ID: 1188663568

View in Genome Browser
Species Human (GRCh38)
Location X:32790863-32790885
Sequence TTGTGCAATGCTCAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 211}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188663568_1188663580 21 Left 1188663568 X:32790863-32790885 CCTTCCACCTGAGCATTGCACAA 0: 1
1: 0
2: 1
3: 13
4: 211
Right 1188663580 X:32790907-32790929 CCCTCGACTACAATAACCAGTGG 0: 1
1: 0
2: 0
3: 2
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188663568 Original CRISPR TTGTGCAATGCTCAGGTGGA AGG (reversed) Intronic
900470897 1:2854446-2854468 CTGTGCCCTGCTCTGGTGGACGG + Intergenic
903556694 1:24199117-24199139 TTTTGGAATGCTGAGGTGGATGG - Intergenic
904265174 1:29314456-29314478 TTGTGCAGAGCTGAGGGGGAAGG - Intronic
906387772 1:45386616-45386638 GTGTACAATGCTCAGGTGACAGG - Intronic
906986313 1:50687070-50687092 CTTTGGAAGGCTCAGGTGGACGG - Intronic
909677234 1:78252213-78252235 TTGTGCCCTGCTCACCTGGAAGG + Intergenic
910530009 1:88225193-88225215 TTGTGCAATGGGCAGATGGATGG + Intergenic
911475286 1:98366371-98366393 ATGAGCAATACTCAGGTGGAAGG - Intergenic
912772608 1:112478675-112478697 TTTTGGAAGGCTGAGGTGGAAGG + Intronic
913513341 1:119582077-119582099 GTTTGCAATGCTGAGGTAGATGG + Intergenic
915350072 1:155218718-155218740 TTGAGCAAGGCACAGATGGAGGG - Intergenic
915353470 1:155240956-155240978 TTGAGCAAGGCACAGATGGAGGG - Intronic
918172745 1:182012969-182012991 GTGTGCACTGCTCAGGTGATGGG + Intergenic
918393911 1:184094661-184094683 TTGTGAAAAGCTCAGGATGAAGG + Intergenic
919361075 1:196595781-196595803 GTGTGCACTGCTCAGGTGATGGG - Intronic
920400889 1:205675766-205675788 CTGGGCAGGGCTCAGGTGGAGGG - Intronic
921812661 1:219532275-219532297 TTGTGCAATGCCAAGGTTAAGGG - Intergenic
923086070 1:230704313-230704335 TTGGGGCATGGTCAGGTGGATGG + Exonic
923291741 1:232552611-232552633 TTTTGGAAGGCTGAGGTGGAAGG - Intronic
924214331 1:241805069-241805091 TTTTGGAAGGCTGAGGTGGACGG - Intergenic
924935906 1:248770059-248770081 GTGTGCACTGCTCAGGTGACAGG + Intergenic
1064005423 10:11695385-11695407 TTGTGCAGTGATCCGGGGGAGGG + Intergenic
1064111235 10:12540999-12541021 CTGTGTAATTGTCAGGTGGAGGG + Intronic
1065066320 10:21968978-21969000 TTGGGCCAGGCTGAGGTGGACGG + Intronic
1066068723 10:31782636-31782658 TTGTGTAATGCTCAGGTTTGGGG - Intergenic
1068002964 10:51358091-51358113 TTGTGAAATGCTCAGCTGAGGGG + Intronic
1070846257 10:79524542-79524564 TTTTGAAATGCTGAGGTGGGTGG + Intergenic
1070927542 10:80235768-80235790 TTTTGAAATGCTGAGGTGGGTGG - Intergenic
1071202340 10:83233851-83233873 TTGTGCTATGCCTAGGTGCATGG - Intergenic
1072263074 10:93701077-93701099 TTTTGGGATGCTGAGGTGGACGG - Intronic
1072450768 10:95537873-95537895 TTCTGCAAGGCCAAGGTGGACGG + Intronic
1073169903 10:101497455-101497477 CTTTGGAATGCCCAGGTGGAAGG + Intronic
1074048899 10:109865138-109865160 TTGTAAAATGCTCTGGAGGAAGG - Exonic
1075623858 10:123947855-123947877 TTGTGCACTGCACAAGTGTAGGG + Intergenic
1079023615 11:16928199-16928221 TTGGGCATTGCTGAGGTGGGAGG + Intronic
1082721767 11:56686475-56686497 GTGTGCACTGCTCAGGTGATGGG + Intergenic
1085299587 11:75450353-75450375 CTGTGCCATGCTGAGGTGGCAGG - Intronic
1088089913 11:106025395-106025417 CTTTGCAAGGCTGAGGTGGAAGG - Intergenic
1088720498 11:112587968-112587990 TTGGGCATGGCTGAGGTGGAGGG - Intergenic
1091346091 11:134855219-134855241 TTGAGCAAAGCACAGGTGGCTGG - Intergenic
1091876683 12:3940511-3940533 TAGTGCACTGCTGAGCTGGAGGG - Intergenic
1091904452 12:4172848-4172870 TTGTCCATTGCTCAGGGGAAAGG + Intergenic
1092028541 12:5263687-5263709 TTTTGGAAGGCTGAGGTGGAAGG + Intergenic
1093984847 12:25519208-25519230 TTTAGCAGTGCTTAGGTGGAGGG - Intronic
1094446766 12:30539455-30539477 GTGTGCCATGCTCAGGTGATGGG - Intergenic
1095449619 12:42316341-42316363 TTTTGGGATGCTGAGGTGGACGG - Intronic
1096379518 12:51144275-51144297 TTTTGGAAGGCTAAGGTGGAAGG - Intronic
1097983105 12:65754525-65754547 TTCTGCAATGCTTTGGTGGTGGG + Intergenic
1100068530 12:90681393-90681415 TGGTGTAATTCTCAGGTGGTTGG - Intergenic
1102217010 12:111168854-111168876 TTGTGGAATGCTCAGCCGGGTGG + Intronic
1102814472 12:115853209-115853231 TGGTACAATGCTCAGGTGACAGG + Intergenic
1103174524 12:118850990-118851012 CTCTGCAAGGCTGAGGTGGAAGG - Intergenic
1103605507 12:122083061-122083083 TTTTGGAAGGCTGAGGTGGAAGG - Intronic
1108246231 13:48517083-48517105 TTGTGCTCTCCTAAGGTGGAAGG - Intronic
1108391262 13:49950071-49950093 GTGTACAATGCTCAGGTGATGGG + Intergenic
1110569049 13:76984970-76984992 TTGTGTGAGGTTCAGGTGGAAGG + Intergenic
1115131385 14:30056383-30056405 TTGGGGAATACTCAGGTGGCAGG + Intronic
1115806157 14:37054344-37054366 TTGGGCAGGGCTCAGCTGGATGG - Intronic
1117317356 14:54585536-54585558 GTGTGCACTGCTCAGGTGATGGG - Intronic
1117365002 14:55017993-55018015 TTGTGCGCTGCTGAGGTGGGAGG - Intronic
1118433723 14:65749500-65749522 TTGAGCAATTTTCTGGTGGATGG - Intergenic
1121393903 14:93601194-93601216 ATGTACAATGCTCAGGTGACGGG - Intronic
1125717811 15:41829530-41829552 CTTTGGAATGCTGAGGTGGAAGG - Intronic
1126384362 15:48078564-48078586 TTGTGCAATACTCATGTGGCTGG - Intergenic
1127778464 15:62289283-62289305 TTTTGCAAGGACCAGGTGGATGG + Intergenic
1129672156 15:77613398-77613420 TTTTGCAGGGCGCAGGTGGAGGG - Exonic
1131455208 15:92578349-92578371 TTTGGCAATGGTCAGGGGGATGG - Intergenic
1134254729 16:12601651-12601673 GTGAGCAATGCTCAGGCAGAAGG + Intergenic
1134376573 16:13681181-13681203 CTGTGGAAGGCTCAGGTTGATGG + Intergenic
1135110027 16:19683376-19683398 TTGTGCAATGCTGAGGTTTGGGG + Intronic
1135250182 16:20894512-20894534 TTGTGCCCTGCTCTGCTGGAGGG - Intronic
1136179509 16:28541319-28541341 TTTTGAAAGGCTGAGGTGGAAGG + Intergenic
1137526245 16:49239009-49239031 TTGTGCAAAGGCCAGGGGGAGGG - Intergenic
1138196187 16:55053963-55053985 TGGTGCAATGAGCAGGTCGACGG + Intergenic
1138271151 16:55696736-55696758 CTGTGGAAGGCTGAGGTGGAAGG + Intronic
1138354031 16:56363470-56363492 GTGTACAATGCTCAGCTGAAAGG + Intronic
1138442398 16:57042853-57042875 TTGTGCAATGCTGGGAAGGAAGG + Intronic
1139544289 16:67642385-67642407 TGGAGCCATGCCCAGGTGGAGGG - Intergenic
1140454174 16:75095201-75095223 TTAGGCCATGCTCAGGTGGGAGG + Intronic
1142397592 16:89841311-89841333 TAGTGCCATGCTAAGGTGGGAGG - Intronic
1143769913 17:9162042-9162064 CTGAGCAATGCTCATGGGGAGGG + Intronic
1143881233 17:10031571-10031593 TTCTGCAAGGCCCACGTGGAAGG - Intronic
1144001570 17:11059998-11060020 GTGTGCAATGCTCCCCTGGAAGG - Intergenic
1144328739 17:14206072-14206094 TTGTGCCAGGCTCTGGGGGATGG + Intronic
1144938481 17:18919120-18919142 CTGTGGAAGGCTAAGGTGGAAGG + Intronic
1145045924 17:19615824-19615846 GTGGGCAATGCTCTGGGGGAAGG + Intergenic
1147551118 17:41442530-41442552 TTGTTCAATGCTCAGGGGACTGG - Intergenic
1147933829 17:43999869-43999891 TGGAGCAATGCTCAGGAGGAAGG + Intronic
1148457473 17:47818732-47818754 TTGTGCAAGGCTCACTTGCAGGG + Intronic
1151214657 17:72569358-72569380 TGGTACAATGCCCAGGAGGAGGG + Intergenic
1152292427 17:79447729-79447751 CTGAGCAATGCTCACATGGATGG - Intronic
1158687809 18:59630479-59630501 TTGGGCAAGGCTCAGCTGGGAGG + Intronic
1160352105 18:78192332-78192354 CTGTGAAATGCTCAAGTGCAGGG - Intergenic
1163466775 19:17472429-17472451 GTGCGCAATGCTCAGGAGTATGG - Intronic
1165706052 19:37977078-37977100 TTTTGGAAGGCTCAGGTGGGTGG - Intronic
1167199404 19:48053934-48053956 ATGTGGGATGCCCAGGTGGAAGG + Intronic
925167520 2:1727255-1727277 TGGTCCAAGGCTCAGGAGGAGGG - Intronic
926686679 2:15703641-15703663 TTGTGGAATGTTGAGGAGGAAGG + Intronic
927787924 2:25986779-25986801 TTCTGGGAGGCTCAGGTGGATGG + Intergenic
928507770 2:31971617-31971639 CTTTGCAAGGCTGAGGTGGAAGG - Intronic
929197586 2:39201883-39201905 GTGTACACTGCTCAGGTGGTGGG + Intronic
931096971 2:58951600-58951622 TTGTCCAATGCTCAGTCAGAAGG + Intergenic
932581403 2:72994765-72994787 GAGTGCCTTGCTCAGGTGGAAGG - Intronic
935326894 2:101945785-101945807 TGGTCCAATGCACAGGTGCATGG - Intergenic
936948543 2:117953783-117953805 ATGTGGAAGGCTGAGGTGGAAGG + Intronic
937138281 2:119574614-119574636 TTGTGCAGTGTTCAGGTGTCAGG - Intronic
937217611 2:120322621-120322643 ATGAGAAGTGCTCAGGTGGAGGG - Intergenic
938595729 2:132785345-132785367 TGGAGCAATGCTAAGGTGGAAGG + Exonic
938602746 2:132859400-132859422 TTGTGGAAAGCTCTGCTGGACGG - Intronic
938662953 2:133506120-133506142 TTGTGTGATGCTGAGGTGCAGGG - Intronic
939720349 2:145642569-145642591 TTGTTCAGTTCTAAGGTGGATGG + Intergenic
940459831 2:153950854-153950876 TTGTGCGATGCTCAGGTTTGGGG - Intronic
941658985 2:168175096-168175118 CTGTGGAATCCTCAGGAGGAAGG - Intronic
943696480 2:190940925-190940947 TAGTGAAATGCTGAGGGGGATGG - Intronic
943992969 2:194721061-194721083 ATGTACAATGCTCAGGTGAGGGG + Intergenic
945193260 2:207212444-207212466 TTGTGTAATGCTGAGGTTTAGGG - Intergenic
1169528735 20:6460243-6460265 TTGTGCACTGCTCAGGTGATGGG + Intergenic
1169969710 20:11256319-11256341 GTGTGCACTGCTCAGGTGATGGG - Intergenic
1171226740 20:23448130-23448152 GTGTGCACTGCTCAGGTGAGAGG - Intergenic
1173568881 20:44064047-44064069 GTGTACACTGCTCAGGTGGTAGG + Intronic
1174311667 20:49660625-49660647 CTGTGCAATGCTCATGTAGTTGG + Intronic
1179335909 21:40453595-40453617 CTAAGCAATGCTCAGATGGATGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1184498557 22:44858216-44858238 CTGTGCAAGGCTCAGTGGGAGGG + Intronic
950404903 3:12798133-12798155 ATGTGAAATGCTCAGGTTCATGG + Intronic
951390406 3:22096251-22096273 TTGTGCAATGCTGAGGTTTGGGG - Intronic
951583793 3:24194168-24194190 GTGTACACTGCTCAGGTGGTGGG + Intronic
951630707 3:24716817-24716839 TTTTCCCATGTTCAGGTGGAGGG - Intergenic
951787015 3:26432936-26432958 TTGTGAACTAGTCAGGTGGAAGG + Intergenic
952281567 3:31928451-31928473 TTGTGCAAGTCTGAGGTAGATGG - Intronic
954966833 3:54619308-54619330 ATGTGCACTGCTTAGGTGGAGGG + Intronic
955614082 3:60787322-60787344 TTGAGCAGTGCTCAGAAGGATGG - Intronic
955784473 3:62522380-62522402 TTTTGCAAGGCTGAGGTGGGAGG - Intronic
956684664 3:71813906-71813928 TTGTGCAATGCTGTGGTGCTGGG + Intergenic
957461938 3:80533118-80533140 TTATGGAATGCTCAGGTAGCTGG + Intergenic
958265617 3:91434117-91434139 TTGCCCAATGCTCAAGAGGAGGG + Intergenic
960677924 3:120214866-120214888 CTCTGCAATCCTAAGGTGGATGG + Intronic
963909315 3:150801470-150801492 TTTTGGAATGCTGAGGTGGGTGG + Intergenic
964795758 3:160495371-160495393 TTTTGCAATTCTCAGCTGCAGGG - Exonic
964881499 3:161428356-161428378 CTGTGGAAGGCTGAGGTGGAAGG - Intergenic
965242312 3:166217669-166217691 CTGTGGAAGGCTGAGGTGGAAGG - Intergenic
966505261 3:180693562-180693584 TTGTGCTGTGCTCACATGGATGG - Intronic
967204063 3:187103447-187103469 GTGTACACTGCTCAGGTGGCGGG - Intergenic
967213078 3:187185966-187185988 TTGAGAAACGCTCAGGTGGTAGG + Intergenic
967506085 3:190254539-190254561 GTGTACAATGCTCAGGTGATAGG - Intergenic
968756985 4:2421796-2421818 CTTTGGAATGCTCAGGTGGGAGG + Intronic
969102638 4:4780903-4780925 TTGTAAAATGCTCTGGAGGAAGG - Intergenic
971080579 4:23205989-23206011 GTGTACACTGCTCAGGTGAAAGG - Intergenic
971244357 4:24914646-24914668 TTGAGCAAGGCTCAGCTGGATGG - Intronic
971317577 4:25580403-25580425 TGGTGCAAGGCTGAGGTGGGAGG - Intergenic
971426020 4:26516227-26516249 ATGTGCACTGCTCAGGTGATGGG + Intergenic
974178839 4:58359573-58359595 ATGAGCAATACTCAGGTAGAAGG - Intergenic
975498461 4:75058823-75058845 CTGAGCAATGCTCAGGCAGAAGG + Intergenic
981436526 4:144729933-144729955 TTCTGCAGTGCTCATTTGGAAGG + Intronic
982132931 4:152246819-152246841 TTCTGCACTGAGCAGGTGGAAGG + Intergenic
983445266 4:167842706-167842728 TTGTGCAATGCTGATGTTCAAGG + Intergenic
985489445 5:170904-170926 TTGTACCATGATCAGGTGAAAGG - Intronic
985868385 5:2534362-2534384 TTGTGCAGGGCTCAGCTGGGTGG + Intergenic
993703302 5:91143369-91143391 TTGTCCCATGCCCAGGTAGAAGG + Intronic
994595250 5:101824512-101824534 GTGTGCACTGCTCAGGTGATGGG - Intergenic
995375367 5:111468219-111468241 GTGTACAATGCTCAGGTGATGGG + Intronic
995448902 5:112278809-112278831 TTTTGGAAGGCTCAGGTGGGTGG + Intronic
999953891 5:156679491-156679513 TTGGGCAATGCACAGCTGTATGG + Intronic
1001037852 5:168310727-168310749 TTGTGGAATGCTGAGGTGGAAGG + Intronic
1003512092 6:6790179-6790201 GGGTGCAATGCTCTGGTGGGAGG + Intergenic
1005657522 6:27956675-27956697 GTGTTCACTGCTCAGGTGGTGGG + Intergenic
1007597987 6:43063377-43063399 TTGTGCACTGCACTGGTGAATGG + Intronic
1007989228 6:46237996-46238018 TTGGGCCAGGCTCAGGGGGAAGG - Intronic
1008116114 6:47552240-47552262 GTGTGCACTGCTCAGGTGATGGG - Intronic
1008119796 6:47598800-47598822 GTGTGCACTGCTCGGGTGGTGGG + Intronic
1008464411 6:51814695-51814717 CTGTCAACTGCTCAGGTGGAAGG + Intronic
1011117157 6:83906087-83906109 CAGTGGAATGCTCAGGTGGAGGG + Intronic
1011679390 6:89768247-89768269 TTGTGCAAGGGACAGGTGGGAGG + Intronic
1012233454 6:96786554-96786576 TTGTGCATTGCTCAGGGGTGAGG + Intergenic
1014278152 6:119411045-119411067 GTGTGCACTGCTCAGGTGATGGG - Intergenic
1015836998 6:137431361-137431383 GTGTGTAATGCTCAGTTGCATGG - Intergenic
1016741306 6:147532226-147532248 GTGTGCACTGCTCAGGTGACAGG - Intronic
1017714061 6:157195815-157195837 TGTTGCAAGGCTGAGGTGGATGG + Intronic
1018145303 6:160880625-160880647 TTGTGTAATGCTGAGGTTTAGGG - Intergenic
1019581335 7:1764615-1764637 TTGTGGGAGGCTGAGGTGGAAGG + Intergenic
1020317219 7:6914313-6914335 TTTTGAAAGGCTGAGGTGGATGG + Intergenic
1022021602 7:26404910-26404932 TTGTGGAATGCCCATGTGAATGG + Intergenic
1026979047 7:74515987-74516009 CTGTGCCATGCTCAGGGTGATGG - Intronic
1027650677 7:80864290-80864312 GTGTACAATGCTCAGGTGATGGG + Intronic
1027981136 7:85223808-85223830 GTGTGCACTGCTCAGGTGATGGG + Intergenic
1028237397 7:88378899-88378921 GTGTGCACTGCTCAGGTGGTGGG - Intergenic
1028838537 7:95400681-95400703 TTGAGAAATGTTTAGGTGGAGGG + Intergenic
1030980967 7:116185427-116185449 GTGAGCAATACTCAGGTAGAAGG - Intergenic
1031098099 7:117444839-117444861 TTGTGTCATGCTCTGCTGGAAGG + Intergenic
1032376311 7:131422302-131422324 TTTTGGGATGCTGAGGTGGAAGG + Intronic
1033219225 7:139516952-139516974 TTGTGGAAGGCTGAGGTGGGCGG + Intergenic
1033728088 7:144142879-144142901 CTGAGGAATGCTCAGGTGAAGGG + Intergenic
1034696683 7:153060063-153060085 TTTTGGAAGGCTGAGGTGGATGG + Intergenic
1038731426 8:30131396-30131418 CTTTGCAATGCTGAGGTGGAAGG - Intronic
1039147093 8:34460376-34460398 TTGTGCTAAGCTCAGGCAGAAGG + Intergenic
1040789105 8:51204485-51204507 TTCTTCTTTGCTCAGGTGGATGG + Intergenic
1043917679 8:85941690-85941712 TTGTGCAATGCTGAGGTTTGGGG + Intergenic
1044561921 8:93620702-93620724 GTCTGCAGTGCTGAGGTGGAAGG + Intergenic
1047351404 8:124078170-124078192 TTGTGGAATGAACAGATGGATGG + Intronic
1048338964 8:133524478-133524500 ATGAGCAATACTCAGGTAGAAGG - Intronic
1050114779 9:2252595-2252617 TTGGGCTAGGCTCAGGTAGATGG + Intergenic
1051281852 9:15449242-15449264 TTGAGCAATGTTCAGATGGTTGG - Intronic
1056133682 9:83609540-83609562 GTGTACACTGCTCAGGTGAAGGG + Intergenic
1057644851 9:96863909-96863931 GTGTACACTGCTCAGGTGGTAGG + Intronic
1058531108 9:105905430-105905452 TTGTACACTGCTCAGGTGATGGG - Intergenic
1059797119 9:117710122-117710144 TTGCGTAATGCTGAGGTGTAGGG + Intronic
1059956065 9:119517032-119517054 TTTTACAATGTTCTGGTGGAAGG + Intronic
1060017777 9:120101813-120101835 TGGTGCAATGCTGAGGTGCATGG - Intergenic
1061417046 9:130452728-130452750 TTGTGGAATCCTGAGCTGGAAGG + Intronic
1185637133 X:1560970-1560992 CTTTGGAATGCTGAGGTGGATGG - Intergenic
1185841208 X:3393046-3393068 TTGTGCAATGCTGAGGTTTGGGG - Intergenic
1185936115 X:4258324-4258346 GTGAGCAATACTCAGGTAGAAGG + Intergenic
1186434297 X:9529697-9529719 CTGTGGAATGCCAAGGTGGAAGG + Intronic
1186530121 X:10286887-10286909 TTGGGCAGGGCTCAGATGGATGG + Intergenic
1187636978 X:21239357-21239379 GTGTGCACTGCTCAGGTGACAGG + Intergenic
1187868036 X:23741916-23741938 TTTTGGGATGCTGAGGTGGATGG - Intronic
1188663568 X:32790863-32790885 TTGTGCAATGCTCAGGTGGAAGG - Intronic
1192956556 X:76076588-76076610 AGGTGTAATGCTCAGTTGGAAGG - Intergenic
1192989077 X:76429739-76429761 TTGGGAAATGCTCTGGAGGATGG + Exonic
1194489098 X:94525153-94525175 TTGTAGAATGCTTAGGTGGGAGG - Intergenic
1195371958 X:104185017-104185039 TTTTGCAAGGCTGAGGTGGGAGG - Intronic
1195498818 X:105570062-105570084 GTGTACACTGCTCAGGTGAAGGG - Intronic
1197322030 X:125044342-125044364 CTTTGCAAGGCTGAGGTGGAAGG + Intergenic
1198798665 X:140427181-140427203 GAGTGCATAGCTCAGGTGGAGGG + Intergenic
1199692336 X:150318109-150318131 TTGAGCATTGCTGAGATGGAGGG - Intergenic