ID: 1188686147

View in Genome Browser
Species Human (GRCh38)
Location X:33072972-33072994
Sequence CTAAATTTTCTGGCCAAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 197}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188686147 Original CRISPR CTAAATTTTCTGGCCAAATA GGG (reversed) Intronic
900668414 1:3832609-3832631 CTAAATTTTCAGAGTAAATAAGG - Intronic
903387942 1:22941766-22941788 CTGAAACCTCTGGCCAAATATGG - Intergenic
905184832 1:36188721-36188743 CTCAATGTTCTGGCCACATTGGG - Intergenic
905786060 1:40758538-40758560 CTAAAATTTCTGAGCTAATAGGG - Intronic
907699540 1:56770974-56770996 CTCCATATTCTTGCCAAATAAGG - Intronic
908936002 1:69376268-69376290 ATAAATTTTGTGGCAAATTAAGG + Intergenic
910629574 1:89341375-89341397 CTAAATTTTCTGGCTAATCGAGG + Intergenic
911516421 1:98873526-98873548 CTAGATTTTCAGGCTAAATTTGG - Intergenic
911880205 1:103227935-103227957 CTAAATCTTGAGGACAAATAAGG + Intergenic
913219583 1:116648745-116648767 CTCAATTATCTGGCTAAACATGG - Intronic
913649770 1:120901503-120901525 CTAAATTTCCTCTTCAAATAAGG - Intergenic
914076914 1:144362025-144362047 CTAAATTTCCTCTTCAAATAAGG + Intergenic
914102264 1:144604480-144604502 CTAAATTTCCTCTTCAAATAAGG - Intergenic
914171363 1:145227594-145227616 CTAAATTTCCTCTTCAAATAAGG + Intergenic
914296634 1:146332716-146332738 CTAAATTTCCTCTTCAAATAAGG + Intergenic
914526472 1:148471560-148471582 CTAAATTTCCTCTTCAAATAAGG + Intergenic
914639932 1:149595562-149595584 CTAAATTTCCTCTTCAAATAAGG - Intergenic
915810110 1:158900076-158900098 TTAAATTTTAGGGCCTAATAGGG + Intergenic
916154575 1:161832188-161832210 CAAAATGTTCTGGCCAATTCTGG - Intronic
916384191 1:164249357-164249379 CTAAATTTTCTGGGCAATCATGG + Intergenic
917245304 1:172994782-172994804 CTAAAGTTTTTGGCCAAATAAGG - Intergenic
917465612 1:175273307-175273329 CTAAATTTTCTGGACACTAATGG + Intergenic
922625938 1:227043121-227043143 TTAAATTTTCTGGCCAGGCACGG + Intronic
1063173212 10:3528524-3528546 CTAAATGTTCTGCCTAAATCTGG - Intergenic
1063507626 10:6615379-6615401 CTCAATTTTCTGTGCAAATTGGG + Intergenic
1064579174 10:16776505-16776527 CTAAGTTTTATGGCAAAATGTGG - Intronic
1064952423 10:20868658-20868680 CTAAACTTTCTAGTCAAGTAAGG - Exonic
1065165272 10:22970224-22970246 ATAAATTGTCTGGTCAAAGAAGG + Intronic
1066494240 10:35926636-35926658 CTCAATTTTCTGGCCCTACAAGG - Intergenic
1068299838 10:55124557-55124579 TTAAAATTTCAGGCAAAATAGGG - Intronic
1069314857 10:67085041-67085063 TCAAATTTGCTGTCCAAATATGG + Intronic
1071200776 10:83219290-83219312 CTTAATTTTCTGGCTAACAAAGG - Intergenic
1072927254 10:99626953-99626975 ATTAATTTTATGGCCAGATATGG + Intergenic
1077932797 11:6751705-6751727 CTTAATTTTCTGGAAAAGTAAGG - Intergenic
1078153043 11:8775350-8775372 GAAAATTTACTGTCCAAATAAGG + Intronic
1082749111 11:56998888-56998910 CTTAATTTTCTGGCTAACTGAGG - Intergenic
1082900092 11:58239076-58239098 CTAAATAATCTGACCAAATTCGG - Intergenic
1085835691 11:79954270-79954292 ATAAAATTGCTGGGCAAATAGGG - Intergenic
1086560621 11:88164305-88164327 TTAAATTTTCAAGGCAAATACGG + Intronic
1087558791 11:99757396-99757418 CTATATTTTCTGTCCTTATAAGG + Intronic
1088130106 11:106477913-106477935 CAAATTTTTCTGGACAAAGAAGG - Intergenic
1090794462 11:130122920-130122942 CTAAAACATCTGGACAAATAGGG - Intronic
1092275448 12:7057493-7057515 CTAACTTTTCTGGCAAGATCGGG + Intronic
1093267524 12:17021258-17021280 CTAAATTATCTGGCAAAACGAGG - Intergenic
1095718776 12:45377389-45377411 ATAACGTATCTGGCCAAATAAGG - Intronic
1096181766 12:49555071-49555093 CTCAAAATTCTAGCCAAATACGG - Intronic
1099727617 12:86453414-86453436 GTAAATATTCTGGACTAATAAGG + Intronic
1100052510 12:90466436-90466458 CTAATTGCTCTGGCTAAATATGG + Intergenic
1100834235 12:98551199-98551221 TTAAATCTTCTGGCCAGGTATGG + Intergenic
1101026493 12:100612206-100612228 CTAATTTTTCTTTCCAAATAAGG + Intronic
1103207281 12:119139813-119139835 CTAATCTTTCTGGCCAGAAAGGG + Intronic
1106098808 13:26675977-26675999 AAACATTTTCTGGCCAAGTAGGG + Intronic
1107879540 13:44821098-44821120 CAAAATCTTTTGGCCATATAAGG - Intergenic
1109346059 13:61115746-61115768 CCAAATTTTCTTGCCAATTGTGG + Intergenic
1109773588 13:67009602-67009624 CTAAATCTCCTGACTAAATAAGG - Intronic
1110397924 13:75053510-75053532 CTTGATTTTCGGGCCAAATTTGG - Intergenic
1111931456 13:94517063-94517085 CTAAAATTTCCCCCCAAATATGG + Intergenic
1113175424 13:107558428-107558450 CTAAAATTTATCCCCAAATATGG + Intronic
1113399507 13:109978023-109978045 AAAAATTTTATGTCCAAATAAGG + Intergenic
1113444377 13:110354341-110354363 CTAAACTTTCTGGCTTAGTATGG + Intronic
1115124799 14:29978951-29978973 GTAAATTTTCTGATCAAATCAGG + Intronic
1115828982 14:37313335-37313357 CTAGATATTCTGGCAAAATTAGG + Intronic
1117317654 14:54589368-54589390 CTAAATTTTATGGCCATGTGTGG + Intronic
1117421302 14:55548392-55548414 CTAAATGTTCTGGGGAAGTAGGG + Intergenic
1120224369 14:81774001-81774023 ATAAATTTTATGGCCAAATGTGG - Intergenic
1120644433 14:87056632-87056654 CTATATTTTCTGGCCAGGTGCGG + Intergenic
1120769480 14:88362729-88362751 CTAAATTTTCTGACAAACAAGGG + Intergenic
1121684877 14:95828386-95828408 ATAAATTATAAGGCCAAATATGG - Intergenic
1126322290 15:47437915-47437937 CTTAAGTTTCTGGCAAAATCTGG + Intronic
1126545331 15:49867013-49867035 CTGAATTTTATGCCAAAATAAGG - Intronic
1128015780 15:64345073-64345095 CTAAATATTCTGGTCATCTAGGG - Intronic
1129156256 15:73720013-73720035 CTAAATTATCTTAGCAAATAAGG - Intergenic
1131765035 15:95666535-95666557 CTATCTTTTCTGGCAAAAAAAGG + Intergenic
1139190061 16:64852726-64852748 CTAAAGTTTTTGGAAAAATAAGG - Intergenic
1140076576 16:71705437-71705459 CCAAATTTCCTGGCCTAAAAAGG + Intronic
1143790517 17:9291554-9291576 CTAAATTTAATGCTCAAATATGG + Intronic
1145947735 17:28790094-28790116 CTTGATTTACTGGCCAAATCGGG + Intronic
1148366918 17:47062298-47062320 TTAAATTTTTTGGCCAAGTGCGG - Intergenic
1149938164 17:60830778-60830800 ATAAATTTTCTGGCTCAATAAGG + Intronic
1155663092 18:28275343-28275365 TTAAATTTTCTTGTCAACTATGG - Intergenic
1156576456 18:38322513-38322535 ATACTTTTACTGGCCAAATAGGG + Intergenic
1160055354 18:75473624-75473646 CTTAATTATCTAGACAAATATGG - Intergenic
1163567115 19:18058428-18058450 CTGAATTTTGTGGCAAAAAAAGG - Intergenic
1163727087 19:18928975-18928997 CCACATTGTCTGGCCAAATTTGG - Intronic
1163882508 19:19938604-19938626 CTAACGTTTTTGGCCTAATAAGG + Intergenic
1164495388 19:28755899-28755921 CTAAATTTTCTGACCATGAATGG - Intergenic
1165475831 19:36030223-36030245 CTAAATTTTCTGTACAGATGGGG + Intronic
1166516791 19:43453217-43453239 ATAAATTTTCTGGCCAGGCACGG + Intergenic
925843996 2:8019440-8019462 CCAGATTTTCTGACCAAACAAGG - Intergenic
926510981 2:13777573-13777595 TTAAATTTTGTTGCCAAAAAAGG + Intergenic
928651579 2:33409726-33409748 CTTAATTTCCTGGCTAAATGGGG - Intergenic
930914943 2:56675010-56675032 ATAAATGTTCTGGACAAACAGGG - Intergenic
931891473 2:66677789-66677811 CTAAATTTTCCTGCAAAATGAGG - Intergenic
933488744 2:82957301-82957323 CTTATTTTTCTTACCAAATAAGG + Intergenic
936690889 2:114887124-114887146 CTAAATGTTCTAGCAAAATAAGG - Intronic
937169588 2:119852240-119852262 CTAATTTTTTTTCCCAAATAGGG - Intronic
937444631 2:121947295-121947317 TTAAATTTTCTGGCCAGGTGCGG + Intergenic
938020105 2:127899363-127899385 CTAAATTTTCTGTAGAGATAAGG - Intergenic
939117526 2:138077494-138077516 TTAAATTTTCTGGAGAAAGAGGG + Intergenic
939773630 2:146357144-146357166 CTAAATTTTGTATCCAAATCTGG - Intergenic
941321638 2:164063064-164063086 CTAACTTTTCTCCCCAACTATGG + Intergenic
943214786 2:185016467-185016489 TTAAATATTCTGGAGAAATAAGG + Intergenic
945197848 2:207253941-207253963 CTATATTTTCTGGGCAATGATGG + Intergenic
1170312604 20:15008952-15008974 CTACATTTTCTGGCAGAATAAGG - Intronic
1173127566 20:40353944-40353966 CTACATGATCTGGCCATATATGG - Intergenic
1173655385 20:44696884-44696906 ATGAATTTTCTGCCCACATATGG + Intergenic
1178782055 21:35612995-35613017 CAAAACTTTCTGCCCAATTAGGG - Intronic
1181192101 22:21149242-21149264 CTCAATTATCTGGCTAAACATGG + Intergenic
1181207095 22:21261268-21261290 CTCAATTATCTGGCTAAACATGG - Intergenic
1182811660 22:33122063-33122085 CTTAATTTTCTGGGAAAACAAGG - Intergenic
1184624840 22:45717266-45717288 GTAAATTATCTGACTAAATATGG + Intronic
1203271002 22_KI270734v1_random:52679-52701 CTCAATTATCTGGCTAAACATGG - Intergenic
951546771 3:23833822-23833844 CTAAATTTTCTGTAGAGATAGGG - Intronic
952122408 3:30261391-30261413 CTCAGTTTTCTGCCCAAACACGG + Intergenic
957217513 3:77340512-77340534 TTGAATTTTCTGGCAAAATAGGG + Intronic
957799336 3:85054717-85054739 GTACATTTGCTGGCCAAAAATGG - Intronic
964683085 3:159363806-159363828 TTTATTTTTCTGGCAAAATAGGG - Intronic
964978862 3:162653697-162653719 CCATATTTTCTCGCAAAATATGG - Intergenic
965122596 3:164581124-164581146 CTAATTTTTATAGCAAAATAAGG - Intergenic
965914196 3:173821088-173821110 CTAAAATTTTTCCCCAAATATGG + Intronic
971483132 4:27131945-27131967 CCAAATTTTCTCTCCACATAAGG - Intergenic
972473079 4:39425730-39425752 TCAAATTTTCTGGCCAGATGTGG - Intronic
973112254 4:46411009-46411031 TTAAATTTTCTGGCCAAAGAGGG - Intronic
975383963 4:73733497-73733519 CTCAAATTTATGGCAAAATAAGG - Intergenic
975837613 4:78441252-78441274 CTAAGTGCTCTGCCCAAATATGG + Exonic
978255715 4:106690633-106690655 CCATATTTTCTGGTGAAATAAGG - Intergenic
979236206 4:118403367-118403389 ATAAATTTCCTGGATAAATAAGG - Intergenic
980085302 4:128384322-128384344 AAACATCTTCTGGCCAAATATGG + Intergenic
980627895 4:135398230-135398252 CTAAATTTTTTGGTCAAAGCAGG + Intergenic
980883118 4:138733450-138733472 CTATATCTTATGGTCAAATAGGG + Intergenic
982808515 4:159796741-159796763 CTAATTTTTATTTCCAAATAAGG - Intergenic
983558382 4:169078091-169078113 CTAAATTTTCTGCCCTTATAGGG + Intergenic
984023158 4:174510929-174510951 CTACATTTTCTGGCCAGGCACGG - Intronic
987657006 5:20820212-20820234 CTTAATTTTATTGCCAATTATGG + Intergenic
987732364 5:21791315-21791337 CTACATTTTCTGGACAATTTTGG + Intronic
988108538 5:26782610-26782632 CTACAGTTTCTTGCCAAATGGGG - Intergenic
988255085 5:28809848-28809870 CCAGATTTTCTGGCCAGATTCGG + Intergenic
988766543 5:34383736-34383758 CTTAATTTTATTGCCAATTATGG - Intergenic
989145440 5:38244998-38245020 TTAAAGTTTTTGTCCAAATATGG + Intergenic
992087207 5:73288741-73288763 CAAAATCCTCTGGCCAAATGGGG + Intergenic
992303017 5:75404716-75404738 TTAAAAATTCTGGCCAAGTATGG + Intronic
993165129 5:84343516-84343538 GTATATTTCCTGCCCAAATATGG - Intronic
993538429 5:89117717-89117739 CAAAATCATCTGGCAAAATAGGG + Intergenic
994574481 5:101559222-101559244 CTAAAAGCACTGGCCAAATATGG + Intergenic
994811573 5:104525615-104525637 ATTAATTATCTGGCCAAAAAAGG - Intergenic
994837752 5:104877683-104877705 ATAAATTTTCTGGACTAATTCGG - Intergenic
996821220 5:127630442-127630464 CTGAAATTTCAGGCCAAAGAGGG - Intergenic
999011449 5:148045511-148045533 ATAAATTTTCTGCACAAATTAGG - Intronic
999668357 5:153936298-153936320 CTAAATCTTCTGACCAAACCTGG - Intergenic
1000789441 5:165587200-165587222 CTAAATTGTGTGGGCAAATGAGG - Intergenic
1000982870 5:167835354-167835376 CTCAATTTTCTTGCCCAATCAGG - Intronic
1004124635 6:12860916-12860938 CTAATTTTTATGGGCAAGTAAGG + Intronic
1006905595 6:37531120-37531142 CTCAATTTTCTCATCAAATAAGG + Intergenic
1007194937 6:40052242-40052264 TGAAATTTTCTGGCTAAATGGGG + Intergenic
1011015643 6:82751738-82751760 TCAAATTTTCTGGCCCTATAAGG - Intergenic
1011279958 6:85666947-85666969 TTACCTTTTCTGGCCAAAGATGG + Intergenic
1011889532 6:92139903-92139925 CTAAATCTTCTGGCTTGATAGGG - Intergenic
1012015026 6:93839021-93839043 CCAAATTTTCTGGTCTTATAGGG + Intergenic
1014914229 6:127126063-127126085 CCAAAGTTTATTGCCAAATATGG - Intronic
1016756711 6:147695398-147695420 CTAAATTATCATCCCAAATAAGG - Intronic
1016795858 6:148116521-148116543 CCAAGTTTTCTGGCTAAACATGG + Intergenic
1016923755 6:149319201-149319223 CTAAAATTCCCGGCCAAATCTGG - Intronic
1017408919 6:154148829-154148851 CTAAATGTTCAAGCCAAAAATGG - Intronic
1021048347 7:15951565-15951587 CTAGATTTTCTGACCCAACATGG + Intergenic
1021209329 7:17826387-17826409 CTAGATTTTCTTGCCATATAAGG - Intronic
1021959493 7:25858003-25858025 GTGAGTTTTCTGGCCAACTAGGG + Intergenic
1022314522 7:29232969-29232991 GTAAATTTTCAAGCTAAATAAGG - Intronic
1022422704 7:30238983-30239005 CTACATTTCTTGGGCAAATAAGG - Intergenic
1027462793 7:78476443-78476465 TTAATTTTGTTGGCCAAATATGG + Intronic
1028822350 7:95227134-95227156 TTATATTCTTTGGCCAAATAAGG - Intronic
1031357558 7:120805993-120806015 GTAAATTTCCTGGCCACATGAGG + Intronic
1034228610 7:149501673-149501695 CTAATTTTTCTGGCACACTAAGG - Intergenic
1034654818 7:152721032-152721054 ATATATTTTCTGGCCAACCATGG + Intergenic
1036766756 8:11554346-11554368 CTTTATTTTCTGGCTAAAGAGGG - Intronic
1037161478 8:15778660-15778682 CTAGATTTTTATGCCAAATAGGG + Intergenic
1037190617 8:16120085-16120107 CAAAATTTTCTGGCCAAGCGCGG + Intronic
1038413586 8:27376756-27376778 CTAAAATTTCTGGTCTAAAAAGG + Intronic
1038856043 8:31334549-31334571 TGAAATTTTCTGTCCAAACAAGG - Intergenic
1039512253 8:38101701-38101723 TTTAATTTTCTGGCCAGGTATGG + Intergenic
1043352686 8:79378879-79378901 GTAGATTTTCTTGCCAAATAAGG + Intergenic
1043688095 8:83113853-83113875 CTAAATTGTCTAGAAAAATATGG - Intergenic
1044175557 8:89116723-89116745 AAAAATTTTCTGGCGAAAAAAGG + Intergenic
1044650909 8:94494162-94494184 TTACATTCTCTGGCCAAATGTGG + Intronic
1046733960 8:117755860-117755882 CAAAATTTTCTGGCAAAAATAGG - Intergenic
1047426653 8:124752576-124752598 TTATATTTTCCAGCCAAATATGG - Intergenic
1048429821 8:134359820-134359842 CAGAATTTTCTGTCCAAAGATGG + Intergenic
1048555744 8:135474224-135474246 CAACATTTTCTCTCCAAATAAGG - Intronic
1048946623 8:139454617-139454639 CTGAAGATTCTGGCCAAGTATGG - Intergenic
1050533275 9:6608982-6609004 CTAAACTTGCTGACCAAGTATGG + Intronic
1050833857 9:10050793-10050815 CTAAATTTCCTGTCCAATTTTGG + Intronic
1051955924 9:22693217-22693239 ATAGATTTTCTTGCCAAAAAGGG + Intergenic
1052251928 9:26408673-26408695 CTAAACTGTCTGGCTAAATCAGG - Intergenic
1054937255 9:70701095-70701117 ATAAATTTTCTAGTCAAGTATGG + Intronic
1055951296 9:81732247-81732269 AAAAATTTTCTGGCCACGTACGG - Intergenic
1055981930 9:82012303-82012325 CAAATTTTTCAGGCCACATAAGG - Intergenic
1056529863 9:87477818-87477840 CTGACTTTTCTGGACAGATAAGG - Intergenic
1056816030 9:89801777-89801799 CTCATATTTCTGGCCAAATATGG + Intergenic
1057955909 9:99407712-99407734 CTAAACTACCTGACCAAATAGGG - Intergenic
1058325233 9:103688047-103688069 CTAGATTTTGTGGTAAAATATGG - Intergenic
1058413977 9:104765508-104765530 GTAAATTTTCTGTCCTAATCTGG - Intronic
1186876061 X:13819377-13819399 AGAACTTTTCTGGCCAAAAATGG - Intronic
1187066238 X:15841156-15841178 CTTCATTTTATAGCCAAATAGGG - Intronic
1188686147 X:33072972-33072994 CTAAATTTTCTGGCCAAATAGGG - Intronic
1190930672 X:54947324-54947346 CTGAATTTTCAGGCTAAATAGGG - Intronic
1192897640 X:75460375-75460397 CCAAATTTTCTGGACAAGGATGG + Intronic
1193903302 X:87210684-87210706 TTAAATTTTCTGGTTAAATGTGG + Intergenic
1194332624 X:92601763-92601785 CTAAATTGTGTGGCGAGATATGG - Intronic
1194490708 X:94545021-94545043 TTAACTTTACTGGCTAAATATGG - Intergenic
1197137409 X:123078173-123078195 CTAAATATTTTGGGCCAATAAGG + Intergenic
1198930029 X:141846328-141846350 CTAAACTTGCTGGCCTAAGAGGG + Intronic
1200641321 Y:5720817-5720839 CTAAATTGTGTGGCGAGATATGG - Intronic
1201939907 Y:19448416-19448438 CTCAGTTTTCTGGCCAAAGTTGG + Intergenic