ID: 1188670628

View in Genome Browser
Species Human (GRCh38)
Location X:32877850-32877872
Sequence CTGCAGAACCAGACTGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 333}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188670621_1188670628 29 Left 1188670621 X:32877798-32877820 CCTTCTGTATCAAGTTGCAACAA 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1188670628 X:32877850-32877872 CTGCAGAACCAGACTGAGGCTGG 0: 1
1: 0
2: 3
3: 27
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188670628 Original CRISPR CTGCAGAACCAGACTGAGGC TGG Intronic
900159314 1:1216034-1216056 CTCCAGTACCAGACTGGAGCTGG + Intergenic
900264158 1:1749055-1749077 GCCCAGACCCAGACTGAGGCTGG - Intergenic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
900726189 1:4217892-4217914 CTGCAGACCAAGAGTGAGGGAGG + Intergenic
900740077 1:4325758-4325780 CTGCAGGGGCAGCCTGAGGCTGG - Intergenic
900965258 1:5952916-5952938 CTGCAGGCCCCGGCTGAGGCTGG - Intronic
901013823 1:6216313-6216335 CTGCAGAAATAAATTGAGGCTGG + Intronic
903570214 1:24298584-24298606 CTGTAGTCCCAGGCTGAGGCAGG + Intergenic
904208251 1:28869036-28869058 CTGCAGATCCAGACTGAAGCCGG + Intergenic
904678999 1:32215835-32215857 CTGGAAAACCAGCCTGGGGCTGG + Exonic
904834194 1:33324385-33324407 CTGCAGAAACAGGCTGAAGGGGG + Exonic
905232357 1:36522142-36522164 CTGGAGACCCAGTCTGAGGGGGG - Intergenic
906150893 1:43587096-43587118 CTGGAGCACCAGAGTAAGGCAGG + Intronic
906566765 1:46806468-46806490 CTGCAGAAAGAGACTAAGCCAGG + Intronic
907052762 1:51340873-51340895 CTTCAAAACCAGCCTAAGGCCGG + Intronic
907841164 1:58158785-58158807 CTGCAGAGCCAGAAAGATGCAGG + Intronic
908496584 1:64700597-64700619 CTGCAGAACCAGCCCGTGGTAGG - Intergenic
910630527 1:89348779-89348801 CTACCCAACCAGACTGAGGTTGG - Intergenic
910650222 1:89558629-89558651 CAGCACAAACAGACTAAGGCAGG - Intronic
911062367 1:93759363-93759385 CTGCAGCACCACACTGAGCTGGG + Intronic
912099407 1:106186885-106186907 CTGTAGCACCTGACTTAGGCTGG - Intergenic
912704510 1:111902075-111902097 CTGCTGCACCTGAGTGAGGCCGG - Intronic
913323961 1:117610203-117610225 CTGTAGAACTAGCCAGAGGCAGG - Intronic
914942166 1:152032807-152032829 CTGCAGAACCAGAAGGACCCTGG - Exonic
915893081 1:159789378-159789400 CTGCAGAACCACTCTCAGGTTGG + Intergenic
917967361 1:180187062-180187084 CTGCAGACCCACACTGAGGAGGG - Intronic
918856772 1:189765637-189765659 CTGTAGACCCAGGCTGAGACAGG - Intergenic
919523722 1:198621373-198621395 CTGCAGAGCAAGAGTGAGACAGG - Intergenic
919717516 1:200794693-200794715 CAGCAGAGCCAGATTAAGGCAGG - Intronic
920785090 1:209033601-209033623 GAGAAGCACCAGACTGAGGCTGG + Intergenic
920793120 1:209111559-209111581 CTGCACAAACAGACTGAGACAGG + Intergenic
921174758 1:212584410-212584432 GTGCAGTTCCAGTCTGAGGCTGG + Intronic
922208200 1:223467242-223467264 CTGGAGAACAAGACGGATGCTGG - Intergenic
922545636 1:226454463-226454485 CTTCTGAGCCAGACTGGGGCTGG + Intergenic
922784393 1:228275925-228275947 GTGCAGAACCAGGCGGTGGCGGG - Exonic
922988433 1:229884939-229884961 CTGCAGGACCTGACACAGGCAGG + Intergenic
923128179 1:231050653-231050675 CTGAAGGACCTGCCTGAGGCTGG + Intergenic
923192336 1:231631410-231631432 CTGAAGGACCTGCCTGAGGCGGG - Intronic
923366497 1:233266945-233266967 CTGAAGAAACAGACAGAGGTGGG - Intronic
923915028 1:238492311-238492333 TTGGAGAACCAGCCTGAGGGAGG + Intergenic
924477544 1:244395170-244395192 CTGCTGACCAGGACTGAGGCTGG - Intergenic
924606599 1:245540853-245540875 CTGCAGAATCCCACTGAAGCTGG - Exonic
1062850317 10:737712-737734 CTCCAGACCCAGACAGAGGGAGG + Intergenic
1062908804 10:1199174-1199196 CTGCAGGCCCAGCATGAGGCTGG + Intronic
1066277985 10:33887529-33887551 CTAGAGACCCAGACTGAGGTTGG - Intergenic
1068131269 10:52898029-52898051 CGGCAGAAGTAGACAGAGGCAGG - Intergenic
1068310379 10:55266748-55266770 CAGCAGAACCACACAGAGTCTGG + Intronic
1068838804 10:61587321-61587343 TTGCAGGACCAGGCAGAGGCTGG + Intergenic
1069242648 10:66162506-66162528 CTGCAGTACCAGCCTGTAGCCGG - Intronic
1069604202 10:69729560-69729582 CTGCAGAACCAGGCTCCGGCTGG - Intergenic
1069701789 10:70432210-70432232 CTGCCGAAGCAGACTGACGCAGG + Intergenic
1071200029 10:83211574-83211596 CTGCAGAATCAGAGTCAGGGTGG + Intergenic
1071343607 10:84670597-84670619 CTCCAGACTAAGACTGAGGCAGG - Intergenic
1072456413 10:95580198-95580220 CTGAGGAATCAGGCTGAGGCTGG - Intergenic
1073323359 10:102628778-102628800 CTCCAGCCCCAGACCGAGGCAGG + Intronic
1074064786 10:110004409-110004431 CTGTAGTCCCAGGCTGAGGCAGG + Intronic
1075141842 10:119844699-119844721 CTGCCCACCCAGACTGAGGGTGG - Intronic
1076229981 10:128812081-128812103 CTGCAGACCCAGCCTGCGTCAGG - Intergenic
1077034713 11:489052-489074 CTGCAGAGCCAGGCAGAGCCGGG - Intronic
1077098675 11:811209-811231 CTGTAGTCCCAGACTGAGGTGGG + Intronic
1077105364 11:839938-839960 CTGAAGAGCCAGATTTAGGCCGG - Exonic
1078129589 11:8602331-8602353 CTGTAGTCCCAGGCTGAGGCAGG - Intergenic
1078460841 11:11514274-11514296 CTGCAGGGCCAGCCTGGGGCAGG - Intronic
1079184259 11:18221780-18221802 CTGCAGAGCCAGAGAGAGCCAGG - Intronic
1080461516 11:32458883-32458905 CTGCAGAGCCATAATGAGCCTGG - Intergenic
1081222836 11:40483217-40483239 CAGCAGGAGCTGACTGAGGCTGG + Intronic
1081702378 11:45159894-45159916 CTGCAGAAACAGAATGGGCCAGG + Intronic
1083266563 11:61549744-61549766 CTGCAGGACCACACAGAGGCAGG + Intronic
1083540665 11:63509755-63509777 CTGGAGAGACAGACAGAGGCTGG - Intronic
1083730194 11:64648657-64648679 CTGCAGAGGCAGACCGGGGCAGG - Intronic
1084459010 11:69285934-69285956 CTGCTAGGCCAGACTGAGGCAGG - Intergenic
1086591428 11:88519469-88519491 TTGCAGAATCAGACTGAGTTGGG + Intronic
1089826223 11:121280727-121280749 ATGCAGTACCAGACTGGAGCTGG - Intergenic
1090068750 11:123525890-123525912 CTGCAAATCCAGCCTGGGGCTGG - Exonic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1092372789 12:7931090-7931112 CTGAAGAAGCAGGCTGAGGCCGG - Intronic
1092898365 12:13035594-13035616 CTGTAGCCCCAGGCTGAGGCAGG - Intergenic
1096572433 12:52531334-52531356 CTCTAGAACCTGACCGAGGCAGG - Intergenic
1097169892 12:57106698-57106720 CTGCAGAAGGGGGCTGAGGCTGG - Exonic
1097998997 12:65921369-65921391 CTGTAGTCCCAGGCTGAGGCAGG - Intronic
1100120586 12:91364888-91364910 CTACTGAAACAGACTGAGGGAGG - Intergenic
1100468596 12:94871539-94871561 CTCCAGAACCAGACAGGGTCTGG + Intergenic
1102539397 12:113607779-113607801 CAGTAAAACAAGACTGAGGCCGG + Intergenic
1102599400 12:114017763-114017785 CTGCAGGATCAGGCTCAGGCTGG + Intergenic
1103459188 12:121090145-121090167 CTGCAGGCCCAGCCTGGGGCCGG + Intergenic
1103933851 12:124465041-124465063 CTGCAGTGGCAGCCTGAGGCAGG - Intronic
1104602534 12:130162959-130162981 CTGCAGGACCAGCCACAGGCGGG - Exonic
1105543002 13:21330995-21331017 CTGGGGAACCAGCCTGAGACAGG - Intergenic
1106836799 13:33643627-33643649 CTGCAAAACCAAACTGAACCGGG - Intergenic
1107349579 13:39500099-39500121 TTGAAGAAACATACTGAGGCAGG - Intronic
1108072445 13:46642044-46642066 CTGCAGAGCCAGACCTAGGCTGG + Intronic
1110092430 13:71470418-71470440 CAGGAGAATCAGGCTGAGGCAGG - Intronic
1111046728 13:82823504-82823526 CAGCAGCACCAGACTAAGGGTGG + Intergenic
1111372553 13:87336026-87336048 CTGGAGATCCATACTGAGGATGG - Intergenic
1112154622 13:96803918-96803940 CTGCAGAACCAGACAGACTGTGG + Intronic
1112916996 13:104564068-104564090 ATGCACATCCAGATTGAGGCCGG + Intergenic
1114283763 14:21220348-21220370 CTGTAGTACAAGGCTGAGGCAGG - Intronic
1115508887 14:34120356-34120378 CTGCAGAATCATACTGAGTTAGG - Intronic
1117213473 14:53526087-53526109 CTGCAGAACCAGCATGAACCAGG + Intergenic
1117420642 14:55541585-55541607 CTGGTCAACCAGACTGAAGCAGG + Intergenic
1118850358 14:69578309-69578331 CTTCAGAATCAGACAGAGCCAGG - Intergenic
1119129307 14:72156870-72156892 CTGCAGGGCCAGACTTAAGCCGG - Intronic
1119593408 14:75911321-75911343 CTGCATAACCAGACTGGGCGCGG - Intronic
1121270082 14:92632095-92632117 CGACAGGACCAGACTGAGGTTGG - Intronic
1121406162 14:93720535-93720557 CTGCTGTACCAGGCTGATGCTGG - Exonic
1122150899 14:99725669-99725691 CTTTAGAACCAGACTGAGCTGGG - Intronic
1122913615 14:104845582-104845604 CTCCAGAAGCAGACTCAGACAGG + Intergenic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1123759399 15:23420954-23420976 CTGAGGTTCCAGACTGAGGCGGG + Intergenic
1124170232 15:27366561-27366583 CAGCAGAACAGGGCTGAGGCTGG - Intronic
1124505094 15:30265452-30265474 CTCCAGTACCAGCCTGAGCCTGG + Intergenic
1124738458 15:32273183-32273205 CTCCAGTACCAGCCTGAGCCTGG - Intergenic
1125883139 15:43210300-43210322 CTGGGGAACCAGAATGGGGCAGG - Intronic
1126589312 15:50323465-50323487 CTGAGGACCCAGAGTGAGGCAGG + Intronic
1126886247 15:53154161-53154183 CTTTAGAACCAGACTGATACTGG - Intergenic
1128496566 15:68201586-68201608 CTGCAGATCCAGGCTGATTCTGG - Intronic
1128509952 15:68307308-68307330 CTGCAGAACTGGGCTTAGGCCGG - Intronic
1129454467 15:75669389-75669411 TTCAAGAACCAGACTGCGGCAGG - Intergenic
1130615622 15:85404356-85404378 TTGCAGAACCAAACTGTGGCAGG - Intronic
1132205544 15:99983798-99983820 ATCCAAAACCAGCCTGAGGCAGG - Intronic
1132673114 16:1109873-1109895 CTGCAGATCCCGACTGCAGCGGG + Intergenic
1132795925 16:1722566-1722588 CTTCAGAACCCAGCTGAGGCTGG + Intronic
1133735370 16:8610994-8611016 CCACAGAATCAGACTGAGGATGG + Intergenic
1133772994 16:8878480-8878502 CTGCTGAGCCAGAGTGAGGAAGG + Intergenic
1136394631 16:29986394-29986416 CTGCAGCACCAGACGGAGCTGGG + Exonic
1136479591 16:30533286-30533308 CTGCAGAGCCAGACAGAGCCTGG + Intronic
1136483370 16:30556245-30556267 CTGCAGAGCCAGACAGAGCCGGG + Intronic
1137392205 16:48091245-48091267 CTGCAGAACCCGAAGGAGGAAGG - Intronic
1137836077 16:51593986-51594008 CTGCAGAAGGAAACTGAGGGAGG - Intergenic
1138447645 16:57074596-57074618 CAGCAGAAGGTGACTGAGGCTGG - Exonic
1138564643 16:57824263-57824285 CTGCACCACCAGCCAGAGGCAGG + Intronic
1138650598 16:58458828-58458850 TTCCAGAGCCAGGCTGAGGCCGG + Intergenic
1139417146 16:66822112-66822134 CAGCAGAACCAGGCTGAGACAGG - Intronic
1139635137 16:68253983-68254005 CAACAGAACCAGACAGGGGCCGG - Intronic
1140048539 16:71459066-71459088 CTGTAGAACTGGACTGAGGATGG - Intronic
1140814481 16:78608593-78608615 CTGCAGACCCATACTGTGGAAGG + Intronic
1141007218 16:80363626-80363648 GTGCTTCACCAGACTGAGGCGGG - Intergenic
1141177483 16:81730494-81730516 CTGCAGATCCGGGCTGGGGCTGG + Intergenic
1141656762 16:85420828-85420850 CTGCAGCTCCAGGCTGCGGCCGG - Intergenic
1142341478 16:89525813-89525835 CTGCAGCACGGGACTGAGGATGG - Intronic
1142556053 17:778264-778286 CTGAAGATCCAGACTGTGACCGG + Intronic
1142797321 17:2318574-2318596 CTGTAGTCCCAGGCTGAGGCAGG - Intronic
1143409553 17:6700614-6700636 CTCCAGAACCACTCTGATGCTGG - Intronic
1143852952 17:9826215-9826237 CAGCAGGACCAGAGTGAGGAAGG - Exonic
1144250058 17:13407431-13407453 AAGCAGAACTAGACTGATGCTGG + Intergenic
1144841211 17:18187146-18187168 CTGCAGAAGCACACTGAAGGGGG + Intronic
1145743732 17:27297577-27297599 CTGTAGTACCAGGCTGAGGTGGG - Intronic
1145879892 17:28345258-28345280 CTGCAGAATCAATCTGAGGGAGG + Exonic
1145885227 17:28377571-28377593 CTGCAGAACCTACCTGAGTCCGG - Intronic
1146888429 17:36487769-36487791 CTACAGAGCCAGACTCAGTCTGG + Intronic
1148058396 17:44816611-44816633 CTCGAGAAGCTGACTGAGGCAGG - Intronic
1148236367 17:45971867-45971889 CTGCAGACCCCCACTGAGGACGG + Exonic
1148644347 17:49210697-49210719 CTGGGGAGCCAGACAGAGGCTGG + Exonic
1149719123 17:58825660-58825682 CTAGAGAATCAGACTGAGGCTGG - Intronic
1151679919 17:75617749-75617771 CTGCAGAGCCAGAGTGATGGGGG - Intergenic
1151861089 17:76762542-76762564 CTGTAGTCCCAGGCTGAGGCAGG + Intronic
1151884960 17:76918118-76918140 CTGCAGACCCAAAGTGGGGCTGG - Intronic
1152408469 17:80110454-80110476 CTGCAGAACCAGAGAGCGTCAGG - Intergenic
1154358587 18:13641566-13641588 CTGCAGAACAGGAGGGAGGCCGG + Intronic
1155238213 18:23842549-23842571 CTGTAGATTCAGCCTGAGGCAGG - Intronic
1155819688 18:30359728-30359750 CTGCTGAACCAGGTTGAGGTGGG - Intergenic
1157175480 18:45448012-45448034 CTGCAAAACAAGACTGAGTATGG + Intronic
1157991769 18:52504800-52504822 CTGGAGAAGCAGGCTGAGGTTGG - Intronic
1158712013 18:59845996-59846018 CTGTAGTCCCAGGCTGAGGCAGG + Intergenic
1159780679 18:72657191-72657213 GTGCACACCCAGATTGAGGCTGG - Intergenic
1160415126 18:78704547-78704569 AGGCAGATCCAGACTGAAGCTGG + Intergenic
1160431513 18:78816328-78816350 CTTCAGAACCAGACAGCAGCAGG + Intergenic
1161035803 19:2083727-2083749 CGGCAGCACCAGGCTGTGGCAGG - Intronic
1161120589 19:2523659-2523681 CTGTGGAACCTGAGTGAGGCTGG + Intronic
1161218147 19:3105012-3105034 CTCCAGACCCAGTCTGAGGCAGG + Intronic
1161671569 19:5614489-5614511 CAGCAGTACCAGACTGAGAAAGG + Intronic
1163250684 19:16124818-16124840 CTGTGGACCCAGGCTGAGGCGGG + Intronic
1163865766 19:19772095-19772117 CTGTAGTCCCAGGCTGAGGCAGG + Intergenic
1164222044 19:23203796-23203818 CTCCTGACCCAGAGTGAGGCTGG + Intergenic
1164934862 19:32202397-32202419 CTGCAGAGCCTGCATGAGGCAGG - Intergenic
1165003838 19:32788232-32788254 CTGTAATCCCAGACTGAGGCAGG - Intronic
1165068505 19:33242048-33242070 ATACAGACCCAGACTGAGGACGG + Intergenic
1165109044 19:33490502-33490524 GTGCAGGACCTGACTGTGGCAGG + Intronic
1165135451 19:33665683-33665705 CTGCTGGACCAGGGTGAGGCTGG + Intronic
1165386558 19:35513591-35513613 CTGCAGACCCAGAGGGAGGGAGG - Exonic
1165633061 19:37317898-37317920 CTGCAGACCCAGCCTGTGCCGGG - Intronic
1167567718 19:50267274-50267296 CTGCAGAGCCAGAATGGAGCTGG + Intronic
1167751878 19:51385775-51385797 CTGGAGAGGTAGACTGAGGCAGG - Intronic
1168215590 19:54923028-54923050 GAGCAGAACCAGCGTGAGGCAGG + Intergenic
1168561723 19:57390097-57390119 CTGATGAACCTGACTGAGGTGGG + Exonic
925024379 2:596110-596132 CTGCAAAACCAGATCCAGGCAGG + Intergenic
925024393 2:596172-596194 CTGCAAAACCAGATCCAGGCAGG + Intergenic
925024407 2:596234-596256 CTGCAAAACCAGATCCAGGCAGG + Intergenic
925987414 2:9227337-9227359 CTGCTGAACGACACTGAGGGAGG - Intronic
926326088 2:11785968-11785990 CTTCAGAAACACAGTGAGGCTGG - Intronic
926633571 2:15158642-15158664 CTGCAGACCCAGCCAGAGTCGGG + Intergenic
927438395 2:23090152-23090174 GTGCCCAACCAGACTGAGGGTGG - Intergenic
927562607 2:24084445-24084467 CTGCGGTGCCAGCCTGAGGCTGG - Exonic
928090924 2:28374704-28374726 CTGCCCAACCAGACTGAAGATGG + Intergenic
928107147 2:28477915-28477937 CTGCAGAAGCAGACTCAGAAGGG - Intronic
928939904 2:36717288-36717310 CTGTAGTCCCAGGCTGAGGCAGG - Intronic
931106374 2:59061091-59061113 CAACAAAACCAGAATGAGGCCGG + Intergenic
932778069 2:74540377-74540399 CGGCAGAACTAGCCTGAGTCAGG + Intronic
933262741 2:80148470-80148492 CTGCAGGGGCAAACTGAGGCAGG + Intronic
935304030 2:101719489-101719511 CAGCAGACCCAGACAGTGGCAGG + Intronic
935560780 2:104557489-104557511 CTGTAGTCCCAGGCTGAGGCAGG + Intergenic
935882927 2:107584437-107584459 CTGCCCACCCAGACTGAGGGTGG + Intergenic
937204721 2:120228113-120228135 CTGAAGAGCCAGACTCTGGCTGG + Intergenic
937341791 2:121095936-121095958 CTGGGGAACCAGTCTGAGGCCGG + Intergenic
938181252 2:129187153-129187175 CAGAGGAACAAGACTGAGGCTGG - Intergenic
938695900 2:133835318-133835340 CTGTAGGATCAGGCTGAGGCTGG - Intergenic
939441015 2:142249298-142249320 CTGCAGAACTACACAGAGGAGGG + Intergenic
939826845 2:147025364-147025386 CTGCAGACTCATTCTGAGGCTGG - Intergenic
944402289 2:199341931-199341953 CTGCAGGACCAGGCTGAAGCTGG - Intronic
945984270 2:216341427-216341449 CTGCTGATGCAGACTGAGCCTGG + Intronic
948113948 2:235479813-235479835 CTGCAGAACCAGCATGGGGGTGG - Intergenic
1169794186 20:9443620-9443642 CTGCAGGATCAGACTGAGGCTGG + Intronic
1170032311 20:11956274-11956296 CCTCAGGACCAGGCTGAGGCTGG - Intergenic
1170662883 20:18360092-18360114 CTGGAGGACAAGCCTGAGGCTGG - Intergenic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171465263 20:25323632-25323654 CTGCAGGCCCAGCCTCAGGCAGG + Intronic
1172468146 20:35172244-35172266 CTCCAGAACCATCCTGAGGCAGG - Intronic
1172477900 20:35252734-35252756 CTGAAGCACCGGAGTGAGGCTGG + Intronic
1172783282 20:37450004-37450026 CTGCAGCACCACACCGAGGAAGG - Intergenic
1174376281 20:50128708-50128730 TTGCAGGAACAGACTGAGACAGG - Intronic
1175742511 20:61429890-61429912 CTGCAGATCCAGCCAGAGGAAGG - Intronic
1176011381 20:62898245-62898267 CTGCAGGACCAAGCTGGGGCAGG - Intronic
1177953271 21:27565851-27565873 CTGGAGAACCAAGCTGAGGCTGG - Intergenic
1178574804 21:33776436-33776458 CTGTAGTACCTGCCTGAGGCAGG + Intronic
1179113990 21:38472988-38473010 CTGCAGACCCGGCATGAGGCAGG + Intronic
1180622796 22:17172811-17172833 CTGGAGAGGCAGGCTGAGGCGGG + Intergenic
1182022437 22:27091968-27091990 CTGCAGAAACAGAAAGAGACAGG + Intergenic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1183035558 22:35138530-35138552 CTACAGAACCAGAGAGATGCTGG + Intergenic
1183046704 22:35226330-35226352 CCACAGAATCAGACTGAAGCTGG + Intergenic
1183293074 22:37014724-37014746 CTGGAAAAGGAGACTGAGGCTGG + Intronic
1183477203 22:38042275-38042297 CTCCACAACCCAACTGAGGCCGG + Intergenic
1184341417 22:43888062-43888084 TTCCAGTACCAGACTGAGGTGGG + Intronic
1185066196 22:48632823-48632845 CTGCAGCCCCAGGCGGAGGCTGG + Intronic
1185078500 22:48696168-48696190 CTGCACACCCACACTGAGGCTGG + Intronic
1185107495 22:48882696-48882718 CTGCAGACCCAGCCTGGGGGAGG + Intergenic
1185272457 22:49935521-49935543 CTGAAGAGCGAGACTGGGGCAGG + Intergenic
950166694 3:10806248-10806270 CTGAATACCCAGACTCAGGCAGG + Intergenic
950675998 3:14554814-14554836 CTGCACAATCAGAATGAGGATGG + Intergenic
951666132 3:25125932-25125954 CAGGAAAACCAGACTGAGGGTGG + Intergenic
954163851 3:48740503-48740525 CTGCAGAACTGCACTGAGCCAGG - Intergenic
954772729 3:52987180-52987202 CTGAAGGACCTGTCTGAGGCTGG + Intronic
954921438 3:54194559-54194581 CAGCAGAGCCAGACTAAGACAGG - Intronic
954982202 3:54756543-54756565 CTGCAGAACTTGGCTGAGTCAGG - Intronic
955266820 3:57452065-57452087 AGGCAGAAAGAGACTGAGGCAGG - Intronic
955324655 3:58000691-58000713 CTTCACAGCCAGACTGGGGCTGG + Intergenic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
959129810 3:102340459-102340481 ATGCTGGCCCAGACTGAGGCTGG + Intronic
959272000 3:104223597-104223619 CTGAAGAACCTGCCTGAAGCTGG - Intergenic
959506778 3:107164857-107164879 GTTCAGAACTAGGCTGAGGCTGG + Intergenic
961596516 3:128022235-128022257 CTGCAGAGCTGGACTGAGGCTGG - Intergenic
961659026 3:128458585-128458607 TTTCAGAGCCAGGCTGAGGCTGG - Intergenic
962009046 3:131376036-131376058 CTGGAGAACAAGGATGAGGCAGG + Intergenic
962257104 3:133879933-133879955 CTGGAGAGCTAGACTGAAGCAGG + Intronic
963301478 3:143601956-143601978 CTGCAGAGCAAGTCTGAGCCAGG - Intronic
965044556 3:163559758-163559780 CTGCGAAACCAGTCTGGGGCTGG - Intergenic
966189847 3:177262251-177262273 CTGTAGTCCCAGGCTGAGGCAGG - Intergenic
967263587 3:187670184-187670206 CTGCAGAAACTGACGGAGTCTGG + Exonic
967823845 3:193862952-193862974 TTGGAGTCCCAGACTGAGGCAGG - Intergenic
968880436 4:3296014-3296036 CTCCAGAAGCTGACTGGGGCGGG - Intronic
969134118 4:5016332-5016354 CAGCAGAAACAGACTAAGACAGG + Intronic
969457340 4:7307530-7307552 CAGCAGAGCCAGGCTGGGGCAGG + Intronic
969614480 4:8244400-8244422 CTGCAGAAACTGCCTCAGGCAGG + Intergenic
972210427 4:36830149-36830171 CAGCAGAACCTGCCTAAGGCTGG - Intergenic
972545901 4:40080457-40080479 CTGTAGTCCCAGACAGAGGCAGG - Intronic
976217834 4:82731461-82731483 CTCCAGGACCAGACTTGGGCTGG + Intronic
978611380 4:110544973-110544995 CTGCAGAACCTCATTGAGCCAGG - Intronic
979292411 4:118992290-118992312 CTGCTGAAACAGTCTGAGGAAGG + Intronic
980131881 4:128824306-128824328 CTGTAGTCCCAGGCTGAGGCAGG + Intronic
981959869 4:150523544-150523566 CAGCACAAACAGACTAAGGCAGG + Intronic
982116856 4:152105204-152105226 CTGCAGAGCCAGGCTGGGGCCGG + Intergenic
982719207 4:158841758-158841780 CTGCAGCTCTAGTCTGAGGCGGG - Intronic
984490912 4:180433354-180433376 CTGTAGTCCCAGGCTGAGGCAGG - Intergenic
985876876 5:2606686-2606708 CTGCAGACCTAGCCTGAAGCAGG + Intergenic
986877757 5:12132086-12132108 CTGCAGTTCTAGACTGAGGCAGG + Intergenic
987386074 5:17330836-17330858 CTGCAGAACCAGACCATGGTGGG + Intergenic
987648006 5:20701020-20701042 CTGGAAAACCAAACTGAAGCAGG + Intergenic
989199460 5:38749275-38749297 GGGCAGAACCAGACTGAGTTTGG + Intergenic
989204386 5:38796980-38797002 CTGCAGAACCAGAAGTAGGGTGG - Intergenic
991374891 5:65956486-65956508 CTGCAGTCCCAGGCTGAGGTGGG - Intronic
992319703 5:75601509-75601531 GTGCACAACCAGATTGAGGGTGG - Intergenic
994086307 5:95762991-95763013 CTACAAAACCAGCCTGAGGAAGG - Intronic
997662288 5:135598855-135598877 CAGCAGAACCAGTCTGTGGTCGG + Intergenic
998101481 5:139438915-139438937 CTGCAGAATCAGCATTAGGCGGG + Intronic
998269910 5:140697233-140697255 CTGCAGACCCCAACTCAGGCTGG + Exonic
1001945143 5:175772423-175772445 CTTCATAACCAGTCTGAAGCAGG + Intergenic
1002940310 6:1709882-1709904 CTGCCTAACTCGACTGAGGCAGG + Intronic
1006507107 6:34496370-34496392 CTGCAGGCCCAGGCTGAGGGGGG + Intronic
1007300076 6:40861327-40861349 CTTCAGAAACAGCCTCAGGCTGG + Intergenic
1011350205 6:86414714-86414736 CTGTAGAAGGAGACTGTGGCAGG + Intergenic
1011563998 6:88655547-88655569 GGACAGAACCAGACTGAGGCAGG + Intronic
1011719717 6:90143099-90143121 CTCCAGACCCTGTCTGAGGCTGG - Intronic
1012409393 6:98938784-98938806 ATTCAAAACCTGACTGAGGCTGG + Intronic
1016247052 6:141995059-141995081 CTGCAGAGCCAGAGTTTGGCTGG - Intergenic
1016435761 6:144035513-144035535 GTGCCCAACCAGACTGAGGGTGG + Intronic
1016582816 6:145648322-145648344 CTGCAGAACTAGACTGACCAAGG - Intronic
1017481804 6:154864876-154864898 CTGCAGAAGAAGAATTAGGCTGG - Intronic
1017491932 6:154952610-154952632 CTGTAGTCCCAGGCTGAGGCAGG - Intronic
1018508868 6:164503598-164503620 CAACAGAACTGGACTGAGGCTGG - Intergenic
1018988890 6:168658531-168658553 CTGTAGCACCAGGCTGAGGAGGG - Intronic
1019048829 6:169167932-169167954 CCTGAGAACCAGCCTGAGGCTGG - Intergenic
1019540219 7:1547965-1547987 CTGCAGACCCCGTCTGGGGCTGG - Intronic
1019637673 7:2084758-2084780 CACCAGAGCCAGACTGGGGCAGG + Intronic
1021696537 7:23281775-23281797 CTGAAGGACCTGCCTGAGGCTGG - Intergenic
1022089501 7:27098240-27098262 CTGCAAACCCAGGCTGAGGAGGG - Intergenic
1022398094 7:30008851-30008873 CTGTAGCCCCAGGCTGAGGCAGG + Intergenic
1022672718 7:32471457-32471479 CTGCAGGACGAGACTGGGCCGGG - Intergenic
1025663950 7:63572463-63572485 CTGCAGCCCAAGACTCAGGCTGG - Intergenic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1026956583 7:74380130-74380152 CTGCAGTGCCAGACTCTGGCTGG + Intronic
1027545801 7:79526006-79526028 CTGAAGAACCAGCCTGTGGCTGG + Intergenic
1029045288 7:97621427-97621449 CTGCAGGACCAGGCTGAGCCTGG - Intergenic
1029272400 7:99385075-99385097 CTGTAGTCCCAGCCTGAGGCAGG - Intronic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1030924686 7:115437550-115437572 CTGTAGTCCCAGCCTGAGGCAGG - Intergenic
1034069901 7:148174424-148174446 CTGAAGCACCAGCCTGAGGTGGG - Intronic
1034261259 7:149757580-149757602 CAGAATAACCAGACTGGGGCGGG + Intergenic
1034330418 7:150277796-150277818 CTGTAGAACCACGCAGAGGCAGG - Intronic
1035066394 7:156108327-156108349 CTGCAAAACCAGATGGATGCTGG - Intergenic
1035077643 7:156191532-156191554 CTGCAAAACCAGACAGAGGCTGG - Intergenic
1035239774 7:157522008-157522030 CTGCAGAACCTTCCTGAGACAGG + Intergenic
1036068373 8:5410644-5410666 GGGCAGAACCATACTGAAGCAGG + Intergenic
1036096895 8:5734165-5734187 CTGCAGAAGCAGGCTTGGGCTGG - Intergenic
1037879620 8:22566346-22566368 CTGGAGCTCCAGGCTGAGGCCGG - Exonic
1039274945 8:35925000-35925022 ATGCACCCCCAGACTGAGGCTGG - Intergenic
1041196116 8:55402889-55402911 CTGCACACCCTGACTTAGGCAGG - Intronic
1045354013 8:101368958-101368980 CTGCAGCCCCAGGCTGAGACAGG + Intergenic
1046779622 8:118201233-118201255 ATGCAGAGCCAGAAGGAGGCTGG - Intronic
1047390799 8:124449414-124449436 CTCCATAATAAGACTGAGGCAGG - Intergenic
1047602868 8:126444335-126444357 CTCCAGAAGGAGGCTGAGGCAGG - Intergenic
1048387929 8:133930609-133930631 CTACAGGATCAGACTGGGGCTGG - Intergenic
1049415809 8:142494575-142494597 CTGCACAACCGGGGTGAGGCAGG - Intronic
1049671981 8:143873949-143873971 ATGCAGGGCCAGGCTGAGGCAGG - Intronic
1051231409 9:14959129-14959151 CTGCAGATCCACACTGATTCTGG - Intergenic
1053287106 9:36856811-36856833 GAGCAGTACCAGACTGAAGCCGG + Intronic
1056871688 9:90287755-90287777 CTTCAGGGCCAGCCTGAGGCAGG + Intergenic
1057667800 9:97059919-97059941 CTGCAGATCCAGAGTGAAGCTGG + Intergenic
1057886626 9:98834576-98834598 CTGAAAAAGCAGCCTGAGGCTGG + Intronic
1058605085 9:106712501-106712523 CTGCTGAACCAGATTCAGGCAGG - Intergenic
1058973347 9:110102887-110102909 CTGCAGAGGCAGAAAGAGGCTGG - Intronic
1059328668 9:113520612-113520634 CTCCAGACCCAGAGGGAGGCTGG - Intronic
1060371594 9:123078608-123078630 GTGCTGAACCAGGCTGAGGTGGG - Intronic
1186639246 X:11437604-11437626 CCTCAGGACCAGACTGAGACTGG - Intronic
1187034285 X:15521642-15521664 CTGCAGAACCAGAAGGTTGCAGG + Intronic
1188342476 X:29021099-29021121 CTGTAGTCCCAGGCTGAGGCAGG + Intronic
1188670628 X:32877850-32877872 CTGCAGAACCAGACTGAGGCTGG + Intronic
1189106299 X:38239179-38239201 TTTCACAACCAGACTGAGACTGG + Intronic
1189357111 X:40318394-40318416 CTGCAAGATCAGGCTGAGGCTGG + Intergenic
1190101288 X:47524468-47524490 CTGCAGTCCCAGACTAAGGAAGG + Intergenic
1194360146 X:92940391-92940413 CTGTGGGATCAGACTGAGGCTGG + Intergenic
1194366418 X:93019299-93019321 CTGCAGACCCAAGCTGAGGGTGG - Intergenic
1194823843 X:98537534-98537556 GTGCAGACCCAGATTGAGGGTGG - Intergenic
1198444589 X:136699747-136699769 CTGGAGAACCATCTTGAGGCGGG + Intronic
1199713318 X:150487744-150487766 CAGGAGAACCTGACTTAGGCTGG - Intronic
1200311092 X:155078114-155078136 CTTCAGCTGCAGACTGAGGCAGG - Intronic
1200668349 Y:6056213-6056235 CTGTGGGATCAGACTGAGGCTGG + Intergenic
1200674645 Y:6135561-6135583 CTGCAGACCCAAGCTGAGGGTGG - Intergenic
1200698227 Y:6380033-6380055 CTGCAGAACCACACAGTGTCAGG - Intergenic
1200700076 Y:6394695-6394717 CTGCAGAACCAAACTGCCTCAGG - Intergenic
1200705354 Y:6438038-6438060 CTGCAGAACCACACAGCGACAGG - Intergenic
1200919172 Y:8597799-8597821 CTGCAGAACCACACTGCCTCAGG + Intergenic
1201028757 Y:9726670-9726692 CTGCAGAACCACACAGCGACAGG + Intergenic
1201034035 Y:9770003-9770025 CTGCAGAACCAAACTGCCTCAGG + Intergenic
1201035886 Y:9784666-9784688 CTGCAGAACCACACAGTGTCAGG + Intergenic