ID: 1188667900

View in Genome Browser
Species Human (GRCh38)
Location X:32847044-32847066
Sequence CTATATATACACAAGAAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 1, 2: 0, 3: 18, 4: 257}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188667900_1188667901 1 Left 1188667900 X:32847044-32847066 CCAATCTTCTTGTGTATATATAG 0: 1
1: 1
2: 0
3: 18
4: 257
Right 1188667901 X:32847068-32847090 TTGACAGTATACAAGTTTAATGG 0: 1
1: 0
2: 0
3: 10
4: 171
1188667900_1188667902 11 Left 1188667900 X:32847044-32847066 CCAATCTTCTTGTGTATATATAG 0: 1
1: 1
2: 0
3: 18
4: 257
Right 1188667902 X:32847078-32847100 ACAAGTTTAATGGTAATTATAGG 0: 1
1: 0
2: 0
3: 12
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188667900 Original CRISPR CTATATATACACAAGAAGAT TGG (reversed) Intronic
900912450 1:5610723-5610745 TTATATATAAAAAAGAAGAAAGG - Intergenic
907264248 1:53246654-53246676 CTATATTTACAGAAGATGTTTGG - Exonic
907863857 1:58379854-58379876 TTCTATATAAAAAAGAAGATGGG - Intronic
908886170 1:68791417-68791439 CTGTGAAGACACAAGAAGATGGG + Intergenic
911561353 1:99409919-99409941 CTGTATTTACACATGAACATGGG - Intergenic
913560815 1:120017572-120017594 CTATAAATACACTTGAAGTTTGG + Intronic
913637312 1:120776030-120776052 CTATAAATACACTTGAAGTTTGG - Intergenic
914281398 1:146176985-146177007 CTATAAATACACTTGAAGTTTGG + Intronic
914542443 1:148627920-148627942 CTATAAATACACTTGAAGTTTGG + Intronic
914624190 1:149443323-149443345 CTATAAATACACTTGAAGTTTGG - Intergenic
915986206 1:160467453-160467475 ATATATACACAAAAGAAGAAAGG - Intergenic
916760663 1:167813975-167813997 GAATATATACAAAAGAAAATGGG + Intronic
917050944 1:170922523-170922545 ATAGATATAAAGAAGAAGATAGG + Intergenic
917202202 1:172529722-172529744 ATATATATAAAGAAGATGATCGG + Intergenic
917214244 1:172661422-172661444 CCATATGTACACAAGCAGAGTGG + Intronic
917832019 1:178901150-178901172 TCATACATACAAAAGAAGATAGG + Intronic
918669185 1:187192826-187192848 ATATATATACACAATAACAAAGG - Intergenic
919032788 1:192266306-192266328 ATATATATATACATGAAAATAGG + Intergenic
920543460 1:206796712-206796734 GTGTATTTACACAATAAGATAGG - Intergenic
921968720 1:221121167-221121189 CTATATAAAGCCAAGAAAATGGG + Intergenic
923317506 1:232795560-232795582 ATATACATACAAAAGAAGAGGGG + Intergenic
923378119 1:233387068-233387090 CTATATATACACTAGGAAACAGG + Intergenic
923922120 1:238578532-238578554 CTATATATAAACCAGAAAGTGGG + Intergenic
1064113387 10:12557384-12557406 CTAAAAATACACAAAAAAATTGG + Intronic
1065301440 10:24325122-24325144 CTATATATACACAAAAACTCGGG + Intronic
1066596785 10:37059662-37059684 ATATATTTACACATGAAGATAGG + Intergenic
1067161659 10:43830462-43830484 CTATATATCCACAAGCATAATGG - Intergenic
1068560331 10:58507932-58507954 CTCTATAAAAACAAAAAGATTGG + Intergenic
1068683429 10:59844311-59844333 AGATATATACCCAAGTAGATAGG - Intronic
1069259729 10:66380214-66380236 GCACATATACACAAGCAGATTGG - Intronic
1069357579 10:67605176-67605198 CTATATATACAAAGGAAAAAAGG + Intronic
1071669257 10:87592266-87592288 ATATATATACCCAAGCAAATTGG + Intergenic
1075206265 10:120451955-120451977 CTACAACTACAAAAGAAGATAGG - Intergenic
1075363136 10:121858166-121858188 ATATATACACAAAAGAAAATAGG - Intronic
1076622341 10:131799508-131799530 ATATATATCCCCATGAAGATGGG + Intergenic
1078667349 11:13337291-13337313 CTATAGACACATAAGAAGACTGG + Intronic
1079049797 11:17144179-17144201 GTATATAAACAAAAGCAGATAGG - Intronic
1080023419 11:27588492-27588514 GTATATATCCAAAAGAAAATAGG - Intergenic
1080207990 11:29753311-29753333 CTATTTGTACACAGGCAGATAGG - Intergenic
1081245443 11:40760774-40760796 ATATATATACACACAAAAATTGG - Intronic
1081299304 11:41430779-41430801 ATATATATACACAAAAATATAGG - Intronic
1082833177 11:57634445-57634467 GTATTTAGACACAAGAAGATGGG - Intergenic
1085193279 11:74647967-74647989 CTTTATTTACACATGAAGACAGG + Intronic
1085928219 11:81047842-81047864 GTATATATATATATGAAGATTGG - Intergenic
1085928220 11:81047891-81047913 ATATATATATATATGAAGATTGG - Intergenic
1085928221 11:81047944-81047966 ATATATATATATATGAAGATTGG - Intergenic
1085928225 11:81048128-81048150 GTATATATATATATGAAGATTGG - Intergenic
1085928234 11:81048472-81048494 GTATATATATATATGAAGATTGG - Intergenic
1085928242 11:81048794-81048816 TTATATATATATATGAAGATTGG - Intergenic
1086620440 11:88882078-88882100 CTAAATATACACAATTAGCTGGG + Intronic
1088405511 11:109471931-109471953 CAATAGATACATAAGAAGAAAGG + Intergenic
1090695240 11:129234562-129234584 CTATATATCTGCAAGAAGAATGG + Intronic
1091640485 12:2233100-2233122 CCATATAAACACAAGCTGATAGG - Intronic
1092354768 12:7785471-7785493 CTATAAAAACACAAGCAGCTAGG - Intergenic
1094228814 12:28079378-28079400 ATATATACATACTAGAAGATGGG - Intergenic
1097347284 12:58507214-58507236 CTATATAGACACATGATGATTGG - Intergenic
1097933347 12:65215308-65215330 CTATATTTACAGAAGAAGGAGGG + Intronic
1098280870 12:68861687-68861709 CTAAAAATACAAAATAAGATGGG - Intronic
1098797868 12:74915601-74915623 ATATATATATACATAAAGATGGG + Intergenic
1098845624 12:75531667-75531689 CTATGTATGCAAAAGAAGAGTGG - Intergenic
1098877826 12:75884929-75884951 CATTATACACACAAGAAGAAAGG + Intergenic
1099755402 12:86840554-86840576 CTGAATAAACACAAGGAGATTGG + Intergenic
1107572777 13:41680762-41680784 CAACATATACACAAGCAGACTGG + Intronic
1107577366 13:41741151-41741173 CTATAGATAAACATGAAGACTGG + Intronic
1109041128 13:57338579-57338601 CCATAAAAACCCAAGAAGATTGG + Intergenic
1109309971 13:60681713-60681735 GTATATATACACACGTATATAGG - Intergenic
1109494746 13:63154466-63154488 CTATATATACAGAATATAATAGG - Intergenic
1110399689 13:75075544-75075566 ATATATATACATAAGTAGCTGGG - Intergenic
1110894769 13:80735774-80735796 CAATAAAAACACAATAAGATAGG + Intergenic
1111288564 13:86129994-86130016 CTATATATAAAAGAAAAGATGGG - Intergenic
1111547849 13:89767230-89767252 CTTTATATACACAGGTGGATTGG + Intergenic
1111884922 13:94008329-94008351 CTATATACACTCATGAACATTGG + Intronic
1113338145 13:109396545-109396567 ATATACACAGACAAGAAGATAGG + Intergenic
1114854725 14:26424545-26424567 ATTTATATTCAAAAGAAGATTGG + Intergenic
1115015253 14:28603569-28603591 CTAAATATAGATAAGGAGATAGG + Intergenic
1115373389 14:32645200-32645222 CTATATATACAAAAAATTATTGG - Intronic
1115475410 14:33808647-33808669 CTATGTACACAGAGGAAGATGGG - Intergenic
1116228597 14:42185728-42185750 TTATATATATAAAAGCAGATGGG + Intergenic
1116691067 14:48106219-48106241 CCTTATATATACTAGAAGATTGG + Intergenic
1117403661 14:55380842-55380864 ATATATATACACACAAAGAATGG - Intronic
1117426182 14:55599943-55599965 CCATATACACACAAAAAGTTTGG - Intronic
1119141957 14:72275396-72275418 CTAAGTATACACTGGAAGATTGG + Intronic
1122089653 14:99329947-99329969 CTACTTAGACACAAGAAGAAGGG + Intergenic
1126981265 15:54246453-54246475 CTATACATAAAAAAGAATATGGG + Intronic
1128533638 15:68472981-68473003 CTATAGCTACACAATAATATAGG - Intergenic
1131180891 15:90239106-90239128 CTATATAAACAGTTGAAGATTGG + Intronic
1131642880 15:94311606-94311628 CCATATATAAACACCAAGATAGG - Intronic
1131972619 15:97907301-97907323 CATTATATACACAAGGAAATAGG - Intergenic
1136153878 16:28369448-28369470 GTACATATACACAAAAAGAAAGG + Intergenic
1136209213 16:28745816-28745838 GTACATATACACAAAAAGAAAGG - Intergenic
1138067551 16:53957931-53957953 CTATTTAAACAATAGAAGATAGG - Intronic
1140642586 16:76993899-76993921 CTCTATTTCCACAAGAAGAGAGG + Intergenic
1143933170 17:10452549-10452571 TTATACATAGAAAAGAAGATTGG - Intronic
1144417523 17:15065459-15065481 CTATATGTACATTAGAATATTGG + Intergenic
1144935930 17:18899063-18899085 CTAAATATACAAAAGTAGCTGGG - Intronic
1146866770 17:36343268-36343290 CTATATATGCCCATTAAGATAGG - Intronic
1147069638 17:37943877-37943899 CTATATATGCCCATTAAGATAGG - Intergenic
1147081168 17:38023415-38023437 CTATATATGCCCATTAAGATAGG - Intronic
1147097110 17:38147372-38147394 CTATATATGCCCATTAAGATAGG - Intergenic
1152213595 17:79018773-79018795 CTAAAAACACACAAGATGATGGG - Intergenic
1153353507 18:4108616-4108638 GTATATATGCAAAACAAGATTGG + Intronic
1153467802 18:5408573-5408595 CTATATACATTCAAGAAAATTGG - Intronic
1153853154 18:9116214-9116236 CTTTATAGAGAAAAGAAGATAGG + Intronic
1156644487 18:39144293-39144315 CTTTATTTTCCCAAGAAGATGGG - Intergenic
1157644570 18:49254318-49254340 ATATATATACACACATAGATGGG + Intronic
1158240918 18:55377088-55377110 GAAAATATAGACAAGAAGATGGG - Intronic
1159403203 18:67964033-67964055 AAATATATACACAAGCATATTGG + Intergenic
1159622827 18:70658245-70658267 CTATACATACACTAGTAGTTGGG - Intergenic
1161159448 19:2753761-2753783 CTACAAATACAAAAAAAGATTGG - Intergenic
1165809288 19:38601108-38601130 CTAAAAATACAAAAGAAGCTAGG - Intronic
1167030990 19:46960264-46960286 ATACGTATACCCAAGAAGATGGG - Intronic
1167063032 19:47163115-47163137 CTATGTATATACAACAAAATTGG + Intronic
925558841 2:5165587-5165609 ATATATATATATCAGAAGATTGG + Intergenic
928842335 2:35625187-35625209 CTAGATATATACCAGAAAATAGG + Intergenic
929132354 2:38589851-38589873 CCCTAAATACACAAGAAGAGAGG + Intronic
929269206 2:39954665-39954687 CTATTTCTACATAACAAGATGGG - Intergenic
929294549 2:40232468-40232490 CTCTATTTACACAAAGAGATTGG + Intronic
930871564 2:56176151-56176173 CTGTATGCACACAAGAATATGGG + Intergenic
931442509 2:62300533-62300555 GTACATATACAGAAAAAGATTGG - Intergenic
932633338 2:73366068-73366090 ATATATATATATAAGAATATGGG - Intergenic
933140417 2:78785662-78785684 CACTATACACACAAGAAAATCGG + Intergenic
933204454 2:79489428-79489450 GTATATTTACACAAGAATAATGG + Intronic
935133105 2:100275938-100275960 ACATATATACACATGCAGATAGG + Exonic
939766753 2:146260203-146260225 CTAAATATAAAGAAGAAGCTGGG - Intergenic
941224841 2:162835664-162835686 CTATATATACACCTTAAAATGGG + Intronic
941314860 2:163979660-163979682 CTATATTTACACAGGTAGGTAGG - Intergenic
941506711 2:166355236-166355258 ATATATATATAAAAGAAGACAGG - Intronic
941710026 2:168702192-168702214 CAATATATACTCAAGAAGAGAGG - Intronic
941889480 2:170563877-170563899 CTTTATCTACAGAAGAAGCTGGG + Intronic
943473422 2:188324229-188324251 CTAAGTAAACACAAGAAGAGTGG - Intronic
945017858 2:205538531-205538553 CTATATGTATACAAGATGAGTGG - Intronic
945572469 2:211486040-211486062 ATATTCATACACAAGAAGCTTGG + Intronic
945617564 2:212091665-212091687 CTATACATATACAAATAGATTGG - Intronic
946121799 2:217522587-217522609 CTATATATTGAAAAGAAAATTGG - Intronic
947694518 2:232173394-232173416 CTATAAAAACACAAAAAAATTGG - Intronic
947780442 2:232755912-232755934 CTATATATACACAAGTAGATAGG - Intronic
948546937 2:238739347-238739369 GTGTATATGCAAAAGAAGATAGG - Intergenic
1169949304 20:11025543-11025565 CCATACATACACAAAAATATTGG - Intergenic
1172423181 20:34835112-34835134 CCATACATACACAAAAAGGTGGG + Intergenic
1175386483 20:58598874-58598896 ATATAGATACACAGGCAGATAGG - Intergenic
1177814105 21:25957322-25957344 CTATATATTGAAAAGAGGATAGG + Intronic
1178130820 21:29570936-29570958 CTGTATTTACACAAGAGAATAGG - Intronic
1178488830 21:33035130-33035152 CTCTATTTACATAAGAAGAGAGG - Intergenic
951161408 3:19427092-19427114 CTCTATCTTCAAAAGAAGATGGG + Intronic
955136740 3:56226571-56226593 ATATATATACATAAAAAGACAGG + Intronic
955706675 3:61734832-61734854 CTATTTATATACAAGAAGCTAGG - Intronic
956658660 3:71578576-71578598 ATAAATATGCACAATAAGATTGG + Intronic
957128514 3:76194306-76194328 ATATATATACATAAAAAGAGAGG - Intronic
957358425 3:79121660-79121682 CTATATTTACAATAGAATATTGG - Intronic
957473949 3:80700219-80700241 CTGTTTATACTCAAGAGGATAGG - Intergenic
957861689 3:85960156-85960178 CAATATCAAAACAAGAAGATTGG - Intronic
959264885 3:104124611-104124633 CTCTATATGAACAAGAAGGTGGG + Intergenic
961845700 3:129761160-129761182 CTAAAAATACAAAAGAAAATTGG + Intronic
961848284 3:129788065-129788087 CTATATATACACAAAAGGAAGGG + Intronic
962148421 3:132866554-132866576 ATACATATATACAAGAAGAATGG + Intergenic
962581054 3:136798179-136798201 CTTTATATAAATAAGATGATGGG + Intergenic
963798280 3:149653221-149653243 CTATACATAAACCAGAAAATGGG - Intronic
963982069 3:151549451-151549473 CTGGATATAAAGAAGAAGATAGG - Intergenic
964091090 3:152876497-152876519 CTAAAAATACACAAAAAAATTGG + Intergenic
964464370 3:156974046-156974068 CTATAAGTACACAACAAGATGGG + Intronic
964480097 3:157131150-157131172 CTATATGTCCCCAAGATGATGGG + Intergenic
965008103 3:163052387-163052409 ATATATATCCTGAAGAAGATTGG + Intergenic
965747649 3:171942161-171942183 ATATATATACACACATAGATGGG - Intergenic
965925281 3:173971531-173971553 GAATATGTACACAAGAAAATGGG + Intronic
966780778 3:183582230-183582252 ATATATATACATAAGCAGAAAGG + Intergenic
968381199 4:97821-97843 CTATATAACCTAAAGAAGATTGG - Intergenic
970034681 4:11719756-11719778 CTATGTATACACAAGCAGGCTGG + Intergenic
970883845 4:20963901-20963923 ATATATATAAAAAAAAAGATGGG + Intronic
971322834 4:25619127-25619149 ATATATGGACACAAGAAGAAAGG + Intergenic
973032320 4:45360215-45360237 CTATATATTCACAATGAGATGGG + Intergenic
974286503 4:59875617-59875639 CTATATACACATAGGAATATGGG + Intergenic
974478571 4:62416194-62416216 CTTCATATATACAAGCAGATGGG - Intergenic
975255151 4:72226109-72226131 CTATATATTCATTAGAAGAAAGG - Intergenic
975656291 4:76644146-76644168 CTATATATATAAAAGAAAAGAGG - Intronic
976279657 4:83314677-83314699 CTATAGATATACATGAAAATTGG - Intronic
976986831 4:91311112-91311134 ATGTATTTACAGAAGAAGATAGG + Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
979102632 4:116640398-116640420 CTATAGAGACACAATAAAATTGG - Intergenic
979305301 4:119135459-119135481 CTATGTAGACTCAAGAAGAAAGG - Intergenic
979391577 4:120134841-120134863 CTATATACACACATGTAGATAGG - Intergenic
980038442 4:127911897-127911919 CAATATATACAGAAGTAGATGGG + Intergenic
980181871 4:129411135-129411157 CTATATATCCCCTAGAAAATAGG + Intergenic
980312973 4:131158748-131158770 CTCTATATATAGAAGTAGATGGG - Intergenic
980329120 4:131388020-131388042 ATATAAAAACATAAGAAGATTGG - Intergenic
980822865 4:138039186-138039208 CTTTATATACAACAGAATATGGG + Intergenic
980879553 4:138695732-138695754 ATATATATATATTAGAAGATGGG - Intergenic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
982270432 4:153580512-153580534 CTAAATATACACAGGAACACTGG - Intronic
982336441 4:154244353-154244375 TGATATATACACAATAAGAGAGG - Intronic
983720841 4:170849538-170849560 CTATAAATATACAAGAATATGGG - Intergenic
984192174 4:176619288-176619310 CTTTATATAAAGAAGAAGAAAGG + Intergenic
984627252 4:182021103-182021125 GTACATATAAACATGAAGATGGG - Intergenic
984998849 4:185465124-185465146 CTTTATTTAAACACGAAGATAGG + Intronic
986222801 5:5784920-5784942 CTATATATACACACACAAATTGG + Intergenic
986965479 5:13265891-13265913 GTATATATACACATGTATATAGG - Intergenic
989783312 5:45296919-45296941 CTTTATATCCACAAGGAAATTGG + Intronic
989994657 5:50814277-50814299 ATATAGATACACAAAAAAATTGG + Intronic
991234102 5:64374523-64374545 CATTTTATAGACAAGAAGATTGG + Intergenic
992567818 5:78018313-78018335 TTATATATATATAATAAGATTGG - Intronic
993100294 5:83530284-83530306 CTATAAATATGCAAGAAGCTAGG - Intronic
993555109 5:89327006-89327028 AAATATATACACAAGCACATGGG - Intergenic
994049904 5:95350600-95350622 GTATATTTAGAAAAGAAGATGGG + Intergenic
994056771 5:95426081-95426103 ATATATATACACACAGAGATAGG - Intronic
994116666 5:96068852-96068874 ATATATACACACAGGAAGACAGG - Intergenic
995388709 5:111615771-111615793 CAATCTATACACAAGAAGAGTGG + Intergenic
995978582 5:118073625-118073647 CTATATATACACACACATATAGG - Intergenic
995983859 5:118143959-118143981 ATATATATACACATGTAAATAGG - Intergenic
996314469 5:122146240-122146262 CTAAATATAGAAAAGAAGGTTGG + Intronic
999410046 5:151342710-151342732 CTAGAGATACACAAGAAGTGGGG + Intronic
999487738 5:152016131-152016153 CTATATATACACAAAAGTAGAGG - Intergenic
1000565166 5:162837445-162837467 TTATATATATATAAGAAGAAAGG - Intergenic
1002812847 6:650297-650319 TTATCTATAAACAAGATGATTGG + Intronic
1005135279 6:22561669-22561691 TGATCAATACACAAGAAGATAGG + Intergenic
1008755867 6:54795162-54795184 CTATATATACACACTTAAATAGG + Intergenic
1009240488 6:61180138-61180160 CTAGATACAGACAAGAAGATGGG + Intergenic
1009308053 6:62117088-62117110 GTATATATCTAAAAGAAGATCGG - Intronic
1010535787 6:77028241-77028263 TTATATATACACTATAAAATTGG + Intergenic
1010551528 6:77228931-77228953 CTATATATAATCTATAAGATGGG - Intergenic
1010556232 6:77282708-77282730 CAATATATATAAAAGAAAATGGG + Intergenic
1011920453 6:92569296-92569318 TTATATATACACAAGTAGGTAGG - Intergenic
1016499338 6:144701581-144701603 ATATGTATATACAAGAAAATGGG - Intronic
1018189396 6:161295808-161295830 CTAAATATACACAAAAAAAAGGG + Intergenic
1018393457 6:163358793-163358815 TTATTTATACACAAGGAGTTCGG - Intergenic
1020249546 7:6456455-6456477 ATATATATACACACGATCATAGG - Intronic
1022920712 7:35011207-35011229 CTATATATGCATAATAAAATGGG + Intronic
1023934347 7:44728780-44728802 CTAAATATACACAATTAGCTGGG + Intergenic
1025772321 7:64523392-64523414 ATAGATATACAAAAGAAAATAGG + Intronic
1027418562 7:77997997-77998019 TTATATATATACAAGATGATGGG - Intergenic
1027715279 7:81661702-81661724 ATACATATAGACATGAAGATGGG + Intergenic
1028527249 7:91800219-91800241 TAATATATACACAATAAAATTGG - Intronic
1030578435 7:111320063-111320085 ATATATATACACAGAAAGAGAGG + Intronic
1030729035 7:112962315-112962337 CTATATATACACATGCACAGTGG + Intergenic
1031380487 7:121079483-121079505 CTACATATAGACCAGCAGATGGG - Intronic
1031705166 7:124971604-124971626 ATATATATAGTCAAGAAAATAGG - Intergenic
1033465974 7:141590149-141590171 CTGAATATGCACAAGAATATGGG - Intronic
1033718230 7:144025633-144025655 CTCTGTATACACAAAAAAATAGG - Intergenic
1034015315 7:147577512-147577534 CTTTGTATACACAAGTAGAATGG - Intronic
1036911220 8:12758831-12758853 ATATATATATATAAGAAAATTGG + Intergenic
1038223097 8:25629299-25629321 GTATATATACAAAAGAGGAGTGG + Intergenic
1038829012 8:31035923-31035945 CTATATAGAGACAAAAAAATAGG - Intronic
1040632283 8:49229494-49229516 TGATACATACACAAGAAGAATGG + Intergenic
1040677328 8:49766117-49766139 CTATAAAGATACATGAAGATGGG + Intergenic
1041355769 8:56998048-56998070 CTATATATACAATAGAAAACTGG + Intergenic
1042338059 8:67649598-67649620 TTGTATATACACAAGAGCATTGG + Intronic
1042931877 8:74022244-74022266 CTAAAAATACAAAAGTAGATGGG + Intronic
1043804522 8:84654925-84654947 GTATATATACCCAAAAAGAAAGG - Intronic
1045180101 8:99771599-99771621 GTCTATATACACAAGAATAAAGG - Intronic
1045730969 8:105240312-105240334 CTACATATACACATAAAAATTGG - Intronic
1050353269 9:4760378-4760400 CTTTATGTCCACAAGAAGAGCGG - Intergenic
1052496480 9:29231994-29232016 CTTTATATACACAAGAAAACTGG + Intergenic
1052686289 9:31761625-31761647 GTATATATACACATTAATATTGG - Intergenic
1052781679 9:32787566-32787588 ATATATATACACAAAAAAAGGGG + Intergenic
1053551349 9:39082483-39082505 CTATAAAAAGTCAAGAAGATAGG - Intronic
1053815464 9:41902601-41902623 CTATAAAAAGTCAAGAAGATAGG - Intronic
1054615132 9:67284839-67284861 CTATAAAAAGTCAAGAAGATAGG + Intergenic
1055295436 9:74828188-74828210 CTAAAAATACACAAAAAAATTGG + Intronic
1055497232 9:76867732-76867754 CTAAAAATACACAAAAAAATTGG - Intronic
1056094403 9:83237472-83237494 ATATATTTACACAAAAAAATGGG - Intergenic
1057373236 9:94493222-94493244 CTATAAAGACACAGGAACATGGG - Intergenic
1058175519 9:101732007-101732029 CCACATATACACAAGAATAGAGG - Intronic
1058549744 9:106101964-106101986 CTGTATATACACAACAAAAAAGG + Intergenic
1058850377 9:109006158-109006180 CTATATGTACAAAACAAGACTGG - Intronic
1185533169 X:838217-838239 CTAGAAATACATAAGAAGAGAGG - Intergenic
1185934693 X:4242575-4242597 CTATAAATATGCAAGAAAATGGG - Intergenic
1186274514 X:7925081-7925103 CCATATAAAGACAGGAAGATAGG + Intronic
1186973653 X:14876036-14876058 AAATATATACATAAGAAGATTGG + Intronic
1187636268 X:21232196-21232218 CTATGTATAGAAAATAAGATAGG + Intergenic
1188667900 X:32847044-32847066 CTATATATACACAAGAAGATTGG - Intronic
1191113829 X:56831721-56831743 GTAGATAAATACAAGAAGATGGG - Intergenic
1192450986 X:71244752-71244774 CTGTATGTACAAAAGAAGAATGG - Intronic
1192829654 X:74737841-74737863 CTATATATTCACAAGTTAATAGG + Exonic
1194617966 X:96130804-96130826 GTAAATAGAAACAAGAAGATTGG - Intergenic
1194700153 X:97104268-97104290 ATATAGATACAGAATAAGATGGG - Intronic
1197924760 X:131634695-131634717 CTATACATGCACACAAAGATGGG + Intergenic
1198578041 X:138032457-138032479 GTATATGTAGACATGAAGATAGG + Intergenic
1199800269 X:151243806-151243828 ATATATATACATATGAAGCTAGG - Intergenic