ID: 1188673675

View in Genome Browser
Species Human (GRCh38)
Location X:32912180-32912202
Sequence TGGGCCTATCTGGTTGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 153}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188673675 Original CRISPR TGGGCCTATCTGGTTGGAGG GGG Intronic
900098973 1:952911-952933 AGGGCCTCTCTGGCTGGAGGAGG - Intronic
900160863 1:1222809-1222831 TGGCCCAACCTGGTTGGTGGTGG - Intronic
900766358 1:4508668-4508690 TGGCCCGAGCTGCTTGGAGGTGG - Intergenic
902376206 1:16031103-16031125 TGGTCCTATCTGGTTGAGTGAGG - Intronic
902548959 1:17208120-17208142 TTGGCCTTACTGGTGGGAGGGGG + Intronic
902764953 1:18607911-18607933 TGGGCCTCTCTTCTAGGAGGTGG + Intergenic
904044628 1:27602324-27602346 TGGGCCTTGCTGGCCGGAGGCGG - Intronic
904983071 1:34522987-34523009 TGGGTGTATGTGGTTGGCGGTGG + Intergenic
905170587 1:36107579-36107601 TGCGCCCATCTGGGTGGAGCTGG + Intronic
906772479 1:48497323-48497345 TGTGCCTCTCTGGGTGGAGCAGG + Intergenic
907536123 1:55159581-55159603 GGGGCCTATCTGGCTGGAGAAGG + Intronic
909779879 1:79530777-79530799 ATGGCATATCTTGTTGGAGGGGG + Intergenic
915727975 1:158032291-158032313 TGGGCCTGTCTGGCTGAAGCAGG + Intronic
916198817 1:162250476-162250498 TGGGCCTATCTGGTTCCCTGTGG + Intronic
919924039 1:202183114-202183136 TGGGTCTACCTGGTGGGAGGTGG - Intergenic
920303182 1:205001988-205002010 TAGTTCTCTCTGGTTGGAGGAGG + Intronic
921530556 1:216277430-216277452 TGGGACTACCTGCTTGGAGGTGG - Intronic
1063316681 10:5013488-5013510 AGGGCTCATCTGGTTGTAGGTGG + Intronic
1064139599 10:12779126-12779148 TGGGCCCATCTGGTGGAAAGTGG + Intronic
1067735359 10:48846298-48846320 TGGTCCTCTCTGCTTAGAGGAGG + Intronic
1069824102 10:71244799-71244821 TGCGCCGAACTGGTTGGCGGCGG + Intronic
1071364512 10:84884816-84884838 TGGGCCTATCTGGATTTTGGAGG - Intergenic
1072020264 10:91392283-91392305 AGGGCCTATCTGATTAGATGAGG + Intergenic
1076066543 10:127452895-127452917 AGGGCCTATCTGGCTGGATCTGG + Intergenic
1076096879 10:127739385-127739407 TGGGCCAAGCTGGGTGGAGGTGG - Exonic
1076477250 10:130761413-130761435 TGGCCCTGTCTGGGTGGAGCTGG + Intergenic
1081009142 11:37786075-37786097 GTGGCCTTTCTGGGTGGAGGTGG + Intergenic
1082254458 11:50018136-50018158 TGGGCCATTCTGTTTGGATGTGG + Intergenic
1083272354 11:61578887-61578909 TGGGCCTCTCTGGCTGCAGTTGG - Intronic
1084787873 11:71453789-71453811 TGGGCCTTCCTGGTGGGAGAAGG + Intronic
1086889349 11:92238425-92238447 GGGGGCAATCTGGTTGGAAGAGG + Intergenic
1089276057 11:117336709-117336731 TGGGCCTTTCTGCTTGAAGAGGG + Intronic
1090024258 11:123154199-123154221 TGAGCCTACCTGCATGGAGGAGG - Intronic
1090465478 11:126929587-126929609 GGGGCCTCTCTGGCTTGAGGAGG - Intronic
1096109716 12:49021491-49021513 TGGGCATCTCAGGTTTGAGGGGG - Exonic
1096695587 12:53346112-53346134 TGTGCCTATGTGTTGGGAGGGGG - Intergenic
1101918729 12:108915928-108915950 TGGTCCTATCAGCTTGGAGCTGG - Intronic
1102882552 12:116497086-116497108 TGGGAGCATCTGGTGGGAGGTGG + Intergenic
1103532416 12:121611603-121611625 TGGACCTGTCTGGTGGGAGGTGG - Intergenic
1104888436 12:132125864-132125886 TGGGCCTTGCAGGTGGGAGGTGG - Intronic
1105630013 13:22154260-22154282 TGTGTCTATGAGGTTGGAGGAGG + Intergenic
1108800420 13:54088735-54088757 TGGGCTTTTCTGGTTGGTAGGGG + Intergenic
1110132181 13:72022264-72022286 TGCTCATACCTGGTTGGAGGAGG - Intergenic
1112586232 13:100721330-100721352 CGGGTCTATCTGCTTGAAGGAGG - Intergenic
1113906007 13:113819519-113819541 TGGGACTGACTGGTGGGAGGTGG + Intergenic
1115730947 14:36269175-36269197 TGGGCCTGTCTGGTTCGTGTTGG - Intergenic
1117115954 14:52512433-52512455 TTGTCCTATCTTATTGGAGGGGG - Intronic
1118744421 14:68763366-68763388 TGTGTTTATCTTGTTGGAGGAGG + Intergenic
1118867135 14:69712544-69712566 TGAGCCTGTCTGCTTGGGGGTGG + Exonic
1121262755 14:92578470-92578492 TGGGTCTATCTGGGCAGAGGGGG - Intronic
1121718904 14:96095772-96095794 TGAGCCTTTAGGGTTGGAGGAGG + Intergenic
1121788287 14:96679673-96679695 TGGGAAGATCTGGCTGGAGGAGG + Intergenic
1124782543 15:32649917-32649939 TGGGCTTGTCTGGTTCGAGTTGG + Intronic
1128934623 15:71734729-71734751 TGTGCCTGTGTGGTGGGAGGAGG + Intronic
1132405897 15:101541736-101541758 TGGGTCTATCTGGGTGGCAGAGG + Intergenic
1132547634 16:540544-540566 TCGGCCTGGCTGGTTGGTGGTGG + Intronic
1132804703 16:1770040-1770062 TGTGCTTCTCTGGTTGGGGGTGG - Exonic
1133822884 16:9252566-9252588 TGTGCCTATCTCTTTGTAGGGGG - Intergenic
1135940378 16:26817097-26817119 TGGGCCTTTCAGGTTCAAGGAGG + Intergenic
1137353023 16:47731042-47731064 TGAGGCCAGCTGGTTGGAGGTGG - Intergenic
1137601852 16:49761636-49761658 TGTGCCTATCTGGGTGCAGGAGG - Intronic
1148000332 17:44384044-44384066 TGGGCGTGGCTGGGTGGAGGGGG - Intronic
1148786007 17:50146545-50146567 TGAGCCTCTCTGGTAGGGGGTGG - Intronic
1150228869 17:63539003-63539025 AGGGTCTTTCTGGGTGGAGGTGG + Intronic
1151549277 17:74812651-74812673 GGGGCTCATCTGGGTGGAGGCGG - Intronic
1154224353 18:12488381-12488403 AGGGCCTTTGTGGTTGGAGACGG + Intronic
1154947663 18:21178179-21178201 AGGGCCTTTCTGGCTGGAGCTGG + Intergenic
1158637811 18:59176996-59177018 TGGGCCGATCAGCCTGGAGGTGG + Intergenic
1158679553 18:59554786-59554808 TTGTCCTGTCTGGCTGGAGGAGG - Intronic
1160513400 18:79465415-79465437 TGGGCCAGACTGGGTGGAGGCGG - Intronic
1161035777 19:2083608-2083630 TGGGCCTGGCTGGGTGGATGGGG - Intronic
1161072608 19:2270211-2270233 TGGGGCAATCTGGTTGGGGGCGG + Intronic
1161528469 19:4772181-4772203 TGGGGAGCTCTGGTTGGAGGTGG - Intergenic
1162793301 19:13074013-13074035 TGGGCTTACCTGGTGGAAGGAGG - Exonic
1168539388 19:57197694-57197716 TGGGCCTATTTGGTTTTTGGAGG - Intronic
929670393 2:43872593-43872615 TGGGCCTACCTGGTAGGCTGAGG + Intronic
930536650 2:52652580-52652602 TGGGCCTATCTGGATTTTGGAGG - Intergenic
931005282 2:57843614-57843636 AAGCCCTATCTGGTTGGCGGGGG + Intergenic
932457235 2:71857571-71857593 TGGGCTGGTTTGGTTGGAGGAGG - Intergenic
938076257 2:128340239-128340261 TGGGACTATCTGGTCTGTGGTGG + Intergenic
939445563 2:142305494-142305516 TGAGCCTTTATGGTAGGAGGAGG + Intergenic
939932859 2:148255590-148255612 TCGCCATACCTGGTTGGAGGAGG + Intronic
944986511 2:205183506-205183528 TGGGCCCCTAGGGTTGGAGGTGG + Intronic
945065629 2:205945605-205945627 TGGGCCAAGCTGGTTGGGGGTGG - Intergenic
948715081 2:239856016-239856038 TGGCCCTATCTGCCAGGAGGTGG + Intergenic
1168866583 20:1091788-1091810 TGGGCCAAGGTGGTTGGAGTTGG - Intergenic
1169965275 20:11210668-11210690 TGGGCCTTCTTGGGTGGAGGTGG - Intergenic
1171206328 20:23284014-23284036 TGGGCCTGTCGGGATGGGGGTGG - Intergenic
1172106390 20:32519633-32519655 GGGGCCCATCTGTTTGCAGGTGG - Intronic
1175345278 20:58268593-58268615 TGGCTCTAGCTGGATGGAGGAGG + Intergenic
1175576955 20:60067388-60067410 TGGGCATTTCTGGGAGGAGGGGG + Intronic
1175764319 20:61582229-61582251 TGTGCCTCTGTGATTGGAGGTGG - Intronic
1177184782 21:17781219-17781241 TGTGATTACCTGGTTGGAGGTGG - Intergenic
1179630208 21:42673188-42673210 TGGGTCAAGCTGGTAGGAGGAGG + Intronic
1180975162 22:19844151-19844173 AGGGCCTATCTGGAAGGGGGCGG - Intronic
1182127681 22:27828094-27828116 TGGGCCTGTGAGGTTGGACGTGG + Intergenic
1182130277 22:27845390-27845412 TGAGCCTGTCAGGTTGGAAGAGG + Intergenic
1184816802 22:46878365-46878387 TGGACTTCTCTGGTTGAAGGAGG + Intronic
956752213 3:72352393-72352415 TGGGGCAATCAGGTTGGAAGTGG - Intergenic
957880174 3:86201562-86201584 GGGGCCTGTCTGGTGGGTGGGGG + Intergenic
960960732 3:123068357-123068379 TGGTACTCTCTGGTTGGAAGTGG + Intronic
962405612 3:135097372-135097394 GGGTCCTGTCTGGTTGTAGGAGG - Intronic
966445644 3:179998240-179998262 TGGGCCTATCTGGATTTTGGAGG + Intronic
966819718 3:183915029-183915051 TGGGCCTACCTTGCTGGAGTGGG - Intergenic
968084022 3:195866639-195866661 GGAGCCTCTCTGGTTGAAGGAGG - Intronic
970787249 4:19814142-19814164 TGTGCCTCTCTGGGTGGAGCAGG - Intergenic
974606470 4:64157971-64157993 TGGGACCACCTGGTGGGAGGTGG - Intergenic
975842820 4:78493644-78493666 GGGGCCTGTCTGGGTGGTGGGGG + Intronic
976563620 4:86529413-86529435 GGGGCCTTTCTAGGTGGAGGTGG - Intronic
980385878 4:132087722-132087744 TGGGCCTATTTGGTTTTTGGCGG - Intergenic
984376559 4:178938149-178938171 TGTACCTATCCAGTTGGAGGTGG - Intergenic
986198393 5:5559117-5559139 TGAGCCTGTCTGATTGGAGAGGG - Intergenic
986361942 5:6987284-6987306 TGAGGCTAAATGGTTGGAGGAGG - Intergenic
987518114 5:18941986-18942008 TGGGACTATGTGGTTTGGGGAGG - Intergenic
988463655 5:31466223-31466245 TGGGACTATTTGCTAGGAGGTGG + Exonic
989457687 5:41662086-41662108 TGGGCCTATTTGGGTGGTGGAGG - Intergenic
990539083 5:56754286-56754308 TGAGAGTATCTGGTTAGAGGTGG - Intergenic
992922119 5:81536473-81536495 GGGGCCTATCAGGTGGGTGGAGG - Intronic
993920639 5:93796372-93796394 TTGGCCTATATGGTGGGGGGTGG + Intronic
997721157 5:136079325-136079347 TGGGGCTCTCTGCTTGGGGGCGG + Intergenic
998140599 5:139697529-139697551 TGGGCCTGGCTGGTGGGGGGCGG + Intergenic
999373263 5:151069009-151069031 TGGGCCTTTCTGGTTCCAGCGGG - Intronic
999699083 5:154211629-154211651 TGGGCTTAGCTGGGTGGTGGTGG + Intronic
1001754727 5:174159587-174159609 TGGGGCTTTCTGGTTTGTGGAGG + Intronic
1005140928 6:22630750-22630772 TGGGCCTGACTAGTAGGAGGAGG - Intergenic
1005821355 6:29602307-29602329 TGGACCTATGGGGTGGGAGGTGG - Exonic
1009806450 6:68606634-68606656 TGGGCCTATTTGGTTTTTGGAGG + Intergenic
1010938288 6:81886730-81886752 TGGGCCTATCTGGATTTTGGAGG - Intergenic
1011479038 6:87776082-87776104 TGGGCCATTCTGGGTGGGGGTGG + Intergenic
1012240927 6:96870907-96870929 TGGGGCTACATGGTGGGAGGAGG + Intergenic
1017352429 6:153458482-153458504 TGGGCCTATCTGGAGGGAAGCGG + Intergenic
1017694776 6:157003558-157003580 TGGGCTTATCTGCCTGGAGAAGG + Intronic
1018154785 6:160975510-160975532 TGGGCCTTTCTGGGAGGAGAAGG - Intergenic
1019129442 6:169862911-169862933 TGGGCCTATCTGGAAGCAGCAGG + Intergenic
1019497040 7:1345576-1345598 TGGGCCCCCCTGGGTGGAGGAGG + Intergenic
1023968597 7:44976315-44976337 TGGGCCTACCAGCTGGGAGGAGG - Intronic
1024047751 7:45596592-45596614 TGGGCATCACTGGTAGGAGGCGG + Intronic
1026057239 7:66995382-66995404 TAGGCGGATCTGGTTGGTGGGGG + Exonic
1026720875 7:72829669-72829691 TAGGCGGATCTGGTTGGTGGGGG - Intergenic
1028461958 7:91104209-91104231 TGGGCCCATCAGGTTGGTGGGGG - Intronic
1028675664 7:93457773-93457795 TGGGCATGTCTGGTTATAGGCGG + Intronic
1029614097 7:101645414-101645436 TGGCCCGGTCTGGATGGAGGGGG + Intergenic
1031676516 7:124618031-124618053 TGGGCCTATTTGGATTTAGGAGG + Intergenic
1033895425 7:146063708-146063730 TGGGCTTGTCTGGCTGGAGCTGG - Intergenic
1034811972 7:154140192-154140214 TGGAGCTCTCTGGTTGGAGTAGG - Intronic
1037630518 8:20651556-20651578 TGGGCCTACCTGGAGGGAGATGG - Intergenic
1039470303 8:37809351-37809373 TGGGTCTATCTGGGGAGAGGAGG - Intronic
1044759548 8:95503421-95503443 TGGACCTATAGGGGTGGAGGAGG - Intergenic
1045922463 8:107547374-107547396 GGGGCCTGTCAGGTTGGGGGTGG + Intergenic
1047261038 8:123260191-123260213 AAGAGCTATCTGGTTGGAGGAGG + Intronic
1048329247 8:133461051-133461073 TGGGACCAGCTGGCTGGAGGTGG + Intronic
1049676140 8:143890105-143890127 TGGCGGTATCTGGTTGCAGGAGG - Intergenic
1055294462 9:74820162-74820184 GGGGCCTGTCAGGGTGGAGGGGG - Intronic
1058259299 9:102809984-102810006 TGGGCCTATCTGGATTTTGGAGG - Intergenic
1061485969 9:130920686-130920708 CTGGCCTATCTGGTTTAAGGAGG - Intronic
1061665889 9:132161103-132161125 AGGGCCCATCAGGGTGGAGGCGG + Intergenic
1062388982 9:136326717-136326739 TGGGCCTATGTGGTGTGACGTGG - Intergenic
1186670593 X:11764025-11764047 TGGGCCAACATGTTTGGAGGAGG + Intronic
1188673675 X:32912180-32912202 TGGGCCTATCTGGTTGGAGGGGG + Intronic
1190165000 X:48066191-48066213 TAGGATTATCTGGTTTGAGGAGG - Intronic
1192507685 X:71698939-71698961 TGAGCCTCTCTGCTTGGGGGTGG + Intergenic
1192519011 X:71782613-71782635 TGAGCCTCTCTGCTTGGGGGTGG - Intergenic
1197959511 X:131988921-131988943 TGGTCCCATCTACTTGGAGGTGG - Intergenic
1198953714 X:142103147-142103169 TGTGCGTGTCTGTTTGGAGGAGG + Intergenic
1199061805 X:143364259-143364281 TGGGCCTATATGATTGGACAAGG - Intergenic
1199144486 X:144349285-144349307 TGGGCCTATTTGGATTGTGGAGG - Intergenic