ID: 1188679331

View in Genome Browser
Species Human (GRCh38)
Location X:32982539-32982561
Sequence CTGTTTTAGTGGGAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 361}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188679331_1188679337 27 Left 1188679331 X:32982539-32982561 CCTTCCTCTTCCCACTAAAACAG 0: 1
1: 0
2: 2
3: 37
4: 361
Right 1188679337 X:32982589-32982611 TAAACCCAAGATAACTCTGAAGG 0: 1
1: 0
2: 0
3: 10
4: 148
1188679331_1188679335 -10 Left 1188679331 X:32982539-32982561 CCTTCCTCTTCCCACTAAAACAG 0: 1
1: 0
2: 2
3: 37
4: 361
Right 1188679335 X:32982552-32982574 ACTAAAACAGCAACAAATGCTGG 0: 1
1: 0
2: 5
3: 46
4: 612
1188679331_1188679336 2 Left 1188679331 X:32982539-32982561 CCTTCCTCTTCCCACTAAAACAG 0: 1
1: 0
2: 2
3: 37
4: 361
Right 1188679336 X:32982564-32982586 ACAAATGCTGGTAATAATGCAGG 0: 1
1: 0
2: 1
3: 30
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188679331 Original CRISPR CTGTTTTAGTGGGAAGAGGA AGG (reversed) Intronic
900990726 1:6097016-6097038 CCGCTTTCATGGGAAGAGGATGG + Intronic
901311031 1:8269884-8269906 CTGCTTGGGTGGGAAGAGGAGGG - Intergenic
901810055 1:11762345-11762367 CTCTTTTGGTGGCAAGAGGAGGG + Intronic
903337290 1:22633618-22633640 CTGTTGAAGTGGGCAGATGAAGG - Intergenic
903676891 1:25070077-25070099 CTACTCTAGTGGGGAGAGGAGGG - Intergenic
905242869 1:36592451-36592473 CTCTTTTTATGGCAAGAGGAGGG - Intergenic
905600723 1:39248186-39248208 ATGTTTTAGTAGAAAGAAGACGG - Intronic
909341265 1:74533893-74533915 GTGTTTTAGTAGAAAGAGTATGG + Intronic
910082887 1:83362909-83362931 CTGTTGTAGCAGGAAGAGGTGGG - Intergenic
910997496 1:93123485-93123507 CTGATCTGGTGGCAAGAGGAAGG - Intronic
912302415 1:108531815-108531837 CTCTGTGAGTGGGAAGAGCAGGG - Intergenic
912438710 1:109681297-109681319 TGGTATTAGTGGGTAGAGGATGG - Intronic
912441231 1:109699742-109699764 TGGTATTAGTGGGTAGAGGATGG - Intronic
913175822 1:116272317-116272339 ATATTTTAGGGGGAAGAGGTTGG + Intergenic
915738164 1:158097800-158097822 TTGTTTTAGTGGAAAGAGCAAGG + Intronic
918998306 1:191792303-191792325 GAATTTTAGTGGAAAGAGGAGGG - Intergenic
919319205 1:196013520-196013542 CCATCTTAGTGGGAAGAAGAGGG + Intergenic
920231617 1:204474420-204474442 CAGTTTTAGTGGGATGTGGGGGG - Intronic
922797411 1:228347300-228347322 CTGGTTTGGAGGGGAGAGGATGG - Intronic
923538254 1:234869622-234869644 CTGGTTTGGAGGGAGGAGGATGG - Intergenic
923938608 1:238793887-238793909 GTGTATTGGTGGGAAGGGGATGG + Intergenic
924188801 1:241525947-241525969 ATCTTTGAGTTGGAAGAGGAAGG - Intergenic
924566399 1:245202342-245202364 CAGGTTTAGTGGGAAGAGCGTGG + Intronic
1065553083 10:26888579-26888601 CTGTTTAAATGGGTAGAGAAGGG - Intergenic
1066874686 10:40582956-40582978 TTTTTTTGGTGGGAAGAAGAAGG - Intergenic
1068203822 10:53821573-53821595 CTTTTTTAGTGGGAATATGTGGG - Exonic
1070950885 10:80429776-80429798 TTGTCAGAGTGGGAAGAGGATGG - Intronic
1070983073 10:80665834-80665856 CAGGGTTAGTGGGAAGGGGACGG + Intergenic
1071220505 10:83459615-83459637 CATTTTTAGTGGCAAGGGGAAGG - Intergenic
1072027279 10:91473455-91473477 ATATTTTAGAGAGAAGAGGAAGG + Intronic
1072085867 10:92078557-92078579 CAGTTGTAGTGGAAAGAGTAGGG - Intronic
1072263327 10:93702960-93702982 CTGTTTTACTGGGGGAAGGAGGG - Intergenic
1075198344 10:120380184-120380206 CGGTTTGAGGGGCAAGAGGAGGG + Intergenic
1075499753 10:122962206-122962228 TTCTTTGAGTGGGAAGAGGAAGG - Intronic
1075620354 10:123923056-123923078 CTGGTTCAGGGGGAAAAGGAGGG + Intronic
1075652021 10:124133561-124133583 CTGGTGTAGTGGGAAGGGGAGGG + Intergenic
1076751381 10:132545191-132545213 CTGATTTTGGGGGAAGAGGCTGG + Intronic
1078503566 11:11910141-11910163 TTGTTTTAGTGGGAGGAATAGGG - Intronic
1078593199 11:12663732-12663754 CTGATTTAGGAGGAAGAGAAGGG - Intergenic
1079241743 11:18726736-18726758 CTGTTGAAGTGGGAAGAGGAAGG - Intergenic
1079837780 11:25355752-25355774 ATGCATTAGTGGGAAGAGAAAGG + Intergenic
1079840315 11:25389000-25389022 CAGTTATAGTGGGAAAAAGATGG + Intergenic
1080769593 11:35328204-35328226 CTGAGTCAGTGGGAATAGGATGG - Intronic
1081086385 11:38806770-38806792 TTGGTTCAGTGGGAACAGGAAGG - Intergenic
1081452688 11:43187252-43187274 CTCTTTGAGTGGGAAAAGAAAGG + Intergenic
1082721167 11:56678986-56679008 ATGTTTCTGTGGGGAGAGGAGGG - Intergenic
1083588700 11:63879405-63879427 CTTTCTGGGTGGGAAGAGGAGGG - Intronic
1084312558 11:68325389-68325411 TTGTGTTAGTGTGAAGAGGAGGG + Intronic
1084689709 11:70718014-70718036 CTGGTACAGTGGGAAGTGGAAGG - Intronic
1084754212 11:71224536-71224558 GTGTTTGGGTGGGAAGAGGGTGG - Intronic
1084953584 11:72679773-72679795 CTGTCTCAGTTGGAGGAGGAAGG - Intergenic
1087514759 11:99143850-99143872 CTGTTTTAGAGCTAAGAGGAGGG + Intronic
1087978160 11:104576056-104576078 CTTTTTTGGGTGGAAGAGGAGGG - Intergenic
1088363823 11:109018296-109018318 CTGATTTAGGTGGAAGAAGAAGG - Intergenic
1088678799 11:112221893-112221915 CTGTTTTAGTGGAGAGAGGCAGG + Intronic
1088715857 11:112548923-112548945 TTTTTTTAGTGGGTAGGGGAGGG + Intergenic
1088750266 11:112836956-112836978 TTGTTTGTGTGGGAAGAGAATGG + Intergenic
1089268931 11:117287993-117288015 CAGTGTTAGTGGGAAGAGCTGGG - Exonic
1089323489 11:117642020-117642042 CTGTTGGAGTGGGGAGAGGCAGG - Intronic
1089618355 11:119707924-119707946 CAGTGGTAGTGGCAAGAGGAAGG + Intronic
1090611899 11:128478649-128478671 CTGCTTAATTGGGAAGAGAAAGG - Intronic
1091699865 12:2652336-2652358 CTGTTTTAATGGGAAAACAATGG - Intronic
1091821330 12:3477576-3477598 CTTTTTTAGGAGGCAGAGGAGGG - Intronic
1091864059 12:3815048-3815070 CTGTATCTGTGTGAAGAGGAAGG + Intronic
1092039954 12:5375250-5375272 CTGTTTCAGAGGTGAGAGGATGG - Intergenic
1092489477 12:8932381-8932403 CTGATTGAGTGGGAAGAGTATGG + Intronic
1096834253 12:54338860-54338882 CTGTTTGCGGGGGCAGAGGAGGG - Intronic
1097291294 12:57917840-57917862 CTGTTTTCATGGCTAGAGGAGGG + Intergenic
1097415425 12:59310364-59310386 CAGGTTTAATTGGAAGAGGAAGG - Intergenic
1098626262 12:72673681-72673703 ATGTTTCAGATGGAAGAGGAGGG + Intergenic
1098720185 12:73887857-73887879 GTGTGTTGTTGGGAAGAGGAGGG - Intergenic
1098915880 12:76256422-76256444 CTGATATAGTAGGCAGAGGATGG - Intergenic
1099191770 12:79568639-79568661 CTGTTTTGGTGGGTGGAGGGGGG - Intergenic
1099689437 12:85933652-85933674 TTATTTTAGTGGAAAGAGTATGG - Intergenic
1100377143 12:94028064-94028086 CTAATTTAGTGGGAAGAGTATGG - Intergenic
1101027907 12:100631557-100631579 CTGTTTTAGAGAGGAGAGGAGGG + Intergenic
1101083091 12:101208995-101209017 CTGTTTCAGTGGAAAGGGGGTGG + Intronic
1101391887 12:104308706-104308728 CAGTTGTAGTTGGAGGAGGATGG + Intronic
1101470408 12:104991548-104991570 CTGTTTTATTCAGAAGAGGATGG + Intronic
1102214405 12:111150298-111150320 CTTTTTTGGGGGGAGGAGGAAGG - Intronic
1103338991 12:120211183-120211205 CTGTTTCTGTGGGAGGAGAAGGG - Exonic
1104529594 12:129556486-129556508 GTGTTTTAGTGAGAAGCAGAGGG + Intronic
1105698728 13:22916853-22916875 CTGTTTTCGTGGGGAGAAGGGGG + Intergenic
1105850429 13:24329400-24329422 CTGTTTTCGTGGGGAGAAGAGGG + Intergenic
1108701260 13:52946231-52946253 CTGTTTTTGTGGCAAGATGAGGG + Intergenic
1108863993 13:54899555-54899577 CTGTTATAGTGGGACTGGGAAGG - Intergenic
1110297890 13:73890353-73890375 CTGTTTTTATGGGAAGAGTGGGG - Intronic
1111106832 13:83656359-83656381 AAGTTTTAGTGGGAAGAATAGGG + Intergenic
1111256108 13:85670674-85670696 CTGTGTCCCTGGGAAGAGGATGG + Intergenic
1111721934 13:91956525-91956547 CAGTTTTAGTGGGCACAGGCAGG - Intronic
1112348144 13:98609921-98609943 CTGTTTTTGTGGGGAGAAGGGGG - Intergenic
1112434987 13:99385433-99385455 ATGTTCTTGTGGGAAGAGGGAGG + Exonic
1112740023 13:102462467-102462489 CTCTTAGAATGGGAAGAGGATGG - Intergenic
1112760991 13:102692946-102692968 CTGGTTTAGAGGCAGGAGGAAGG + Intronic
1114241273 14:20870696-20870718 GTGTTTATGTGGGAAAAGGAAGG + Intergenic
1115019458 14:28658473-28658495 CTTTTTAAGTGACAAGAGGAAGG - Intergenic
1115096490 14:29642919-29642941 TTTTTTTAATGAGAAGAGGAGGG + Intronic
1115795127 14:36926769-36926791 TTGTTTTGGTGGCAAGAGTAGGG - Intronic
1115992935 14:39168344-39168366 CTGTTCTAGAGGGAAAAGGAAGG + Intronic
1116260828 14:42623566-42623588 CTGTTTGTGTGGGAAGATGGGGG + Intergenic
1117851021 14:59969665-59969687 CTTTTCTAGTTGGAAGAGGAAGG + Intronic
1120861228 14:89256592-89256614 CTTGCTCAGTGGGAAGAGGAAGG - Intronic
1121345903 14:93135756-93135778 AAGGTCTAGTGGGAAGAGGAGGG + Intergenic
1122680148 14:103454036-103454058 CAGGTTTAGTAGAAAGAGGATGG + Intronic
1124363098 15:29053327-29053349 CAGTTTGAGGGGGAAGAGGAGGG + Intronic
1124442439 15:29696927-29696949 CCGTTGTAGTGGGAAGCTGAGGG - Intergenic
1125299937 15:38244678-38244700 ATGTTGCAGTGGGAAGAGGAGGG + Intergenic
1126098123 15:45103591-45103613 CTGTTTCACTGGGTAGAGCACGG + Intronic
1126678917 15:51185537-51185559 CTGTCCTAGGAGGAAGAGGAAGG + Intergenic
1128485722 15:68085550-68085572 ATGGTTTAGTGGAAAGAGCATGG + Intronic
1129209494 15:74059377-74059399 CTGTGGTAATGGGAAGAGAATGG + Intergenic
1130027805 15:80284960-80284982 CTGTTTTATTGGGGGGAGGGGGG + Intergenic
1131749449 15:95490924-95490946 ATGTTATAGTGGGAAGGGCATGG - Intergenic
1132714495 16:1284027-1284049 CAGATTCAGTGGGAAGAGGTGGG - Intergenic
1133427929 16:5709306-5709328 CTGTTATTTTGGGAAGAGTAAGG + Intergenic
1137995653 16:53208360-53208382 CTGAATGAGTGGGAGGAGGAGGG + Intronic
1138560854 16:57800279-57800301 CAGTCTTACTGGGAAGGGGATGG + Intronic
1138717451 16:59040198-59040220 CTGGTATAGTGGAAAGAAGACGG - Intergenic
1141031060 16:80588988-80589010 CTGTGATAGGGGCAAGAGGAAGG + Intergenic
1141234040 16:82198998-82199020 CTGTGTGTGTGGGGAGAGGAGGG - Intergenic
1142746723 17:1963111-1963133 GTGTTTTAATGGTCAGAGGAGGG + Intronic
1142947652 17:3446381-3446403 CTGTTTTATTTGGAAGAAAAAGG + Intronic
1143252285 17:5532682-5532704 CTGTTGTCTTGGCAAGAGGAGGG + Intronic
1143808960 17:9454822-9454844 CTGTTCTAGGGGGCAGAGGATGG + Intronic
1144890195 17:18489999-18490021 CTGCTTGAGTGGCCAGAGGAAGG - Intronic
1145067350 17:19770747-19770769 TTGTTTCAGTGGGAAGTGGGAGG - Intergenic
1145123425 17:20280983-20281005 CTGCGTTAGTGTGAGGAGGAAGG + Intronic
1145142021 17:20454319-20454341 CTGCTTGAGTGGCCAGAGGAAGG + Intronic
1145855848 17:28156558-28156580 CTTTTTTTGTGGGAGGGGGAGGG + Intronic
1145915232 17:28569947-28569969 CAGGTTAAGTGGGAAAAGGAGGG - Intronic
1146481333 17:33207184-33207206 TTCATTTAGTGCGAAGAGGACGG + Intronic
1147038922 17:37702194-37702216 CTGTTTTAGGTGGATGTGGAAGG + Intronic
1147465546 17:40607972-40607994 TTATTTATGTGGGAAGAGGACGG + Intergenic
1147649774 17:42055248-42055270 TTGTTTGTGTGGGGAGAGGAAGG + Intronic
1147977960 17:44258767-44258789 CTTTCTTAGTGGGGAGAGTAGGG - Intronic
1148171619 17:45525837-45525859 CTGTTTGGGTGGGGAGGGGAGGG - Intergenic
1148277751 17:46320572-46320594 CTGTTTGGGTGGGGAGGGGAGGG + Intronic
1148299958 17:46538427-46538449 CTGTTTGGGTGGGGAGGGGAGGG + Intronic
1148364403 17:47042712-47042734 CTGTTTGGGTGGGGAGGGGAGGG + Intronic
1148728910 17:49818525-49818547 CTGTTTTATTAGGAAAAAGAGGG - Intronic
1148909726 17:50934925-50934947 GTGTTTTAGAGGGAAGCTGAAGG + Intergenic
1149154773 17:53614633-53614655 CTGTTTTAGTGGGAGGCAGCAGG - Intergenic
1149461356 17:56832687-56832709 GTGTTTAAGAGGGAGGAGGAGGG - Intronic
1150205131 17:63398515-63398537 CTTTTTTATAGGGAGGAGGAAGG + Intronic
1150281208 17:63930667-63930689 CTGTTGTAATGGGCATAGGAAGG - Intronic
1150402545 17:64870872-64870894 CTGTTTGGGTGGGGAGGGGAGGG - Intronic
1151552030 17:74827839-74827861 CTGTTTTAGGGCCAAGAGGCTGG + Intronic
1151656539 17:75498841-75498863 CTGTTGTACTGGGAAGAGCAGGG + Intronic
1151828134 17:76535031-76535053 CTGTCTGAGTGTGAGGAGGAAGG + Intronic
1152054439 17:78012532-78012554 ATATTTTAGTGGGAAGAGCCAGG + Intronic
1152386220 17:79976409-79976431 GAGTTTTAGAGAGAAGAGGATGG + Intronic
1154323722 18:13374978-13375000 CTGTTTCCATGGGAACAGGAAGG - Intronic
1155786260 18:29904882-29904904 CTGTTTTGGTGGGTCTAGGACGG - Intergenic
1156468318 18:37361976-37361998 CTGCTGGAGTGGGAAGCGGACGG + Intronic
1156512509 18:37652224-37652246 CTGTTGCAGTGGGCAAAGGATGG + Intergenic
1157796998 18:50583793-50583815 CTGATTCAGTGTGAAGAGAAGGG - Intronic
1158604473 18:58883125-58883147 ATGTTATATTGAGAAGAGGATGG - Intronic
1160755472 19:754900-754922 CTGGTTTGGGTGGAAGAGGAGGG + Intronic
1160755479 19:754924-754946 CTGGTTTGGGTGGAAGAGGAGGG + Intronic
1160857453 19:1223934-1223956 CTGTTTCAGCGGGAAGTGGTGGG + Intronic
1162287690 19:9751783-9751805 CTTTTTTTGTGGGCAGGGGATGG - Intergenic
1164557708 19:29266381-29266403 CTGTTTTAGTGTGAAAATGCAGG + Intergenic
1165707253 19:37985561-37985583 GTGTCTTAGAGGGATGAGGAAGG + Intronic
1166267050 19:41690796-41690818 GTGTCTTTGTGAGAAGAGGAAGG + Intronic
1166875694 19:45895923-45895945 CTGTTTTTGAGAGAAGAGCAGGG - Intronic
1168078069 19:53991476-53991498 GTGTTTTAAGGGGACGAGGAAGG - Intergenic
1168627942 19:57933850-57933872 CTGTGTTTGAGGGAGGAGGAAGG - Exonic
925655812 2:6147034-6147056 CTCTTTGAGTGAGTAGAGGAAGG + Intergenic
925858638 2:8153961-8153983 AGATTTTATTGGGAAGAGGATGG - Intergenic
927404835 2:22755061-22755083 CTGTATTTTTGGGAAGAAGAGGG - Intergenic
927878647 2:26675323-26675345 CTGGTTCAGTGGAAACAGGATGG - Intergenic
927908729 2:26881224-26881246 CTGTTTTAGAGGGAAATGAATGG - Intronic
928082187 2:28321328-28321350 CTGATTAAGTGGGAAGAACATGG - Intronic
928285730 2:29988487-29988509 CTGTTTTTCTGTGAAGAGAATGG - Intergenic
929877874 2:45812024-45812046 CTTCTTAAGTGGGAAGAAGAGGG + Intronic
931220521 2:60284696-60284718 CTGTTTTAGTGGGTCCAGGTCGG + Intergenic
933534237 2:83552265-83552287 CTGTGTTAGTTTGAGGAGGATGG + Intergenic
933669230 2:84991045-84991067 CTGCTTTAGTCAGAAGATGAAGG + Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934664706 2:96162154-96162176 TTGTTTCAGTGGGTAGAGCATGG - Intergenic
935705070 2:105849511-105849533 CTGGTTTAATGGGAAGCTGAAGG - Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936375924 2:111941587-111941609 CTGTTTTTCTGGGCAGAGGGAGG + Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
937968613 2:127533510-127533532 CTGTTCTAGGGGGAACAGGCGGG + Intergenic
940519722 2:154728857-154728879 TTTTTTTAGTGGGAAAGGGAAGG + Intronic
940909739 2:159200095-159200117 CTGTTTAAAAGGGAAGGGGAAGG - Intronic
942701470 2:178716025-178716047 CTCTTTTGCTGGGGAGAGGATGG - Intronic
943851566 2:192729766-192729788 CTGTGTTAGTGTGGAGAGGTGGG + Intergenic
944490745 2:200255426-200255448 ATGATTTACAGGGAAGAGGAAGG + Intergenic
945140725 2:206683666-206683688 ATGATTGAGTGGGATGAGGAAGG - Intronic
945155675 2:206834825-206834847 CTGTTTTAGTGGTCAGAAGGTGG + Intergenic
946536648 2:220637001-220637023 ATGTTATAGTTGGAAGAGGTTGG + Intergenic
948937590 2:241177749-241177771 CTGGATTACTGGGAAGAGGGTGG - Intronic
1169158138 20:3351727-3351749 TTATTCTTGTGGGAAGAGGAAGG + Intronic
1171194415 20:23186380-23186402 CTGCTGTGGTGGGAAGAGCACGG - Intergenic
1172939683 20:38645876-38645898 CTGGTTTGGTGGAATGAGGAGGG - Intronic
1173509500 20:43615378-43615400 CTGTCTTAGGGGGCAGATGAAGG - Intronic
1173701819 20:45078626-45078648 ATGTTTGACGGGGAAGAGGAAGG + Exonic
1173853029 20:46230940-46230962 CTGCCTTAGAGGGAGGAGGAGGG + Intronic
1174449119 20:50609051-50609073 CAGTTTCAGTGGGGTGAGGATGG + Intronic
1175532514 20:59683880-59683902 CCGTTATAGTGGGTAGAAGAAGG + Intronic
1176698027 21:10004498-10004520 CTGTGTTAGTTTGATGAGGATGG - Intergenic
1178762996 21:35421958-35421980 CAGTTTGAGTGGGAAAAGTATGG - Intronic
1179078831 21:38150959-38150981 GTGTGATAGTGGGAGGAGGATGG + Intronic
1179236696 21:39553822-39553844 CTGTTTAAGTGGGAGGTGGTTGG + Intergenic
1179433741 21:41345215-41345237 GTGTTTCTGTGGGAAGAGGCGGG + Intronic
1182321704 22:29481934-29481956 CTTTTTGAGTTGAAAGAGGAGGG + Intronic
1182900337 22:33893274-33893296 CTGGGGTGGTGGGAAGAGGAAGG - Intronic
1183148654 22:36019115-36019137 CTGTTTTAGTGGTACATGGAAGG - Intronic
1184846680 22:47092110-47092132 CTGTTCTTGTGGAAAGAGCAGGG - Intronic
950829788 3:15861591-15861613 ATTATTTGGTGGGAAGAGGAGGG - Intergenic
952160346 3:30687296-30687318 CTGTTTTAGTGGGAAGACAGAGG - Intronic
952878098 3:37965026-37965048 GTGTTTTATTGGGAGGGGGAGGG + Intronic
954524680 3:51259563-51259585 ATGTCTTGGTGGGAAGAGGGTGG + Intronic
954594743 3:51814708-51814730 CTGCTTTAGGAGGAGGAGGAGGG - Intergenic
954623518 3:52009559-52009581 ATGTTTTACTGGGGAGAAGAAGG - Intergenic
955029702 3:55204472-55204494 CTGTTTTCCAGGGAAGAGGTGGG + Intergenic
955053974 3:55439917-55439939 CTCCTTTTGTTGGAAGAGGAGGG - Intergenic
955707899 3:61747324-61747346 CTGTTTTGATGGAAAGAGGAAGG + Intronic
957317759 3:78589643-78589665 CTGTTTTAGTTGGAGAATGATGG + Intergenic
957729058 3:84108405-84108427 TAGTTTTAGTGGGGAGAGGGAGG + Intergenic
957772185 3:84708045-84708067 CTGTTTAAGGAGGAAGAGGCGGG - Intergenic
958034224 3:88150536-88150558 AAGTTTGAGTGGGAGGAGGATGG + Intronic
959371858 3:105536919-105536941 CTGATTTAGTGGGTATAGGACGG + Intronic
959802622 3:110512966-110512988 CTGTGAAAGTGGGAAAAGGAGGG - Intergenic
960698803 3:120420868-120420890 GTGGTTTAGTGGAAAGAGGCTGG - Intronic
960879836 3:122333009-122333031 CTATTTTACTGGGAAGAGGGAGG + Intronic
961178921 3:124860728-124860750 GTGTTCCAGAGGGAAGAGGAAGG - Intronic
961935993 3:130584482-130584504 CTGTTTTGTTGGGAACAAGATGG + Intronic
962057239 3:131885471-131885493 CTGTTGCAGTGGGCAAAGGATGG + Intronic
962356854 3:134701914-134701936 TTGTTTTTGTGGGATGGGGAGGG - Intronic
962471957 3:135716950-135716972 CTGGTACAGTGGGAAGGGGAAGG + Intergenic
963299121 3:143579293-143579315 TTGTTTTGGTGGGAAAATGAGGG - Intronic
964708150 3:159642959-159642981 CTGCTTTAGTGGGAGGAGGGAGG + Intronic
966731584 3:183155992-183156014 CTGTTCTAGTTGGAAAAGAACGG - Intronic
968204698 3:196789047-196789069 CTGTTTTAGTTAGGAGAGAATGG + Intronic
968562584 4:1292416-1292438 CTGGTGAAGTGGGAAGAGAATGG + Intronic
976318279 4:83682869-83682891 CTGTTTTAGTGGCAAGAAGAAGG - Intergenic
976782185 4:88773387-88773409 CTCTATTGGTGGGAAGAGGCAGG - Intronic
976913880 4:90345055-90345077 CTCTTTTAATGGAAAGAGCATGG - Intronic
977639935 4:99345966-99345988 CTGTTATGGTGGAAGGAGGAGGG + Intronic
978444929 4:108771524-108771546 CAGTTTTAGTGGGTCCAGGATGG - Intergenic
979664623 4:123297113-123297135 CTTTTTTTGTGGGTAGGGGAGGG - Intronic
980370572 4:131864348-131864370 CTGTGTTAGTTTGATGAGGATGG - Intergenic
980708907 4:136538591-136538613 CTTTTTTAATTGGTAGAGGAAGG + Intergenic
981103890 4:140858833-140858855 CTGGTCTAGTGGAAAGATGATGG + Intergenic
981262629 4:142739958-142739980 CTGATTTAGCCGAAAGAGGATGG + Intronic
981374966 4:144004376-144004398 CTTGCTTAGTGGTAAGAGGAAGG + Intronic
981686338 4:147458874-147458896 CTGCTTAATAGGGAAGAGGATGG + Intergenic
984620329 4:181944870-181944892 CTGTTTCAAGTGGAAGAGGAAGG - Intergenic
984643720 4:182198538-182198560 CTACTTTGGTGAGAAGAGGAAGG + Intronic
985323495 4:188740648-188740670 CTCTTGTTCTGGGAAGAGGACGG + Intergenic
986186802 5:5449872-5449894 CTTGTTTTCTGGGAAGAGGAGGG - Intronic
986485870 5:8236353-8236375 CTGTTTTGGGGGAAGGAGGAGGG - Intergenic
987817403 5:22920484-22920506 CTGTGTTAGTTTGCAGAGGATGG - Intergenic
988097346 5:26633799-26633821 TTGTCTTAGTGTGAAGGGGAGGG - Intergenic
988664964 5:33316362-33316384 GTGATTGAGTGGGAAGAGGATGG + Intergenic
989177362 5:38541413-38541435 CTGTTGTACTGGGAAAAGCAAGG + Intronic
989577402 5:43000970-43000992 CAATTTTATTGAGAAGAGGAAGG - Intergenic
990142766 5:52724675-52724697 CTGTTTTAGAGGGCAGATGAAGG + Intergenic
990803178 5:59628809-59628831 CTTTATTAGTGGGATGAGAACGG - Intronic
990826069 5:59899393-59899415 CTTTTTTAATTAGAAGAGGAGGG - Intronic
992894716 5:81236006-81236028 CTGTGCCAGTGTGAAGAGGAAGG - Intronic
994118768 5:96090670-96090692 CTGTGTTGGTGAGAAGAAGAGGG + Intergenic
994833273 5:104813584-104813606 CTGAGTAAGTTGGAAGAGGAAGG - Intergenic
995017760 5:107330999-107331021 CTATTTTACTAGGGAGAGGAGGG + Intergenic
996209598 5:120790633-120790655 CTATATTGGTTGGAAGAGGAGGG + Intergenic
996577697 5:124994249-124994271 CTTTTTTTGTGGGAGGATGAAGG + Intergenic
996938878 5:128979984-128980006 CCTTTTGGGTGGGAAGAGGAAGG + Intronic
996947102 5:129083593-129083615 CAGTTTTAGTGCACAGAGGAGGG + Intergenic
997312485 5:132899062-132899084 CTGTTTTATTGGTAAGAGTTGGG - Intronic
1000073758 5:157765402-157765424 CTGCTTTAGTGGGAAGAGCTGGG + Intergenic
1000540012 5:162527956-162527978 CTGTTATTGTGGAGAGAGGAAGG + Intergenic
1001206933 5:169772732-169772754 ATTTTTCAATGGGAAGAGGAGGG - Intronic
1001501221 5:172236448-172236470 CTGTATTATTTGGAAGAGGTAGG - Intronic
1001535968 5:172498068-172498090 CTGTGTTACTGTGGAGAGGAAGG + Intergenic
1002932599 6:1644674-1644696 CTGATTTATGGCGAAGAGGAGGG + Intronic
1003623437 6:7722894-7722916 CAGTGATAGTGGGAATAGGACGG - Intergenic
1004325328 6:14669459-14669481 CTTTTTGGGTGGGCAGAGGAAGG - Intergenic
1005030063 6:21500181-21500203 CTCTGTTAGTGGGAAGAACAGGG + Intergenic
1005081572 6:21961613-21961635 CTTTTGTACTGGGAAGATGATGG + Intergenic
1005194215 6:23264142-23264164 CTGCTTTAGTGGAGAGATGAGGG + Intergenic
1005497293 6:26398892-26398914 GAGTTTTAGTGGGAAGGTGAAGG - Intergenic
1006188360 6:32192707-32192729 CTGTTTGGGTGGGAAGAGAATGG - Exonic
1006430584 6:33993324-33993346 CTGAGTGAGTGGGAAGTGGAAGG + Intergenic
1007443463 6:41884783-41884805 ATGTTTTAATTGGAAGTGGAAGG + Intronic
1007694039 6:43720274-43720296 CTGCTTGAGTGGAAAGAGGATGG + Intergenic
1008393895 6:50984700-50984722 CTTTGTTAATGGGAAGAGCATGG + Intergenic
1009555656 6:65162086-65162108 GTGTTTTAATGGAAAGAGCATGG + Intronic
1010986520 6:82431424-82431446 GTGTTTTGGTGGGAAGTGGAAGG + Intergenic
1011183931 6:84653325-84653347 AGGTTTTAATGGGAATAGGAAGG - Intergenic
1011735613 6:90308115-90308137 CTTTTTAAGAGGGAGGAGGAGGG - Intergenic
1011954652 6:93011744-93011766 CTGTTTTGGGGAGAAGAGGAGGG - Intergenic
1012117886 6:95326870-95326892 CTGGTTTAGTGGCAAGATTATGG - Intergenic
1012373432 6:98532615-98532637 CTGATTTAGAGGGTAGAAGATGG - Intergenic
1013000079 6:106013231-106013253 CTGTTTTAGAGGGATTGGGAAGG - Intergenic
1013959424 6:115881091-115881113 CTGGTGTAGTGGGATGAGGGTGG - Intergenic
1014119519 6:117707347-117707369 CTATTTTTGTGGGGAGAAGAGGG + Exonic
1014709081 6:124785547-124785569 CTGTTTTGATGGGAGAAGGAGGG + Intronic
1014976502 6:127891619-127891641 TTGATTTAGTGTGAAGAGAAAGG - Intronic
1015153175 6:130061663-130061685 CCTTTTGAGTTGGAAGAGGAGGG + Intronic
1015294425 6:131574535-131574557 ATGTTTTAATGGGAGGAGGGTGG - Intronic
1015557862 6:134481769-134481791 CTTTTTGAGTGGGGGGAGGAAGG + Intergenic
1017312360 6:152988719-152988741 CTCTTGTTCTGGGAAGAGGACGG - Exonic
1017415828 6:154219573-154219595 CTGTGTAAGTGGGATGTGGAAGG - Intronic
1017540855 6:155401035-155401057 CTGTTTTATTGGGGTGGGGAAGG - Intronic
1019030716 6:169008451-169008473 CTGGCTTAGGGGGAAGATGATGG - Intergenic
1019052620 6:169194788-169194810 CTGTGTTACTGGAAAAAGGATGG - Intergenic
1019832718 7:3349270-3349292 GTGGTTTTGTGGGAAGAGCAGGG + Intronic
1020830704 7:13091263-13091285 CTGTTGGAATGGGAAGTGGAAGG + Intergenic
1022186262 7:27972413-27972435 CTCTTTTAGGGGAAGGAGGATGG + Intronic
1022540910 7:31134782-31134804 ATGTTTAAATGGGATGAGGAAGG - Intergenic
1023179474 7:37467665-37467687 CAGATTTAGTGGGAGGTGGATGG + Intergenic
1023341710 7:39228314-39228336 CTGTTTTTGTAGGCAGAGGATGG + Intronic
1023395800 7:39750868-39750890 CTGTTTAAGTAGGAAGATCAGGG - Intergenic
1023584619 7:41716248-41716270 AGATTTTAGTGGGAAGAGAAGGG + Intergenic
1023640157 7:42249480-42249502 CTGTCTTAGTGGGAAGAAAAGGG + Intergenic
1023998527 7:45176677-45176699 ATGTTTTGGTGGGCAGAGGTTGG + Intronic
1024444344 7:49459198-49459220 CCATTTTAGTGGGAAAAGAATGG - Intergenic
1025875710 7:65478326-65478348 CTGTTTTAATGTGAAAAAGAAGG + Intergenic
1027219118 7:76202599-76202621 CTCTTGCACTGGGAAGAGGATGG + Intronic
1027299723 7:76819111-76819133 CTGTTGTAGCAGGAAGAGGTGGG - Intergenic
1028111524 7:86948115-86948137 CTGTTTTGGCTGGAAGAGGGTGG - Intronic
1028955553 7:96685207-96685229 AACTTTTAGTGGGAATAGGATGG + Intronic
1029947819 7:104551929-104551951 AAGTTTTAGAGAGAAGAGGATGG - Intronic
1031120209 7:117713580-117713602 CTGTGTTTGTGTGAATAGGAAGG + Intronic
1031963195 7:128008174-128008196 TTATTTTAGTGAGAAAAGGATGG + Intronic
1032926465 7:136611441-136611463 CTGTTTTGGTAGCAAGATGATGG + Intergenic
1034211627 7:149368683-149368705 CTGTTGTAGGGGGAGGGGGAGGG - Intergenic
1035906757 8:3519845-3519867 CTATTTTAGTGGGAGGTTGATGG - Intronic
1036784734 8:11678535-11678557 GGGTTTTAGTGGGAAAAGCAGGG + Intronic
1039341569 8:36656198-36656220 CTGTTTTAGTTGGAAGACTTGGG - Intergenic
1039619871 8:38986774-38986796 GTGATTTAGTGGCAAGAAGATGG + Intronic
1040552338 8:48447445-48447467 CTTTTTTGGGGGGAAGGGGAGGG - Intergenic
1040948903 8:52916015-52916037 CTGGTTTAGTGGGAAGTTAAAGG + Intergenic
1041695186 8:60728400-60728422 ATGTTTTTGTGGCAGGAGGAAGG + Intronic
1041810363 8:61902158-61902180 CTGTTTTTGTGAGCATAGGAAGG - Intergenic
1043975311 8:86578782-86578804 TTCTTTCGGTGGGAAGAGGAGGG + Exonic
1045536996 8:103039718-103039740 CTGTGTGTGTGGGAAGGGGAAGG + Intronic
1046665221 8:116994858-116994880 ATGTTTTAGCTGGTAGAGGAAGG + Intronic
1047200557 8:122761647-122761669 CCACTTTAGGGGGAAGAGGAGGG - Intergenic
1047414795 8:124655434-124655456 CTGTTCTGCTGGGATGAGGAAGG - Intronic
1047471621 8:125179178-125179200 CTTTATTATTGGGAAAAGGATGG + Intronic
1048321789 8:133405783-133405805 CTGTTCCAGTGGGTATAGGAAGG - Intergenic
1048643800 8:136394913-136394935 CTGTTTCAGTGGGATGTGGGTGG + Intergenic
1048917524 8:139199130-139199152 CTTTCTTGATGGGAAGAGGAGGG + Intergenic
1049731447 8:144180590-144180612 CTGTTTTAGGGGGGACAGGTGGG + Intronic
1050600041 9:7241479-7241501 CTGTTTGAAAGGGAAGAGCAAGG - Intergenic
1050662736 9:7900865-7900887 CTCTTTAAGTGGGAAGAACATGG + Intergenic
1050733926 9:8741509-8741531 CTGTTTGAGTGGAAAGTGGCTGG - Intronic
1050880517 9:10694146-10694168 CTCTTTTAGTTGAAAGAGCATGG + Intergenic
1053362206 9:37496441-37496463 CTGTTTTAATGGGAAAGGGGAGG - Intronic
1053635159 9:39990844-39990866 CTGTGTTAGTTTGATGAGGATGG - Intergenic
1053770772 9:41473467-41473489 CTGTGTTAGTTTGATGAGGATGG + Intergenic
1054208728 9:62259854-62259876 CTGTGTTAGTTTGATGAGGATGG + Intergenic
1054316077 9:63588286-63588308 CTGTGTTAGTTTGATGAGGATGG - Intergenic
1054549504 9:66385291-66385313 CTGTGTTAGTTTGATGAGGATGG + Intergenic
1055230586 9:74059503-74059525 TTGTTTTAATGGGAAGATGGTGG + Intergenic
1056816785 9:89807632-89807654 CTGCTTTTGTGGGCAGAGGAGGG + Intergenic
1057069047 9:92080179-92080201 CTGTTAGAGTTGGAGGAGGAAGG - Intronic
1057070630 9:92096290-92096312 GTGTTTTAGAGGGGTGAGGATGG - Intronic
1057628784 9:96702037-96702059 CCCTTTCAGTGGGAAGAGGGTGG - Intergenic
1057631864 9:96725789-96725811 CTGATTTAGCTGGAATAGGATGG - Intergenic
1058951852 9:109911178-109911200 CATTTTTAGGGGGAAAAGGAGGG + Intronic
1059246578 9:112854698-112854720 CTGCGTTGGTGGGCAGAGGAGGG + Intronic
1059587714 9:115623911-115623933 CTGCTTTAGTGGGGTGGGGATGG - Intergenic
1060934215 9:127506327-127506349 CTGTTCTGGAGGGAAGGGGAAGG - Exonic
1062098903 9:134717840-134717862 CTGTTTCGGTTGGACGAGGAGGG + Intronic
1185719667 X:2371693-2371715 CTGTGATAATGGGAGGAGGAGGG - Intronic
1185719674 X:2371717-2371739 CTGTGATAATGGGAGGAGGAGGG - Intronic
1186234075 X:7488253-7488275 CTCTTTTGGGGAGAAGAGGAGGG + Intergenic
1186234250 X:7490152-7490174 TTTTCTTAGTGGGAAGAGGATGG + Intergenic
1186524401 X:10235223-10235245 CTTTCTAAGTGGGAAGAGGAAGG + Exonic
1188424271 X:30028701-30028723 CTATTTTAGTGGGATGAGATTGG - Intergenic
1188679331 X:32982539-32982561 CTGTTTTAGTGGGAAGAGGAAGG - Intronic
1189830358 X:44966687-44966709 GTGTAATAGGGGGAAGAGGAAGG + Intronic
1189848341 X:45156551-45156573 AGGTTTTAGTGGGAAGAGTGTGG + Intronic
1190099591 X:47512248-47512270 CTATTTTTGTGGGGAGAAGAGGG - Intergenic
1193212356 X:78822122-78822144 CTGTTTATTTGGGAAAAGGAGGG + Intergenic
1194110948 X:89834257-89834279 ATTTTTTAGTGTGAAGAGGGTGG + Intergenic
1194688520 X:96954568-96954590 CTTTTATATTGGGATGAGGATGG + Intronic
1195850196 X:109274531-109274553 CTTCTATAGTAGGAAGAGGAAGG - Intergenic
1196172459 X:112604782-112604804 TGGTTATAGTGGAAAGAGGAAGG + Intergenic
1197287952 X:124618126-124618148 CTGATTAAGTGGGAAAATGAAGG - Intronic
1197401184 X:125992792-125992814 GTGTGTGAGTGGGAAGAGGCAGG - Intergenic
1197729211 X:129795637-129795659 CTGCTTTAGTGGGTACAGGGTGG - Intergenic
1198328760 X:135601734-135601756 GTATTTTAGTGGGAATAGCATGG + Intergenic
1198621355 X:138514228-138514250 TTGTGTTTCTGGGAAGAGGAAGG + Intergenic
1199153294 X:144516037-144516059 TTGTTTTTGTGGAAAGATGAAGG - Intergenic
1199700931 X:150375043-150375065 CTGCTTAGGAGGGAAGAGGATGG + Intronic
1199853563 X:151741839-151741861 CAGTCTCAGTGGGAAGGGGAGGG + Intronic
1199934085 X:152554043-152554065 TTGTTGTGGTGGGAACAGGATGG - Intergenic
1200007708 X:153098777-153098799 AGGTTTTAGTGGGATGATGAGGG + Intergenic
1200463607 Y:3489003-3489025 ATTTTTTAGTGTGAAGAGGGTGG + Intergenic
1201283259 Y:12358971-12358993 CTCTCTCAGTGGGAGGAGGAGGG + Intergenic