ID: 1188665512

View in Genome Browser
Species Human (GRCh38)
Location X:32815137-32815159
Sequence CTGGAAACCCAGTCGGGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188665505_1188665512 11 Left 1188665505 X:32815103-32815125 CCTCTGTTCTAAATCAGGTTGCT 0: 1
1: 0
2: 0
3: 10
4: 240
Right 1188665512 X:32815137-32815159 CTGGAAACCCAGTCGGGATGGGG 0: 1
1: 0
2: 0
3: 7
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188665512 Original CRISPR CTGGAAACCCAGTCGGGATG GGG Intronic
900089670 1:914422-914444 CTGGTGACCCTGGCGGGATGGGG - Intergenic
900884652 1:5405749-5405771 CTGAGAACCCAGTGGGGCTGAGG - Intergenic
901677744 1:10896899-10896921 CTGGGTACCCAGTGGGGCTGGGG + Intergenic
905019713 1:34800570-34800592 CTGTAATCCCAGGCGGGAGGCGG + Intronic
906124624 1:43420130-43420152 CTGGAAGACCAGTGGAGATGGGG - Intronic
914419514 1:147516515-147516537 CAGGAAACTCAGTCTGGTTGGGG - Intergenic
921572521 1:216796265-216796287 CTGGGAGCCCAGTGGGGAAGTGG - Intronic
921714242 1:218401826-218401848 CTTGATGCCCAGTCGGGACGCGG - Intronic
923223120 1:231914309-231914331 CTGGAAACCCTGTCTGCAAGCGG + Intronic
924193242 1:241578170-241578192 CTGCAAACACAGTGGGAATGGGG - Intronic
1063128211 10:3154044-3154066 CTGGAGGCCCAGTCGGGGTGTGG - Intronic
1065378806 10:25068366-25068388 CTGCATACCCATTCGGGAAGAGG + Intergenic
1066439872 10:35428274-35428296 CTGGAGCCCCAGTCGGGATCAGG - Intronic
1074780902 10:116801466-116801488 CTGTGAACCCCCTCGGGATGGGG - Intergenic
1077005765 11:355462-355484 CTGGAAGCCGAGTCGGCCTGAGG + Intergenic
1077167207 11:1149078-1149100 CTGGAAACCCAGAGGTGCTGGGG - Intergenic
1078469976 11:11578938-11578960 CTGGAAACCCAAAAGGGATGGGG + Intronic
1079983041 11:27171908-27171930 CTAGGAACCCAGTGGGGAGGTGG + Intergenic
1081565353 11:44257531-44257553 CCGGAACCCCAATCAGGATGTGG - Intergenic
1083378486 11:62245084-62245106 CTGGATACCCATTCAGGCTGGGG - Intergenic
1085523645 11:77152286-77152308 CGGGAAAGGCGGTCGGGATGTGG - Intronic
1087007833 11:93486566-93486588 CTGAAAACTCAAGCGGGATGTGG - Intronic
1090490159 11:127153585-127153607 CTCGAAACCCAGTCAGCATGGGG - Intergenic
1092281291 12:7099710-7099732 CTGGAAAGACAGACAGGATGGGG - Exonic
1094428002 12:30336125-30336147 TTGGCAACTCAGTCAGGATGTGG - Intergenic
1095195267 12:39307576-39307598 CTGGAAATGCTGTCAGGATGTGG - Exonic
1104155370 12:126126170-126126192 CAGGAACCACAGTGGGGATGAGG + Intergenic
1105702570 13:22944224-22944246 CTGGAAGCCCAGTAGGGAAAGGG - Intergenic
1105855194 13:24366007-24366029 CTGGAAGCCCAGCCGGGAAAGGG - Intergenic
1115217477 14:31026825-31026847 CAGGAATCCGAGACGGGATGCGG - Intronic
1115509266 14:34123860-34123882 ATGGAAACCTTGTCGGGAGGAGG + Intronic
1117918690 14:60705278-60705300 CTTGATACCCAGTAGGGAAGTGG + Intergenic
1119319451 14:73720958-73720980 GTGAAAACCCAGTAGGTATGTGG - Intronic
1119948623 14:78721302-78721324 CTGGAAACCTACGAGGGATGAGG - Intronic
1122499564 14:102187754-102187776 GGGGAAACCCAGGCTGGATGAGG + Intronic
1123491810 15:20787035-20787057 ATGGAAGCCCAGTGGGGAGGAGG - Intergenic
1202956645 15_KI270727v1_random:83360-83382 ATGGAAGCCCAGTGGGGAGGAGG - Intergenic
1133020489 16:2964772-2964794 CTGGGGACCCAGGCGGGAGGTGG + Intronic
1133129639 16:3668880-3668902 CAGGAAACACATTCAGGATGGGG + Intronic
1133231077 16:4366913-4366935 CTGGCAACACAGTGGGGACGGGG - Intronic
1133798561 16:9066346-9066368 CTGGACACCCAGTTGGTGTGTGG + Intergenic
1138433815 16:56986081-56986103 CTGGAGTCCCAGTCAGGCTGGGG - Intergenic
1140941369 16:79724171-79724193 GTAGAATCCCAGTCTGGATGTGG - Intergenic
1142750764 17:1986136-1986158 CAGGAAAACCAGGCGGGATCTGG + Intronic
1147952689 17:44115805-44115827 CTGGAAAGCCAGGCAGGACGCGG + Intronic
1148464691 17:47857837-47857859 CTGAAGACCCAGTGGGGCTGAGG + Intergenic
1151185634 17:72361969-72361991 CTGGAAACCCAACTGGTATGCGG + Intergenic
1152144028 17:78556944-78556966 CTGGAAGCCGAGTCGGGAACCGG - Intronic
1152620165 17:81359399-81359421 CTGGAAATCCATCCGGGCTGCGG + Intergenic
1155948081 18:31877947-31877969 CTGCAAGCCCAGTTGGCATGGGG - Intronic
1156282841 18:35657781-35657803 CTGGAGAAACAGTAGGGATGTGG + Intronic
1157912017 18:51625285-51625307 CTGGAATCCCAGTGGGGTGGGGG + Intergenic
1162741922 19:12778380-12778402 CTGGAAAACCACGCGGGAGGAGG - Intronic
1163102124 19:15104396-15104418 GTGGAGACCCAGTCTGGACGAGG + Intergenic
925383241 2:3443298-3443320 CGGGAAAACCAGTGGGGAGGAGG - Intronic
926143300 2:10381377-10381399 CTGGAAACCCAGACCTGAGGTGG - Intronic
926889769 2:17629145-17629167 CTGAAAACTCAGTCTGGGTGTGG - Intronic
928044537 2:27915894-27915916 ATGGAAAACCAGTGGAGATGGGG - Intronic
928109355 2:28494149-28494171 ATGGTAACCCAGTTGGGCTGTGG + Intronic
932581650 2:72996077-72996099 CTTGTAATCCAGTGGGGATGAGG + Intronic
935587704 2:104816639-104816661 CAGGAAACCCACTAGGCATGAGG - Intergenic
936089455 2:109491534-109491556 CTGGAAACTGAGTCTGGTTGAGG + Intronic
938365459 2:130729770-130729792 ATGGGCACCCAGCCGGGATGTGG + Exonic
946716526 2:222559279-222559301 CTGGAGAGCCAGTAGAGATGGGG + Exonic
1170366224 20:15601170-15601192 CTGGAACCCCAGTGAGGCTGAGG - Intronic
1181440151 22:22931546-22931568 CTGGAAACCCAGCAGGGTTAAGG + Intergenic
1183083542 22:35472700-35472722 AAGGACACCCAGTCGGTATGTGG - Intergenic
1183353459 22:37346171-37346193 CTATAAACCCAGGCGTGATGTGG - Intergenic
1184409052 22:44316164-44316186 CAGGGAACCCAGTTGGGACGTGG + Intergenic
1185037332 22:48486343-48486365 CTGGAAACAAGGCCGGGATGGGG + Intergenic
952958820 3:38577038-38577060 CTGGGAAGCCACTGGGGATGGGG + Intronic
954453935 3:50586793-50586815 CTGGAAAGCCAGGTGGGGTGGGG - Intergenic
955491180 3:59484770-59484792 CTGAAAACTCAGTAGGGATTTGG + Intergenic
960928759 3:122822965-122822987 CTGGCAACACAGTGGGGAGGTGG - Intronic
960954770 3:123024487-123024509 CTGGATTCCCAGTGGGAATGGGG + Intronic
961667075 3:128499144-128499166 CTGGAAGCCCAGCTGGGCTGCGG - Intergenic
963503820 3:146160911-146160933 CTGGAATCCCTGTCTGGGTGCGG - Exonic
965430505 3:168581832-168581854 ATGGAAACCAAGTCTGAATGAGG + Intergenic
965534129 3:169807272-169807294 CTGGAAACCCATTGTGGATTTGG - Intronic
969866602 4:10080440-10080462 CTGGACAGCCAGTGGGGGTGGGG - Intronic
980917711 4:139049534-139049556 CTGGAAATCCAGGCCGGGTGTGG - Intronic
982074969 4:151730069-151730091 CTGGAAACAGACTCGGGGTGTGG + Intronic
986327058 5:6684190-6684212 CTAGAAACCCAGGCGGGAGATGG + Intergenic
989535486 5:42559248-42559270 TTGGAAACCTAGGCTGGATGTGG + Intronic
997309253 5:132866353-132866375 GTGGAATCCCAGTCAGGAAGCGG - Intronic
997586881 5:135048613-135048635 CTGGACCCCCAGCTGGGATGTGG + Intronic
999524117 5:152383846-152383868 CTGGAGACCCAGGAGAGATGAGG - Intergenic
1001159190 5:169299520-169299542 CTGGGAACCCAGCCGAGAAGTGG - Intronic
1001818734 5:174693250-174693272 CTGGAAACACAGGGGGGAGGGGG - Intergenic
1005200616 6:23340383-23340405 CTGGAACCCCTGCCGGGATGTGG + Intergenic
1006748329 6:36360784-36360806 CTGGAAGCACAGTGGGGCTGTGG - Intronic
1006787630 6:36679087-36679109 CTGGAAACCCAGCTGGGGCGAGG + Intronic
1008766874 6:54928069-54928091 CTGGCAACCCAGTCCAGGTGAGG + Intronic
1011648003 6:89478609-89478631 CTGTAATCCCAGCCGGGGTGAGG + Intronic
1014365221 6:120531905-120531927 CTGGAAAAGCAGTGGGGATGGGG - Intergenic
1014755212 6:125295399-125295421 TTTGAAACCCAGTCTGGATCTGG - Intronic
1017505731 6:155067165-155067187 CTGAAGACCCAGTCTGGCTGTGG + Intronic
1024527709 7:50362898-50362920 CAGGAAACACAGGCAGGATGTGG + Intronic
1027024572 7:74841581-74841603 CTGTAATCCCAGTGTGGATGAGG - Intronic
1027063193 7:75102541-75102563 CTGTAATCCCAGTGTGGATGAGG + Intronic
1027460534 7:78447525-78447547 CTGGATACCCAATGGGGATCTGG + Intronic
1034342893 7:150369306-150369328 CTGGAATTCCTGTCGGGAGGAGG + Intronic
1035044700 7:155956038-155956060 CTGGAAACCCACCCTGGAGGTGG + Intergenic
1039304802 8:36249838-36249860 CTGGAGACCCAGGAGGGTTGTGG + Intergenic
1042488590 8:69373938-69373960 CTGGGATCCCAGTGGGGCTGGGG - Intergenic
1048753370 8:137704511-137704533 CTGGACACCCAGTAGGCATTTGG + Intergenic
1049179272 8:141212789-141212811 CTGTCAATCCAGTCGGGACGTGG + Intronic
1060190291 9:121588423-121588445 GGGGAACCCCAGTTGGGATGAGG - Intronic
1061615221 9:131774760-131774782 CTGGAAAAGGAGTCGGGCTGTGG + Intergenic
1061822592 9:133236786-133236808 CAGGGGACCCAGTTGGGATGAGG + Intergenic
1062635092 9:137486551-137486573 TTGGACACTCATTCGGGATGTGG - Intronic
1188665512 X:32815137-32815159 CTGGAAACCCAGTCGGGATGGGG + Intronic
1190063106 X:47223378-47223400 CTGGAAACCCAGCATGGATGGGG - Intronic