ID: 1188684000

View in Genome Browser
Species Human (GRCh38)
Location X:33046569-33046591
Sequence ATGTTATCCTGGGCAATCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 117}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188684000_1188684004 -7 Left 1188684000 X:33046569-33046591 CCATTGATTGCCCAGGATAACAT 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1188684004 X:33046585-33046607 ATAACATCAAGTGACTGACTGGG 0: 1
1: 0
2: 0
3: 13
4: 150
1188684000_1188684006 -5 Left 1188684000 X:33046569-33046591 CCATTGATTGCCCAGGATAACAT 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1188684006 X:33046587-33046609 AACATCAAGTGACTGACTGGGGG 0: 1
1: 0
2: 0
3: 6
4: 144
1188684000_1188684003 -8 Left 1188684000 X:33046569-33046591 CCATTGATTGCCCAGGATAACAT 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1188684003 X:33046584-33046606 GATAACATCAAGTGACTGACTGG 0: 1
1: 0
2: 0
3: 12
4: 122
1188684000_1188684005 -6 Left 1188684000 X:33046569-33046591 CCATTGATTGCCCAGGATAACAT 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1188684005 X:33046586-33046608 TAACATCAAGTGACTGACTGGGG 0: 1
1: 0
2: 1
3: 13
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188684000 Original CRISPR ATGTTATCCTGGGCAATCAA TGG (reversed) Intronic
901141695 1:7038238-7038260 ATGTGATCATGAGCATTCAAAGG + Intronic
903380240 1:22891650-22891672 ATGTTACCCAGGGCGATCCAAGG - Intronic
904760367 1:32799314-32799336 GTGTTATCTTGGCCAATGAAAGG + Intronic
904872218 1:33625834-33625856 ATGTTCTCCTGGGCAAGCAGAGG + Intronic
907559645 1:55376792-55376814 AAGTCATCCCTGGCAATCAATGG + Intergenic
909793642 1:79705156-79705178 ATGTGGTCCTGAACAATCAATGG - Intergenic
911774735 1:101794146-101794168 ATGTTCTCCTAGGTCATCAATGG + Intergenic
912785749 1:112602172-112602194 ATATTATCCTTGGTCATCAAAGG + Intronic
914076667 1:144358718-144358740 ATGTTTTCCTTGGCAATCTCTGG - Intergenic
914102511 1:144607779-144607801 ATGTTTTCCTTGGCAATCTCTGG + Intergenic
914171116 1:145224299-145224321 ATGTTTTCCTTGGCAATCTCTGG - Intergenic
914296388 1:146329415-146329437 ATGTTTTCCTTGGCAATCTCTGG - Intergenic
914640174 1:149598854-149598876 ATGTTTTCCTTGGCAATCTCTGG + Intergenic
917636082 1:176938050-176938072 ATTTTATCTTAGGCAATCAAAGG + Intronic
918977018 1:191502699-191502721 ATGTTAACCTGGGCAACATAGGG - Intergenic
921349543 1:214221642-214221664 ATCTTTTCCTGGCCCATCAAAGG + Intergenic
921780429 1:219156563-219156585 ATTTTATGCTTTGCAATCAAAGG + Intergenic
922546442 1:226460918-226460940 ATGGGAGCCTGGGAAATCAATGG + Intergenic
922628249 1:227075780-227075802 CTGTTAGCCTGGGCACTTAAAGG - Intronic
923500827 1:234562215-234562237 ATCTTATCCTGGACATACAATGG - Intergenic
1064789458 10:18939542-18939564 ATGTTCTCCTTGGCAAACTACGG + Intergenic
1066136750 10:32454870-32454892 ATGTTTCCCTGTGAAATCAAAGG - Intronic
1068292961 10:55029641-55029663 ATGTGGTCTTGGTCAATCAATGG + Intronic
1068354169 10:55889691-55889713 CTGTTAACCTGGAAAATCAAAGG + Intergenic
1073761611 10:106635106-106635128 ATATTAACCTGAGCAATGAAAGG + Intronic
1075084630 10:119406418-119406440 ATGATCTCCAGGGCAACCAAGGG + Intronic
1076000639 10:126910263-126910285 CTGGTATCCTAGGCAAACAATGG - Intronic
1076980754 11:203515-203537 ATGTTTTCCTGGGCCATGGAGGG - Exonic
1078435177 11:11318803-11318825 ATATTATCCTGGGACATTAACGG + Intronic
1080322202 11:31023404-31023426 ATTCCATCCTGGGCAATCAAAGG + Intronic
1082852694 11:57779521-57779543 CTGTCCTCCTGGACAATCAAAGG - Intronic
1084969635 11:72764091-72764113 ATGTTATCCTGGACCATGAGTGG + Intronic
1086071564 11:82805507-82805529 ATCGTCTCCTGGGCTATCAAAGG - Intergenic
1089262816 11:117233759-117233781 ATGCAATACTGGGCAATCCAGGG - Intronic
1090048534 11:123357781-123357803 GTGTGATCCTGGGCAGCCAATGG + Intergenic
1092553769 12:9532531-9532553 ATGTTAGCCTGCACAATCACAGG - Intergenic
1093956156 12:25221353-25221375 CTGTTATCCTGGCTACTCAAGGG - Intronic
1095135173 12:38592288-38592310 AGGTTATCCTGGGCTATCCAGGG - Intergenic
1097635911 12:62121864-62121886 ATGTTCACCTGGGAATTCAATGG - Intronic
1106293418 13:28387738-28387760 ATGTTACCCTGGGGTATGAAGGG - Intronic
1107311715 13:39085530-39085552 AAGTTATCTTGGGACATCAAGGG + Intergenic
1107427745 13:40311094-40311116 ATGTTAACAAGGGCAATCATAGG + Intergenic
1108781869 13:53846434-53846456 ATGTTATCATGGACAGTTAATGG - Intergenic
1111689350 13:91542714-91542736 GTGTTAGCCTGGGCAATAAGAGG - Intronic
1113118451 13:106900061-106900083 ATTTTCTCCTGGCAAATCAATGG + Intergenic
1115185250 14:30680669-30680691 CTGTAATCCTGGCCACTCAAAGG + Intronic
1117827478 14:59718626-59718648 ATATTTTCCTGGCCAAGCAACGG - Intronic
1123816216 15:23981853-23981875 AGGTTATACTGGGTCATCAAGGG + Intergenic
1124137869 15:27050562-27050584 TTGTTCTCCTGGGCAAATAAGGG - Intronic
1127635361 15:60864345-60864367 AGTTTATCTTGGGCAATAAATGG - Intronic
1130662382 15:85840785-85840807 GTGTTATCCTGGGCACCCACCGG + Intergenic
1131849048 15:96518112-96518134 CTTTTATGCTTGGCAATCAATGG + Intergenic
1133645779 16:7763275-7763297 ATGAAATCATGGGGAATCAAGGG + Intergenic
1133831807 16:9330242-9330264 ATTTCCTCATGGGCAATCAAGGG + Intergenic
1135503473 16:23016731-23016753 TTGTTATTCTGGCCAAACAATGG - Intergenic
1140553339 16:75892125-75892147 AAATTATTCTGGGAAATCAATGG + Intergenic
1144970682 17:19107439-19107461 GTGTTATCTTGGGCAAATAATGG + Intergenic
1144990985 17:19233601-19233623 GTGTTATCTTGGGCAAATAATGG + Intronic
1146614818 17:34347745-34347767 ATGTTTTCATGGGCAATGCATGG + Intergenic
1147532143 17:41289374-41289396 ATGTTATACTGGGGACTCATGGG + Intergenic
1165945978 19:39442602-39442624 AGATTAGCCTGGGCAATAAAGGG - Intronic
927601725 2:24448559-24448581 AGCATATCCTGGGAAATCAAAGG - Intergenic
928506737 2:31961470-31961492 ATGTTATCTTGGGCCAGCCATGG + Intronic
931821615 2:65957593-65957615 ATGATATGCTGGGCAGGCAAAGG - Intergenic
939811176 2:146834186-146834208 ATGTTACACTGGGGACTCAAGGG + Intergenic
944161504 2:196665394-196665416 AGGTAATCCTAGGCAATCTAGGG + Intronic
946690784 2:222306858-222306880 AGGTTACCCTGGGCTTTCAAGGG + Intergenic
946730330 2:222703497-222703519 ATGTTGTCCTGGGTACTGAAAGG - Intronic
1169051402 20:2581581-2581603 ATGTTTTCCTCGGTAGTCAATGG + Intronic
1173722780 20:45273942-45273964 ATTTTATTCTGGGAAATCATTGG - Intergenic
1174222315 20:48966390-48966412 ATGTTAACAAGGGCAATCTATGG - Intronic
1175274549 20:57759234-57759256 ATGGTCTCTTGGCCAATCAATGG + Intergenic
1175805581 20:61826736-61826758 ATGCTATCCTAGGCCATCAACGG - Intronic
1180622778 22:17172730-17172752 ATACTATCCTGGGCAACAAAAGG + Intergenic
1183920080 22:41159083-41159105 ATTTTCTCCTGCCCAATCAATGG + Intronic
949344491 3:3064244-3064266 ATTCTATCCTGGGGGATCAATGG - Intergenic
949936253 3:9118600-9118622 ATGTTTTTCTGGGGAATAAATGG - Intronic
955633711 3:61002702-61002724 TTCTTACCCTGAGCAATCAACGG - Intronic
956638092 3:71386376-71386398 ATCTTACCCTGGGCACGCAATGG - Intronic
956790322 3:72675195-72675217 ATGTTATCCTGAGCATCCAAAGG + Intergenic
957138942 3:76328427-76328449 ATGTTATACTAGGAAATTAATGG - Intronic
960271418 3:115678733-115678755 ACTTTATCATGGGCATTCAAAGG + Intronic
965138004 3:164799227-164799249 ATCTTACCCTGGTCAATAAAAGG + Intergenic
966092416 3:176156149-176156171 ATGTTATTCTGGAAAATCTATGG + Intergenic
970676800 4:18459776-18459798 CTGTTATCCTGGGGAATTATGGG + Intergenic
972152515 4:36111717-36111739 ATTTTATCTTGAGCAATCAAGGG - Intronic
973891047 4:55367687-55367709 ATGTTATTCTCGGCAATCTCAGG + Exonic
975227015 4:71884799-71884821 GTGTTATGCTGGGTAATCACAGG - Intergenic
979040356 4:115783685-115783707 ATGTTATCATGGGAAGTCAGAGG + Intergenic
995684003 5:114751041-114751063 ATGTCATCCTGGGGAAGCAGGGG + Intergenic
996955138 5:129174462-129174484 ATGTGAGCCTGGGGAATTAAAGG + Intergenic
998876982 5:146609927-146609949 AAGCAAGCCTGGGCAATCAATGG - Intronic
1000164884 5:158638897-158638919 ATGTTATCCTAGGGCAGCAAGGG + Intergenic
1003395841 6:5751324-5751346 CTGTTATCCTGGGCACTTGATGG + Intronic
1004338700 6:14787976-14787998 GTGTTATCCTGGGCTGTAAATGG - Intergenic
1004726665 6:18317458-18317480 ATGGTATCCTAGACACTCAAGGG - Intergenic
1006283835 6:33078160-33078182 ATGTGATGCTGGGCAGTGAAAGG + Intronic
1009306249 6:62092987-62093009 ATTTAATACTGGGAAATCAATGG + Intronic
1012909761 6:105105386-105105408 ATGTTATACTTGGCCCTCAATGG - Intronic
1014280405 6:119436983-119437005 ATGAGATCCTGGGAAAACAAAGG - Intergenic
1015505837 6:133986761-133986783 ATTTTGTTCTGGGCAATTAAAGG - Intronic
1017222572 6:151983635-151983657 ATGTTGTCTTGGCCAATCATAGG - Intronic
1020499958 7:8905289-8905311 AAGTTATCCTGGGTCATCTATGG - Intergenic
1024460731 7:49656960-49656982 TTGTTAGCATGGGCAATCAATGG - Intergenic
1025635488 7:63316654-63316676 TTGTTACCCTGGGCCACCAAGGG - Intergenic
1025647207 7:63431516-63431538 TTGTTACCCTGGGCCACCAAGGG + Intergenic
1027632647 7:80626005-80626027 CTGTTCTCCTGGGTAATCAGGGG + Intronic
1028401619 7:90431204-90431226 AACTTATCCTGGGCAATGTAGGG + Intronic
1028563135 7:92197320-92197342 ATTTGATCCTGAGAAATCAATGG - Intergenic
1031073969 7:117194661-117194683 ATGTAATGCTGGACAAACAAAGG + Intronic
1033723510 7:144086725-144086747 GTGTTTTCCTGTGCATTCAAGGG + Intergenic
1033802787 7:144920520-144920542 TTGTTATCCTTGGCAATCACTGG + Intergenic
1041264251 8:56048185-56048207 ATGGAATCCTGGGTAATCACTGG + Intergenic
1043743039 8:83838081-83838103 ATGTGATCCAGTGCAATGAAAGG + Intergenic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1050165770 9:2763325-2763347 ATGTTATCTAGGGGAATCATTGG + Intronic
1056893875 9:90522773-90522795 ATGTTATCCTTGTAAATCAATGG - Intergenic
1060381567 9:123179484-123179506 ATGTTATCCTGGCCAGGCACGGG + Intronic
1060711872 9:125874500-125874522 ATGTAATCTTGGGCTATCATTGG + Intronic
1185872726 X:3677589-3677611 ACGTTACCATGTGCAATCAATGG - Intronic
1186145396 X:6619444-6619466 ATGTGTTACTGAGCAATCAATGG - Intergenic
1188684000 X:33046569-33046591 ATGTTATCCTGGGCAATCAATGG - Intronic
1188693502 X:33158905-33158927 ATGTTATCATGATCACTCAAAGG - Intronic
1195251108 X:103048466-103048488 ATGTGCTCCTGAACAATCAATGG - Intergenic
1195655790 X:107330261-107330283 AGGTTATCCTAGGCATTCGAAGG - Intergenic
1197156205 X:123272877-123272899 ATCTTATCCTGGGCACACAGAGG + Intronic
1199666470 X:150100187-150100209 ATGTGCTCCTGGGCACACAATGG - Intergenic
1200791212 Y:7301093-7301115 ATGTTACAATGTGCAATCAATGG + Intergenic