCTGAAAGGAAAAGG - Intergenic
939842176 2:147202577-147202599 TGAAAGTAGCTGAAAGAAAAGGG + Intergenic
940021212 2:149157716-149157738 ATCTAATAGTTGAAAGAAAAGGG - Intronic
940427413 2:153545898-153545920 ATCCAGTGGCTGACAGGAAATGG + Intergenic
940760489 2:157733486-157733508 ATATATAAACTGAAAGGCAAGGG + Intergenic
941267961 2:163387000-163387022 TTATTTGAGCTGAAAGGAAAAGG - Intergenic
941459248 2:165748010-165748032 AAATACTAGAAGAAAGGAAAAGG + Exonic
941561416 2:167050222-167050244 ATGTAACAGCTGAAAGGTAACGG - Intronic
941706471 2:168663948-168663970 ATATAGTTGCTGGGAGAAAAGGG - Intronic
941882633 2:170496961-170496983 ATAAAGGAGAAGAAAGGAAAGGG + Intronic
942413156 2:175732560-175732582 ATAGTCTAGCTGAGAGGAAAAGG + Intergenic
942490193 2:176482250-176482272 ATGTTGGAGCTGAAAGGACAAGG - Intergenic
942576231 2:177366234-177366256 ATATATTAGCTTAAATGATAAGG - Intronic
942874491 2:180777991-180778013 AGAAAGTCGCTGGAAGGAAAGGG + Intergenic
942895478 2:181048069-181048091 CAGTAGAAGCTGAAAGGAAAGGG - Intronic
943233710 2:185291152-185291174 AGATAGGAGCTGAAGGGACATGG + Intergenic
943704340 2:191019260-191019282 AAATGGTAGCTGGAAGGAGAGGG - Intronic
943862444 2:192885647-192885669 CTATACATGCTGAAAGGAAAGGG - Intergenic
944420539 2:199525371-199525393 ATATAGTTGCTGAAAGAAATAGG + Intergenic
945592532 2:211752092-211752114 TCATTGTAGCTGACAGGAAAAGG + Intronic
945664825 2:212727560-212727582 AGATAATTGCTGAATGGAAAAGG - Intergenic
946479701 2:220042631-220042653 ATATATTAGGTGAAAGGAGTAGG - Intergenic
946546172 2:220746402-220746424 ATATAGTATGTGAAATGTAAAGG - Intergenic
948744829 2:240081328-240081350 ACATAGTGGCTAAAAGTAAAAGG + Intergenic
1169942144 20:10948703-10948725 ATATAGAAATTGAAAGAAAACGG - Intergenic
1170264533 20:14450780-14450802 ACATAGTACCTGAAGGAAAAGGG + Intronic
1170297126 20:14839985-14840007 ATATACTAGCTGCAAGTAGAAGG - Intronic
1170452198 20:16495185-16495207 ATAAAGGTGCTGAAAGGAAAAGG - Intronic
1170721430 20:18883233-18883255 ATATAAAAGCAGAGAGGAAAAGG - Intergenic
1172352677 20:34255682-34255704 AGATAGGAGCTGAAGGGACACGG + Intronic
1173240290 20:41289653-41289675 TTAAAGCTGCTGAAAGGAAATGG - Intronic
1176632896 21:9156263-9156285 ATTTAGGGGTTGAAAGGAAACGG + Intergenic
1177093786 21:16805318-16805340 ATACAATATCTGAAATGAAAAGG + Intergenic
1177897570 21:26872452-26872474 AGATAGGAGCTGAAGGGACACGG - Intergenic
1178420398 21:32438542-32438564 GTATAAGAGCTGAAAGCAAAAGG + Intronic
1180332307 22:11492816-11492838 AGATAGGAGCTGAAGGGACATGG - Intergenic
1180836287 22:18931190-18931212 ATACAGCAGCTGAAAGGCAAAGG + Exonic
1183074883 22:35420517-35420539 ATAAAGTAGCTTAAAGAAATAGG + Intronic
1183226728 22:36555481-36555503 ATATAGCACCAGAAAGGAGATGG + Intergenic
1183245277 22:36688556-36688578 AAAAAGTAGCTGAAATGAAATGG + Intronic
1183506106 22:38209898-38209920 AGATAGTATCTGAAAGGTCAGGG + Intronic
1184991307 22:48171749-48171771 ACATAGATGCTGAAAGGAAGAGG - Intergenic
1185350522 22:50334360-50334382 AGATAGGAGCTGAAGGGACACGG - Intergenic
1185355692 22:50368436-50368458 AGATAGGAGCTGAAGGGACATGG - Intronic
1203286379 22_KI270734v1_random:156489-156511 ATACAGCAGCTGAAAGGCAAAGG + Intergenic
949311460 3:2703333-2703355 ATATAATAGCTTACATGAAATGG + Intronic
951149775 3:19275145-19275167 ATAAAGATGCTGAAAAGAAAAGG + Intronic
951259677 3:20492888-20492910 ATATATAAACTGAAAGTAAATGG - Intergenic
953465300 3:43114584-43114606 ATATAGTAGCTCAAAGCAAATGG + Intergenic
954903828 3:54042883-54042905 ATATTGTAGGTGAAAAGAAAAGG - Intergenic
955185001 3:56706622-56706644 ATATAGTATCAGAATGAAAATGG + Intergenic
955209879 3:56930753-56930775 ATGTAGTAAGTGAAGGGAAATGG + Intronic
955353609 3:58212003-58212025 AAATAGTACATGGAAGGAAATGG + Intronic
957090310 3:75723610-75723632 AGATAGGAGCTGAAGGGACATGG + Intronic
958854290 3:99365804-99365826 AAATTGTAGCTGAAAAGAATTGG + Intergenic
959187013 3:103057330-103057352 ATTTAGTTTGTGAAAGGAAAAGG + Intergenic
959442954 3:106401513-106401535 CTATAATAGCTAAAAGGAGAGGG + Intergenic
959446010 3:106440797-106440819 ATCCTGTAGCTGAAAGGATATGG + Intergenic
959666456 3:108927630-108927652 ATACAGGATATGAAAGGAAAAGG - Intronic
960281872 3:115789393-115789415 ATCAAATAGCTTAAAGGAAAAGG + Intergenic
960476143 3:118131103-118131125 AAGTATAAGCTGAAAGGAAAAGG + Intergenic
961495831 3:127290357-127290379 CTAGAGTGGCTTAAAGGAAAAGG - Intergenic
962070984 3:132033933-132033955 ATAAAGTAGCCAGAAGGAAAGGG - Intronic
962126630 3:132626261-132626283 AAATAGTAGCTTATAGGAAGAGG + Intronic
962299445 3:134224799-134224821 AGATAGGAGCTGAAGGGACATGG - Intronic
963331120 3:143917506-143917528 ATATACTAGGTGAAAGGAATGGG + Intergenic
963991115 3:151655421-151655443 ACCTAGTAGATGAGAGGAAAAGG - Intergenic
963996741 3:151718249-151718271 AGATATTAGCATAAAGGAAAAGG - Intergenic
964336654 3:155661680-155661702 ATCTAGTATCAGAGAGGAAAGGG - Intronic
965352049 3:167625562-167625584 GTATTCTAGCTTAAAGGAAAAGG + Intronic
966759450 3:183403798-183403820 GTATAGTATGGGAAAGGAAAGGG + Intronic
967269254 3:187719445-187719467 ATTTAGTAGTTGGAAGGGAAGGG - Intronic
967467938 3:189828855-189828877 TAATAGTAGCTTAAAGAAAACGG + Intronic
967532309 3:190562862-190562884 ATATAAGAGCTGGAAGGAAGAGG + Intronic
968680151 4:1913126-1913148 AGATAGGAGCTGAAGGGACACGG + Intronic
968719392 4:2189221-2189243 ATAGAATAGCTGAATGGATAAGG + Intronic
968846773 4:3047489-3047511 AGATAGGAGCTGAAGGGACAGGG + Intergenic
969985549 4:11206239-11206261 GTAAAGTTGCTGAAAGGAAAGGG - Intergenic
970570604 4:17377769-17377791 GTATAGTGCCTGAAAGGAAGGGG - Intergenic
970926068 4:21453787-21453809 ATGTGCTAGCTGAAAGGAGATGG - Intronic
971447120 4:26762857-26762879 TTCTAGAAGCTGGAAGGAAATGG + Intergenic
971549075 4:27926597-27926619 ATCTAGCAGGTGATAGGAAATGG - Intergenic
974243398 4:59282264-59282286 AAATGCTTGCTGAAAGGAAAGGG - Intergenic
974454381 4:62107260-62107282 AAATAAGAGTTGAAAGGAAAGGG - Intergenic
975334264 4:73157596-73157618 CTTTAGTATCTGAAATGAAAGGG - Intronic
975626430 4:76353323-76353345 ATGTAGATGCTGAAAGGTAATGG + Intronic
976607926 4:86999948-86999970 CTGTAGTAACAGAAAGGAAAGGG + Intronic
976945060 4:90755017-90755039 AGATAGTAGTTGGGAGGAAATGG + Intronic
976963535 4:91008566-91008588 AAATATTTGCTGAAAGTAAAAGG - Intronic
978217947 4:106229622-106229644 CTATAGTAACTGAAACAAAATGG - Intronic
979168839 4:117573294-117573316 ATTTAGTCCCTGAAAAGAAAAGG - Intergenic
979246925 4:118517700-118517722 CTATAATAGCTGTATGGAAAAGG + Intergenic
979700634 4:123663307-123663329 ATATTGTGGCATAAAGGAAATGG - Intergenic
980397123 4:132228057-132228079 AGATAGGAGCTGAAGGGACACGG - Intergenic
980737241 4:136906200-136906222 ATAAAATTACTGAAAGGAAACGG + Intergenic
981400099 4:144303639-144303661 CTATGGTAACTGAAAGGAGATGG + Intergenic
981726451 4:147852438-147852460 CTAGAGGAGCTTAAAGGAAAGGG + Intronic
982264410 4:153525331-153525353 AAAAAGAAACTGAAAGGAAAAGG - Intronic
982975675 4:162056861-162056883 TTATAGTAAATGGAAGGAAAAGG + Intronic
983455669 4:167960588-167960610 ATAAAGTGGCTGAATGGATAAGG + Intergenic
984859489 4:184224352-184224374 ATTTAGTAGCTGAGTGGTAAGGG + Intergenic
986408372 5:7449612-7449634 CTATAGGAGCTGGAAAGAAAAGG + Intronic
987860234 5:23476903-23476925 ATAAATTAGCTGAAAGTTAATGG + Intergenic
988459967 5:31426179-31426201 ATGGGGTAGATGAAAGGAAATGG - Intronic
989534136 5:42544203-42544225 ATAAAATAGCAGAAAGAAAAAGG + Intronic
989611120 5:43292628-43292650 ATATAGTTGACTAAAGGAAAGGG + Exonic
990223003 5:53616827-53616849 TTAAAGAAGCTCAAAGGAAATGG + Intronic
990780232 5:59352601-59352623 GTATAGTAGCTGATATGAACAGG - Intronic
990959026 5:61374032-61374054 ATCAAGTAGATGAAAGCAAAAGG - Intronic
991433387 5:66571233-66571255 ATATTTTAGCTGAAATGTAATGG + Intergenic
992237246 5:74723531-74723553 AGATAGTAGAGGACAGGAAATGG - Intronic
992681847 5:79161327-79161349 ATGTAGGAGCTGAAAAAAAAAGG + Intronic
992944892 5:81800326-81800348 ATTTTGTAGCTGAAAGCAGATGG + Intergenic
994102259 5:95906718-95906740 ATACAGTTCCTGAGAGGAAAAGG - Exonic
995846217 5:116496660-116496682 ATTTATCAACTGAAAGGAAAGGG - Intronic
996127193 5:119739928-119739950 ATATAGTAAGTGAAAGCATAAGG - Intergenic
996184427 5:120458520-120458542 AGATAGGAGCTGAAGGGACACGG - Intergenic
996795239 5:127339106-127339128 ACTGAGTAGCTGAAAAGAAATGG - Exonic
998303441 5:141049440-141049462 ATGTAGAAGGTGAGAGGAAAGGG - Intergenic
999646450 5:153722002-153722024 ATCTACTTGCTAAAAGGAAAAGG - Intronic
1000000186 5:157131003-157131025 AAATAATAGCAGAAATGAAAGGG - Intronic
1000922090 5:167150218-167150240 TGATGGTTGCTGAAAGGAAAGGG - Intergenic
1002550890 5:179990783-179990805 AGATAGTAGCTGAAGGGGCATGG - Intronic
1003776105 6:9367200-9367222 CCATAGTGGCTTAAAGGAAATGG - Intergenic
1005367355 6:25092326-25092348 ATATAGCAGCTAAATAGAAATGG + Intergenic
1005688079 6:28274350-28274372 ATAAAGTAGCTGAAAGAAAGGGG + Intronic
1005922113 6:30411531-30411553 AGATAGGAGCTGAAGGGACACGG + Intergenic
1006526888 6:34613965-34613987 CTATAGTAGCAGAAAGAAAGTGG + Intronic
1008168736 6:48175086-48175108 ATATAGGAGCTGATGGGAAAAGG - Intergenic
1008378865 6:50820827-50820849 GTAAAGTAGCTAAATGGAAAAGG + Intronic
1010494134 6:76513329-76513351 CAATAGAAACTGAAAGGAAATGG + Intergenic
1011040778 6:83028141-83028163 TGAAGGTAGCTGAAAGGAAAAGG - Intronic
1011290655 6:85773159-85773181 ACATAGAAGCTGAAATGGAAGGG - Intergenic
1011606280 6:89109538-89109560 ATGTAGTGGCTAAGAGGAAAGGG + Intronic
1013052562 6:106550450-106550472 ATAAAGTCTTTGAAAGGAAAAGG - Intronic
1013431165 6:110055891-110055913 ATGCAGCACCTGAAAGGAAAAGG - Intergenic
1013698452 6:112732136-112732158 ATATCTTAGCTGAAAGTAAAGGG + Intergenic
1013703287 6:112799665-112799687 ATATAGAAGCAGAAATGAAATGG - Intergenic
1014667953 6:124262659-124262681 ATAGATTAGTTGAAAAGAAATGG + Intronic
1014807716 6:125849170-125849192 TTGTAGTAGCTGAATGAAAACGG - Intronic
1015509302 6:134022153-134022175 ATATAGAAGCAGAAAGAACATGG + Intronic
1016109348 6:140203127-140203149 TGAGAGTTGCTGAAAGGAAATGG + Intergenic
1016248074 6:142011214-142011236 AAATGTGAGCTGAAAGGAAAGGG + Intergenic
1016385690 6:143528749-143528771 AAATATTATCTGAAAAGAAACGG - Intergenic
1016473121 6:144396607-144396629 ATATAGTAGGTGAATTTAAATGG + Intronic
1016699925 6:147042797-147042819 CTTTAGCAGCTGGAAGGAAAGGG + Intergenic
1017065516 6:150525671-150525693 ATGTGGTAGCTGAAAGGACAGGG - Intergenic
1017548024 6:155472181-155472203 ATCTGGTAGCTTAAATGAAAAGG + Intergenic
1017946615 6:159101175-159101197 ATACAGTTTCAGAAAGGAAAAGG - Intergenic
1017982253 6:159410313-159410335 ATAAAGAGGTTGAAAGGAAAAGG + Intergenic
1018370157 6:163160863-163160885 ATATGGTAGCTGAGGGGGAAAGG - Intronic
1018497861 6:164368641-164368663 ATAAAGAAGCTGAAAGAACAGGG - Intergenic
1020258479 7:6516425-6516447 AGATAGGAGCTGAAGGGACACGG + Intronic
1020507551 7:9012079-9012101 ATATATAAGCTGCAAGTAAAAGG - Intergenic
1021377412 7:19924919-19924941 TTATAGAAGTGGAAAGGAAAAGG + Intergenic
1021522459 7:21551425-21551447 AAATAGCAGCGGAAAGGAATTGG - Intronic
1021768058 7:23968993-23969015 ACATAGTTGCTGTAAGGAATTGG + Intergenic
1022289458 7:28986994-28987016 ATCTAGAAACTGGAAGGAAAAGG + Intergenic
1022547422 7:31201925-31201947 ATGTAGCATCTGAAAGGAAAGGG + Intergenic
1024398974 7:48901930-48901952 ATAAAGTTGATGAAAGAAAAGGG - Intergenic
1026382694 7:69815200-69815222 ATATATTTTCTGAAAGGGAATGG + Intronic
1027986112 7:85292598-85292620 TTATAGTTGCTGTAATGAAAAGG - Intergenic
1028974284 7:96894234-96894256 ATAAAATAGTTGTAAGGAAATGG + Intergenic
1029400943 7:100345522-100345544 AGATAGGAGCTGAAGGGACATGG - Intronic
1029694814 7:102205619-102205641 GTAGGGTAGCAGAAAGGAAATGG + Intronic
1030332842 7:108291104-108291126 ATATAGAAGATCAAAAGAAAAGG + Intronic
1030407011 7:109127934-109127956 AAACAGTAGCTGAAAGAAATAGG + Intergenic
1030748706 7:113202342-113202364 ATATAGTATATGAAAGTTAAGGG + Intergenic
1031318155 7:120283611-120283633 ATATTTTAGCTGAAAAGACAAGG + Intronic
1031451257 7:121922848-121922870 ATATTTTAACTGAAATGAAAGGG - Intronic
1033496698 7:141905493-141905515 ATCTAGAAGGTGATAGGAAAGGG + Intergenic
1033828937 7:145228392-145228414 ATAAAGCAGCTGTAAGGTAACGG - Intergenic
1033855012 7:145550229-145550251 GTATAATAGCTAAAAGTAAAAGG - Intergenic
1033987653 7:147245805-147245827 AGATAAAAGCTGAAAGGAATTGG - Intronic
1033990969 7:147286774-147286796 ATATGGTAGGTGAATGGAAAGGG - Intronic
1034007374 7:147488990-147489012 GTATAGAAGTTCAAAGGAAAAGG - Intronic
1034381923 7:150704251-150704273 ACACAGAGGCTGAAAGGAAAGGG + Intergenic
1035488213 7:159247289-159247311 ATATAGTGGCAGAAAGCAGATGG + Intergenic
1036541369 8:9715427-9715449 AGATGGTAGCTGTATGGAAAAGG + Intronic
1036586216 8:10126320-10126342 AAATAGTACCTGAAATGCAAAGG + Intronic
1037326695 8:17698975-17698997 ATGTAGAATCTGGAAGGAAAAGG - Intronic
1037537813 8:19843217-19843239 ATATATTAGCTACAAAGAAAGGG + Intronic
1038186776 8:25282388-25282410 ATACAGCAGGTGAAAGGAGATGG - Intronic
1038678436 8:29644584-29644606 AAATAGTAGCAGAAAGGGAGGGG + Intergenic
1039228216 8:35413564-35413586 AGATAGTAGCAGAAAGTCAAAGG - Intronic
1039310285 8:36310716-36310738 ATATAGAATCTGAAACCAAATGG - Intergenic
1039695830 8:39910300-39910322 AGTTAGTAGCTGAATGGCAAAGG - Intronic
1041025222 8:53678363-53678385 ATAAAGAAGTTGAAAGTAAAAGG + Intergenic
1041612066 8:59862656-59862678 ATATATAAACTAAAAGGAAAGGG + Intergenic
1042257837 8:66824335-66824357 CCATAGTAGATAAAAGGAAATGG + Intronic
1043466823 8:80517043-80517065 ATAGAGTGACTGAAAGGAAAGGG + Intronic
1043861410 8:85321574-85321596 ATATGGTGGGTGGAAGGAAATGG + Intergenic
1044095692 8:88061361-88061383 AAAAAGGAGATGAAAGGAAAGGG - Intronic
1045543811 8:103110748-103110770 AAAGAGTTGCTGGAAGGAAAAGG - Intergenic
1045735486 8:105291590-105291612 ACAGATTAACTGAAAGGAAATGG + Intronic
1045790713 8:105980516-105980538 ATAGAGTGGCTGAATGGATAAGG + Intergenic
1045884662 8:107081265-107081287 AAAAAATAACTGAAAGGAAAAGG + Intergenic
1046176418 8:110581696-110581718 ATATTCTTGCTGGAAGGAAATGG + Intergenic
1046377847 8:113410296-113410318 AGATAGTAGGTGATAAGAAAAGG - Intronic
1046638847 8:116703230-116703252 AGATAGGAGCTGAAGGGACACGG + Intronic
1046984560 8:120372911-120372933 ATACCATAACTGAAAGGAAATGG - Intergenic
1049516396 8:143060079-143060101 AGATAGGAGCTGAAGGGACATGG + Intergenic
1050146799 9:2576756-2576778 ATATAAGAGAGGAAAGGAAATGG + Intergenic
1050994584 9:12199943-12199965 ATATAGAAGAAGGAAGGAAATGG + Intergenic
1052353454 9:27480749-27480771 AAGTAGTAGAAGAAAGGAAAGGG + Intronic
1055674381 9:78640439-78640461 ATAATGTTTCTGAAAGGAAAAGG + Intergenic
1055932139 9:81570222-81570244 ATAAAATAGGTGAAAGGTAAAGG - Intergenic
1059156482 9:111993655-111993677 TTATATTACTTGAAAGGAAAGGG - Intergenic
1060630441 9:125152965-125152987 CTACAGTACTTGAAAGGAAAGGG + Intronic
1060844327 9:126823466-126823488 ACAAAGAGGCTGAAAGGAAAAGG - Intronic
1061200333 9:129134614-129134636 TTATAGTTCTTGAAAGGAAAGGG + Intronic
1061785480 9:133025394-133025416 AGATAGGAGCTGAAGGGACATGG + Intergenic
1062557554 9:137121600-137121622 AGATAGGAGCTGAAGGGACATGG + Intergenic
1062642366 9:137525948-137525970 AGATAGGAGCTGAAGGGACATGG - Intronic
1203755731 Un_GL000218v1:123886-123908 ATTTAGGGGTTGAAAGGAAACGG + Intergenic
1186296763 X:8157261-8157283 ATTTATTAGCTGTAAGGTAAGGG - Intergenic
1186377359 X:9018927-9018949 ATTTATTAGCTGTAAGGTAAGGG + Intergenic
1186923148 X:14303770-14303792 ATGTAGAAGCTTAAAGGAAGGGG + Intergenic
1187767917 X:22663865-22663887 TTATAATAGCAGAAAGCAAAGGG + Intergenic
1187796475 X:23008952-23008974 ATATAGTAGGTGATGGGAGAGGG - Intergenic
1187811650 X:23185305-23185327 AGATAAGATCTGAAAGGAAAGGG + Intergenic
1188043283 X:25395691-25395713 ATATACTATCTGAGAGGAAAGGG - Intergenic
1188657244 X:32713525-32713547 ATATAGTAGCTGAAAGGAAAGGG - Intronic
1188713224 X:33428296-33428318 ATAGAGTAGCTTAAATGAACTGG - Intergenic
1188948761 X:36341971-36341993 ATATAGTGACTGTATGGAAATGG + Intronic
1189451962 X:41143505-41143527 ATACAGTAGCTGTCATGAAATGG + Intronic
1190579866 X:51881791-51881813 AAATAGCAGCTGGAAGTAAATGG - Intronic
1190952358 X:55158947-55158969 ATATAGTATCTCACAGAAAATGG - Intronic
1191753410 X:64568142-64568164 ACTTAGCAGCTGAAATGAAATGG - Intergenic
1191850333 X:65581459-65581481 ACATTGTAGGTCAAAGGAAAAGG - Intergenic
1192617004 X:72635931-72635953 ATTTAGTAGCTGAATAAAAAAGG + Intronic
1194738554 X:97544193-97544215 AAATTGTAGCTGGAAGGGAAGGG + Intronic
1194759759 X:97781531-97781553 ATATATAGGCTGAAAGTAAAAGG + Intergenic
1195923947 X:110006911-110006933 AGATATTAGCTGAAGTGAAAGGG + Intronic
1195943904 X:110189112-110189134 ATATCCTAGCAGAATGGAAAGGG - Intergenic
1195973427 X:110498781-110498803 ATAGAGTAGCTGAAATGAAGGGG + Intergenic
1196591768 X:117493781-117493803 AAATAGTAGCTGAGAAAAAATGG - Intergenic
1198365109 X:135932141-135932163 AGATAGGAGCTGAAGGGACACGG - Intergenic
1198795847 X:140393282-140393304 CTATACGAGCTGAAAAGAAATGG - Intergenic
1199421307 X:147648036-147648058 ATATGGTCAATGAAAGGAAAAGG - Intergenic
1201169336 Y:11241491-11241513 ATTTAGGGGTTGAAAGGAAACGG + Intergenic
1201181613 Y:11353219-11353241 ATATAGAAACTGAAAAAAAAAGG + Intergenic
1202602589 Y:26609458-26609480 ATATAGTATCTGCAATGAAAAGG - Intergenic