ID: 1188674487

View in Genome Browser
Species Human (GRCh38)
Location X:32922418-32922440
Sequence GACCTACCCCCTAAGCTTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 49}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188674487 Original CRISPR GACCTACCCCCTAAGCTTTA GGG Intronic
911497030 1:98644289-98644311 GCCCTACCCTCTAACCTCTAAGG - Intergenic
1063612712 10:7576550-7576572 GACCGGCCCCCTCAGCTTCATGG + Exonic
1068561155 10:58515377-58515399 CACCTACTACCTAAGCTATATGG + Intronic
1080642422 11:34165572-34165594 GACCAAGCCCCTAAGCTGTGAGG + Intronic
1084121313 11:67070640-67070662 GACCTACACCCTGAGCGTTCTGG - Intronic
1095212743 12:39512072-39512094 TATCTACGCCCTAAGCTTTTAGG + Intergenic
1100607421 12:96163026-96163048 GTCCTACCACCTGAGCTTCAAGG - Intergenic
1107697358 13:43013316-43013338 GCCCCACCCCCTAACCTTCAGGG + Intergenic
1117329515 14:54698516-54698538 GACCTACCTCATAAGCTTCTTGG + Intronic
1130676667 15:85958886-85958908 GACCCACCCCTTCATCTTTATGG + Intergenic
1144335624 17:14266579-14266601 CACCTACACCCTACACTTTAAGG - Intergenic
1145273879 17:21418705-21418727 GGCCTAGCCCCGAAGCCTTAGGG + Exonic
1146195677 17:30810717-30810739 GAAATACTCCCTAAGCTTTTGGG - Intronic
1151835290 17:76578884-76578906 GACCGACCCCCTTAGCTCTAGGG + Intronic
1157598682 18:48879301-48879323 CACCCACCCCCTAACCTTGAGGG + Intergenic
1161770340 19:6227441-6227463 GACCTACGCGCTTAGGTTTAGGG + Intronic
1163168241 19:15512163-15512185 GACCTACCCCCTAAGGTTTTTGG - Intronic
1163186674 19:15643954-15643976 CACCTACCCCCAGGGCTTTAAGG + Intronic
1163218129 19:15895581-15895603 CACCTACCCCCAGGGCTTTAAGG - Exonic
925372993 2:3361313-3361335 GCCCAACCCCCTAAGCTGCAAGG + Intronic
931220507 2:60284572-60284594 GAACTACCCACTTAGCTTTTGGG - Intergenic
932153986 2:69398809-69398831 GACCTATCCCCAAAGTCTTAGGG - Intronic
932376451 2:71240330-71240352 CACATGCCCCCTGAGCTTTAGGG + Intergenic
933318768 2:80746061-80746083 AACCTAAACCCAAAGCTTTAAGG + Intergenic
938983496 2:136549410-136549432 GAGCTACGCCCTATGGTTTAAGG - Intergenic
943702360 2:191000441-191000463 GACCAAACCCCTAAGCTGGAAGG + Intronic
1176699690 21:10029826-10029848 GAGCAACCACCTAAGCTTAAGGG + Intergenic
1177133011 21:17279937-17279959 GACTTAACCCTTGAGCTTTAAGG + Intergenic
1180135893 21:45861451-45861473 GCCCCACCACCCAAGCTTTAGGG + Intronic
1184595390 22:45510800-45510822 GATCTACACCATAATCTTTATGG + Intronic
953584627 3:44188463-44188485 TACCTACCACCTATGCTTTAGGG - Intergenic
964665881 3:159171452-159171474 GCCCTACCCCAGAATCTTTAGGG - Intronic
965931908 3:174054525-174054547 TCCCTCCTCCCTAAGCTTTAGGG + Intronic
969599946 4:8170443-8170465 GACCCACACCCTCAGCTCTAAGG - Intergenic
973572487 4:52254562-52254584 GACATACCCACAAAGATTTATGG + Intergenic
976621085 4:87127897-87127919 CACCTACCCCTTAATCATTAAGG - Intronic
980372099 4:131888451-131888473 GAGCAACCACCTAAGCTTAAGGG + Intergenic
981880055 4:149599496-149599518 GTTCTACCCCTTAAGCTTTGTGG + Intergenic
993692702 5:91022506-91022528 TACCTACTCCCTGTGCTTTAAGG + Intronic
994093095 5:95825802-95825824 GACCTCTCTCCTAAGCTTCAGGG + Intergenic
995709326 5:115018861-115018883 TATCTTCCCCCTAAGCTGTAGGG - Intergenic
998464114 5:142329444-142329466 GCACTACCTCCTAAGCTTTCCGG + Intergenic
1000961533 5:167606599-167606621 GAACTACCCTCTTAGCATTACGG - Intronic
1017289141 6:152714964-152714986 GATCTACTCCCTAAGCTTAATGG - Intronic
1043867783 8:85395260-85395282 GGCCTTCTCCCTAAGCTTTCAGG + Intronic
1044517096 8:93152173-93152195 GACCTCCCCATTCAGCTTTAGGG - Intronic
1048316480 8:133366785-133366807 GGCCTACCCCCTAAACATTCCGG - Intergenic
1052592718 9:30519525-30519547 GACCTACCCCCAAAGGCTGAGGG + Intergenic
1053636803 9:40016008-40016030 GAGCAACCACCTAAGCTTAAGGG + Intergenic
1053769186 9:41448606-41448628 GAGCAACCACCTAAGCTTAAGGG - Intergenic
1054317671 9:63613089-63613111 GAGCAACCACCTAAGCTTAAGGG + Intergenic
1054547857 9:66360107-66360129 GAGCAACCACCTAAGCTTAAGGG - Intergenic
1057228815 9:93306536-93306558 GGCCAAGCCCCTAAGCTTCAGGG - Intronic
1188674487 X:32922418-32922440 GACCTACCCCCTAAGCTTTAGGG + Intronic