ID: 1188665356

View in Genome Browser
Species Human (GRCh38)
Location X:32812753-32812775
Sequence ATAAGCTTGTTAGCTGTTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188665356_1188665360 2 Left 1188665356 X:32812753-32812775 CCCCTAACAGCTAACAAGCTTAT 0: 1
1: 0
2: 0
3: 7
4: 94
Right 1188665360 X:32812778-32812800 AAACTAGCTTATTTACAAATTGG 0: 1
1: 0
2: 1
3: 33
4: 470

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188665356 Original CRISPR ATAAGCTTGTTAGCTGTTAG GGG (reversed) Intronic
905316332 1:37083817-37083839 AGAAAGTAGTTAGCTGTTAGAGG + Intergenic
906442831 1:45864688-45864710 ATAAGCTTAGTAGCTGTAGGTGG + Intronic
909547614 1:76865435-76865457 ATTAGGTTGTGAGCTCTTAGAGG + Intergenic
909738908 1:79003632-79003654 ATAAGCTGGTTGGCTGCTAAAGG + Intronic
909821720 1:80071648-80071670 ATAAGCTTGGAAACTTTTAGTGG + Intergenic
909895697 1:81066320-81066342 ATGAACTTGTTAGCTTTGAGAGG - Intergenic
914744312 1:150490426-150490448 TTAAGCTTGTTACTTTTTAGTGG + Intronic
916924886 1:169507849-169507871 ATAAGTTTGTTAGATCTTTGAGG + Intergenic
924464292 1:244286066-244286088 ATGAGCTTGCTAGCTGTTGTCGG + Intergenic
1064126205 10:12662867-12662889 ATGAACTTGTTAGCTTTTATTGG + Intronic
1067581018 10:47445937-47445959 ATAATATTCTTGGCTGTTAGTGG - Intergenic
1067686867 10:48470998-48471020 GCAACCTTGTTAGCTGGTAGTGG - Intronic
1068333188 10:55599629-55599651 ATTAGGTTGTTAACTGTCAGTGG - Exonic
1069156456 10:65036127-65036149 ACAATTTTGTTATCTGTTAGTGG - Intergenic
1069756622 10:70777575-70777597 TTAAGCGTGATAGCTGATAGTGG - Intronic
1072173280 10:92889048-92889070 ATAAAAATGTTAGGTGTTAGTGG + Intronic
1078420072 11:11203774-11203796 ATAAAATTGTTAGATGTTAAAGG - Intergenic
1083919404 11:65773846-65773868 TTAAGCTTTTTAGCTGCTACAGG + Intergenic
1086413954 11:86570318-86570340 TTAAGCTGATGAGCTGTTAGGGG + Intronic
1090981597 11:131727140-131727162 CAAAGGTTGTTAGCTGTTTGGGG - Intronic
1093114344 12:15191005-15191027 ATAAGACTGTTAGCTGAGAGTGG - Intronic
1096353669 12:50921157-50921179 AAAAGCCTGTTAAATGTTAGAGG - Intergenic
1096565915 12:52478880-52478902 AAAAGATTATTGGCTGTTAGTGG + Intergenic
1099136584 12:78911468-78911490 ATAAGCCTGCAAGCTGATAGAGG + Intronic
1099879273 12:88447570-88447592 ATAAGTTTTATAGCTGTTACAGG - Intergenic
1100293932 12:93243110-93243132 ATGAGGATTTTAGCTGTTAGTGG - Intergenic
1105244968 13:18641562-18641584 ATAAGCATGTTTCCTGTGAGTGG - Intergenic
1106269677 13:28140232-28140254 TGAAGCTTGTTAGTTGTTAGTGG + Intronic
1109620371 13:64896568-64896590 ATAACCTTATTAGTTGGTAGAGG - Intergenic
1111262693 13:85762332-85762354 GTAAGCTTGTAAGTTGTTGGAGG + Intergenic
1111838122 13:93414269-93414291 TGAAGCATCTTAGCTGTTAGGGG - Intronic
1111846106 13:93510756-93510778 AAAAGCTTATACGCTGTTAGTGG - Intronic
1112000901 13:95208908-95208930 ATATGGTTGTTAGCTGGTCGTGG - Intronic
1115726132 14:36217941-36217963 ACAAGCTTGTTGTCTGTTATTGG - Intergenic
1116034217 14:39608624-39608646 CTAAGCTTTTTAGCTGCAAGGGG - Intergenic
1117051832 14:51868069-51868091 ATGAGTTTGTGAGCTCTTAGAGG - Intronic
1144536908 17:16098950-16098972 AAAAACTAGTTACCTGTTAGAGG + Intronic
1149019128 17:51943247-51943269 AGAAGCTGGTTAGGTGCTAGAGG + Intronic
1154314809 18:13296250-13296272 ATAAGCTTGTGAGATGTTTTAGG + Intronic
1154443979 18:14418370-14418392 ATAAGCATGTTTCCTGTGAGTGG + Intergenic
1156047566 18:32894326-32894348 ATAAGCTCCTTAGATGTTGGGGG - Intergenic
1157972546 18:52286732-52286754 ATGCGCTTGCTAACTGTTAGAGG + Intergenic
929207387 2:39312626-39312648 ATATGCTTTTAAGCTGTTAATGG + Intronic
930252410 2:49049604-49049626 ATAAGCTTATTAGCTCACAGTGG + Intronic
930333732 2:50019270-50019292 ATAAGTTTGAAAGCTGTTTGAGG + Intronic
930534709 2:52631343-52631365 AAAAGTTTGTCAGCTCTTAGAGG - Intergenic
939100146 2:137886619-137886641 ATAAGCATGTTTCCTGTGAGTGG - Intergenic
940507890 2:154579235-154579257 CTAAGCTTGTTACATGTCAGAGG - Intergenic
943536176 2:189153481-189153503 ATATGCTTGTTAGATATTATGGG - Intronic
944614498 2:201446508-201446530 ATAAGTATGTTTGCTGTAAGAGG - Intronic
947693858 2:232165934-232165956 ATAAGCATGTTAGTAGTTATGGG + Intronic
1176452110 21:6872856-6872878 ATAAGCATGTTTCCTGTGAGTGG - Intergenic
1176830282 21:13737905-13737927 ATAAGCATGTTTCCTGTGAGTGG - Intergenic
1179115377 21:38486691-38486713 ATAATAATGTTAGCTGTTATGGG - Intronic
1179117830 21:38510149-38510171 AGAAGCTTTTTAGATGTTTGGGG - Intronic
1182906317 22:33939986-33940008 ATCACATTGTTAGCTGTGAGGGG + Intergenic
957716227 3:83932577-83932599 AGAAGCCTGTTAAATGTTAGAGG - Intergenic
960705682 3:120478473-120478495 AAAAGTGGGTTAGCTGTTAGTGG + Intergenic
964482012 3:157148885-157148907 ATTAGATTGTTAGCTCTTCGTGG - Intronic
964963233 3:162455568-162455590 ATAAGTTTGTTAGCCAGTAGAGG + Intergenic
967577122 3:191107340-191107362 ATATGATTGTTGGCTGTTAGAGG - Intergenic
967797269 3:193611256-193611278 ATAAGCTTATTAGCCTTTTGAGG + Intronic
971559617 4:28060707-28060729 ATAAGTTTGGTAGCTATAAGAGG - Intergenic
977962382 4:103100663-103100685 ATAGCCTTGTTTGCTGCTAGGGG + Intergenic
978069869 4:104453967-104453989 ATAAGTTTGTTAACTGTGAGAGG - Intergenic
979078062 4:116299528-116299550 ATTAGGTTGTTAACTGTCAGTGG - Exonic
981737602 4:147969241-147969263 ATAAGCTTGAAAGCTGATTGGGG + Intronic
987732134 5:21787351-21787373 GTAATCTTGTTTGCTGGTAGAGG - Intronic
990585058 5:57202736-57202758 ATTAGATTGTAAGCTGTTAGAGG + Intronic
990671375 5:58133900-58133922 ATAAGCTTGTTACCAGGGAGTGG + Intergenic
993781218 5:92067210-92067232 ATAAGATTTTTAGGAGTTAGAGG + Intergenic
995487157 5:112650749-112650771 ATAAGCTTATTATCTGACAGGGG - Intergenic
996049957 5:118921145-118921167 ATAAGCCTCCTAGCTGTGAGGGG + Intronic
998729443 5:145057778-145057800 ATAAGCTTGAGAGCTTTAAGTGG - Intergenic
999430155 5:151518907-151518929 ATAAGCTTGTCAGTTGTCAGGGG + Intronic
999835244 5:155363421-155363443 CTTAGCTTGTTAGCTGTAAAGGG - Intergenic
1002341131 5:178517162-178517184 ATAAGACTGACAGCTGTTAGGGG - Intronic
1004135533 6:12962398-12962420 ATTAACTTGATAGCTGTTGGGGG - Intronic
1005228468 6:23671445-23671467 CTAAGATTGCTAGCTGTTAGTGG + Intergenic
1013702066 6:112784017-112784039 ATTAGCTTTTTAGATGTTATAGG + Intergenic
1014920295 6:127206550-127206572 ATAAACTTGTTAACTATCAGGGG + Intergenic
1014960386 6:127676406-127676428 ATATGCTTGTTAGCTGTGTGTGG + Intergenic
1015579563 6:134708863-134708885 AAAAGCTAGTTAGCTCTGAGAGG - Intergenic
1016750489 6:147625959-147625981 CTCAGCTTGTTTGCTGTTAAGGG + Intronic
1017099378 6:150834252-150834274 CTAAGCTGGTTTGCTGTTACAGG + Intronic
1020447018 7:8279663-8279685 AGAAGCTTGGGAGCTGTCAGTGG + Intergenic
1029896966 7:103993331-103993353 ATAAGTTTATTAGCTGCTATTGG - Intergenic
1031796971 7:126186804-126186826 AGAAGCTTGTTACATTTTAGGGG + Intergenic
1033191474 7:139284340-139284362 ATGAGTTTGTTAGCTTTGAGGGG - Exonic
1037295928 8:17400347-17400369 ATAAGTTAGTGAGCTGTAAGAGG + Intronic
1037572730 8:20172390-20172412 ATGAGCTTGTAAGCTCCTAGAGG + Intronic
1049027434 8:140004641-140004663 ATTAGCTTGGTTGCTGTCAGTGG + Intronic
1049989571 9:978101-978123 AAAGGCTTGTGAGCTGATAGCGG + Intronic
1203517071 Un_GL000213v1:11659-11681 ATAAGCATGTTTCCTGTGAGTGG + Intergenic
1185881839 X:3748171-3748193 CTAAGCTTGCTAGCTGTTCATGG - Intergenic
1188601188 X:31966781-31966803 AAAATCTTGTTATCTGTTATTGG - Intronic
1188665356 X:32812753-32812775 ATAAGCTTGTTAGCTGTTAGGGG - Intronic
1189629595 X:42938751-42938773 AGAAGTTTGTTAGATGTTATAGG + Intergenic
1190431574 X:50382778-50382800 ACTAGCTTATTAGCTGTAAGAGG + Intronic
1190463341 X:50700940-50700962 ATCTGCTTATTAGCTGGTAGAGG - Intronic
1200852271 Y:7896102-7896124 AGAAGCATGTTACATGTTAGTGG - Intergenic
1202117552 Y:21485329-21485351 ATATGTCTGTTAGCTTTTAGTGG + Intergenic