ID: 1188688400

View in Genome Browser
Species Human (GRCh38)
Location X:33098594-33098616
Sequence ACATTGTTTACATATAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188688400_1188688401 7 Left 1188688400 X:33098594-33098616 CCTGTGTTATATGTAAACAATGT 0: 1
1: 0
2: 1
3: 13
4: 227
Right 1188688401 X:33098624-33098646 GAAACAGAATGCTTGTTCCCTGG 0: 7
1: 17
2: 25
3: 35
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188688400 Original CRISPR ACATTGTTTACATATAACAC AGG (reversed) Intronic
900901085 1:5516385-5516407 TGTTTGTTTACATATAACAGTGG + Intergenic
901164290 1:7206607-7206629 CCATTGTATAAATATATCACAGG + Intronic
902940614 1:19798213-19798235 ACACTGTTTACAAAACACACAGG + Exonic
903587309 1:24425994-24426016 ACATTATTTACTTATAGAACAGG + Intronic
907088149 1:51697834-51697856 ATATTGTTTCCATATAAACCAGG + Intronic
908238792 1:62171798-62171820 ACCTTGATTTCATACAACACAGG + Intergenic
914389281 1:147204414-147204436 ATATTGTTTACACATTACAGAGG + Intronic
916864964 1:168846570-168846592 ACATTGTTGAAACATAACTCGGG - Intergenic
919034886 1:192293811-192293833 ACATTTTTTACATATAAAAGTGG + Intergenic
919175520 1:194013782-194013804 ACGTTGTATTCATGTAACACTGG - Intergenic
919303066 1:195794813-195794835 ACATTTTGTAAATAAAACACAGG + Intergenic
919445210 1:197695974-197695996 AAATTGTTTACTAATAAAACAGG + Intronic
919531201 1:198723491-198723513 ACTTTTTTGACATTTAACACAGG - Intronic
921506770 1:215981118-215981140 CCATTTTTTACATCTAATACTGG - Intronic
923496220 1:234527677-234527699 ACATTATTTAAATGTCACACTGG - Intergenic
1064273364 10:13885029-13885051 ACCTTGTTTACTTATATTACTGG - Intronic
1066252429 10:33647580-33647602 ACATTATATACATATAATAAGGG - Intergenic
1070109036 10:73464307-73464329 TCATTATTTATATATATCACAGG + Intronic
1071238609 10:83678735-83678757 ACAGTGTTTGCAAATAACATTGG - Intergenic
1074254763 10:111790509-111790531 ATATTGTTTTTATATATCACAGG + Intergenic
1074513727 10:114144257-114144279 ACATTATTTACATATTAAATGGG - Intronic
1074582808 10:114736496-114736518 CCATTGTTTAAAAATAACAAAGG + Intergenic
1075008579 10:118848876-118848898 AAAATGTTTACAAATAAAACAGG + Intergenic
1075882126 10:125861815-125861837 ATATTATTTACATATAACTAAGG - Intronic
1079667256 11:23121473-23121495 GCACTGTTTACATATAACTAAGG + Intergenic
1080033771 11:27689336-27689358 ACATTATTTCTATATAACAGAGG - Intronic
1081004298 11:37715190-37715212 ACATTGTTTATATCTTACATGGG + Intergenic
1084842067 11:71862059-71862081 GCATTGTCTACACAGAACACAGG - Intergenic
1086971371 11:93084461-93084483 ATATTTATTACATATAACTCAGG + Intergenic
1087471635 11:98583217-98583239 ACATTTTTTACATATATCTGTGG + Intergenic
1088033159 11:105276965-105276987 ACATTAATTACATCCAACACTGG - Intergenic
1088036646 11:105325362-105325384 ACATTGTTTACATGGCACATAGG - Intergenic
1090708984 11:129369035-129369057 ACAATATTTACAAAGAACACTGG - Intergenic
1092647130 12:10587472-10587494 ACATTATCTACATCTAACAAAGG + Intergenic
1093814409 12:23527512-23527534 ACAATGCTTACTTATAAAACAGG + Intergenic
1094778533 12:33761746-33761768 AATTTATTTACATCTAACACTGG - Intergenic
1095090903 12:38103847-38103869 ACATAGTAAACATATATCACAGG + Intergenic
1095254790 12:40022296-40022318 ACATAGATTACATATCACACAGG + Intronic
1097302273 12:58031765-58031787 ACATTGTAAACATGTATCACTGG + Intergenic
1099489033 12:83265231-83265253 AAATTGTTTTAATATCACACAGG + Intergenic
1100510983 12:95273141-95273163 GCATTGTCTACATATAAACCAGG - Intronic
1100556661 12:95701150-95701172 ACTTTGGTAACCTATAACACAGG - Intronic
1101914065 12:108882837-108882859 TCATTGTTAACATATAAAAATGG + Intronic
1103358938 12:120342432-120342454 ACAGTATTTACATATGATACAGG + Exonic
1103610085 12:122118360-122118382 GTATTGTTGAAATATAACACTGG - Intronic
1103802178 12:123545523-123545545 ACATTGTTTTCTTATAACATTGG + Intergenic
1107044966 13:35984367-35984389 ACATTGTTTGGAGACAACACTGG + Intronic
1107554399 13:41504817-41504839 CCATTGTATATATATACCACAGG - Intergenic
1109191106 13:59325288-59325310 ACATTGTTTACATTAAATGCTGG + Intergenic
1109821649 13:67664892-67664914 ACATTGTTTATATTTTGCACTGG - Intergenic
1110000024 13:70185397-70185419 ACAGAGGTTACAAATAACACTGG + Intergenic
1110669084 13:78154970-78154992 TCTTTGTTTTCATATACCACAGG + Intergenic
1110952599 13:81515389-81515411 ACAATTTTGACACATAACACAGG - Intergenic
1111789894 13:92841126-92841148 AAATTGTTTTCATATAATCCAGG + Intronic
1112193093 13:97196946-97196968 AGATTGTTTACATAGACCAAGGG + Intergenic
1112198878 13:97255741-97255763 GCTGTGTTTAGATATAACACAGG + Intronic
1114913255 14:27227519-27227541 ACATTAGTTACATATAAAACTGG - Intergenic
1118722644 14:68605231-68605253 AAATATTTTACATATAACACAGG - Intronic
1119135238 14:72212365-72212387 ACATTGTTGGCAGCTAACACAGG - Intronic
1121533730 14:94676812-94676834 ACAGTGTTTATATAAAACAAAGG - Intergenic
1126027686 15:44463626-44463648 ACATTATTTACTCCTAACACAGG - Intronic
1127336622 15:57992552-57992574 ACATTGGTGTCATAGAACACTGG - Intronic
1129680237 15:77654780-77654802 GCATTATTTCCATGTAACACGGG - Intronic
1133791759 16:9014423-9014445 GCTTTATTTACCTATAACACAGG + Intergenic
1135035003 16:19069709-19069731 ACATTTCTTACATATAAAATTGG - Intronic
1139196417 16:64923992-64924014 AAATTGCTTATACATAACACAGG - Intergenic
1147487877 17:40835793-40835815 ACAGTCTTTTCATAAAACACAGG - Exonic
1148252606 17:46097600-46097622 ACATTGTTTAAATATTACACTGG + Intronic
1148290372 17:46442551-46442573 AAATTGTGTGCATATAACAAAGG + Intergenic
1148312540 17:46660124-46660146 AAATTGTGTGCATATAACAAAGG + Intronic
1150179607 17:63103002-63103024 ACAGTGTTTGCATATAACCTAGG - Intronic
1150691732 17:67372868-67372890 ACATTGTCTATATTTAACAGAGG + Intergenic
1151216515 17:72580711-72580733 ACTTTGTTCACACATTACACAGG - Intergenic
1152170623 17:78744880-78744902 AAATTGTGTACATAAAACAAAGG - Intronic
1152939497 17:83160782-83160804 AGAAAGTTTACAGATAACACAGG - Intergenic
1153742546 18:8144192-8144214 ACGGTGCCTACATATAACACAGG - Intronic
1155089207 18:22489813-22489835 AGATTGTTTACATAATGCACGGG - Intergenic
1155645538 18:28072660-28072682 ACAACTTTTACATAAAACACAGG + Intronic
1155738679 18:29257563-29257585 ACAGTGTTGACATATAATAAAGG + Intergenic
1156190277 18:34711212-34711234 GCGTTGTTTACATATCACCCTGG + Intronic
1156218173 18:35023545-35023567 AAATTGTTTACATATATTAATGG + Intronic
1156675522 18:39523134-39523156 TCATTTTTCACATATAACATTGG - Intergenic
1156955602 18:42959151-42959173 ACAATGTTTACATATGAAGCTGG - Intronic
1158946317 18:62450070-62450092 ACATGGTTTACCTATGGCACAGG - Intergenic
1160162967 18:76489670-76489692 AGGTTGTTTACAGATAACAATGG + Intronic
1161181659 19:2887290-2887312 ACAATGTTCACACATAAAACAGG + Intergenic
1161904338 19:7144168-7144190 ACAAAGTTTACTTATAAAACAGG - Intronic
1166132371 19:40753750-40753772 ACATTGGTGACATAGAACCCTGG + Intronic
1167420038 19:49397411-49397433 ACATTCTTTACACCCAACACTGG - Intronic
1168235399 19:55059856-55059878 ACCTTGATTTCATACAACACAGG - Intronic
925382122 2:3435813-3435835 GCATTCATTACATATCACACAGG - Intronic
925863922 2:8207417-8207439 ACATTTTATATTTATAACACAGG - Intergenic
927526342 2:23744904-23744926 AAATTGTTAACATTTAATACTGG + Intergenic
927825097 2:26303008-26303030 ACATTGTTCACAAACAGCACGGG - Intergenic
930640614 2:53851148-53851170 ACAAGGTTTACAGATAAGACTGG - Intergenic
930956969 2:57214569-57214591 ACATTGTTTAAAAATAGCATTGG - Intergenic
931310025 2:61069114-61069136 TCATTGTTTACATAAGACACTGG - Intronic
932784836 2:74590880-74590902 GCAGTGTTTACATACAACAGGGG + Intronic
933289178 2:80418791-80418813 ACATTGTTAAAATAGAAAACAGG - Intronic
938172653 2:129093474-129093496 AAAGTGTTAACATATAACCCAGG - Intergenic
941110946 2:161418164-161418186 ACATTGTTTACATATGCCCCTGG - Intronic
941131399 2:161654140-161654162 ACCGTCTTTTCATATAACACTGG + Intronic
942220124 2:173760613-173760635 ACATTGATTATATATTAGACTGG + Intergenic
942808388 2:179963873-179963895 ACACTGTTTACATTTTACACTGG - Intronic
943164667 2:184305481-184305503 ACAGTGTTTACATGTAGTACAGG - Intergenic
943696010 2:190931768-190931790 AAATTGTTGACATATAAATCCGG + Intronic
944326484 2:198411492-198411514 ACATTGTTTGCACTCAACACAGG - Intronic
947783738 2:232795362-232795384 ACTTACTTTACATATAACAATGG - Intronic
1169748569 20:8968043-8968065 ACATTGTTTACATTAAAAATGGG - Intronic
1171083944 20:22218587-22218609 ACATTTTTTCCATAAAAAACAGG - Intergenic
1177454913 21:21324848-21324870 ATATTGTATACATATGACAGTGG - Intronic
1177591589 21:23176832-23176854 ACATTGTATAAATATTGCACTGG + Intergenic
1177596437 21:23249445-23249467 ATTTTGTTTAAAAATAACACAGG + Intergenic
1178085785 21:29110944-29110966 ACATTTTTTACATGGAAGACAGG - Intronic
1178227240 21:30736183-30736205 AAATTGTTTAAATATAATAAAGG - Intergenic
1178558252 21:33613395-33613417 ACATTTTTTACATACATGACTGG + Intronic
1178586448 21:33874983-33875005 ACAGTGTGTACATATAACCATGG - Intronic
1179780662 21:43698658-43698680 ACAGTGTTTACAGATAAGAGCGG - Intergenic
951122913 3:18949520-18949542 ACCTTGTTTACTTATGACAAGGG + Intergenic
953285691 3:41605801-41605823 ACATTCTTTACATATATAAAAGG + Intronic
954703230 3:52463480-52463502 ACATAGTTACCATATAACTCAGG - Intronic
958607894 3:96383486-96383508 ACAATGTTTACATATTGCATTGG + Intergenic
958660009 3:97054776-97054798 ACATAATTGACATATAAAACAGG - Intronic
958885086 3:99716986-99717008 ACATTGCTAACATTTAACACAGG - Intronic
959990418 3:112625206-112625228 CCATTTTTCACATATTACACTGG + Intronic
961335233 3:126172418-126172440 ACATTCTTTGCATTTATCACAGG - Intronic
963611124 3:147470364-147470386 ATATTTTTTACATATACAACAGG + Intronic
963753778 3:149211970-149211992 ACTTTGTTTCCATATAATAATGG - Intronic
965511892 3:169576927-169576949 ACATTGTGTAGACATAGCACTGG + Intronic
966037174 3:175433286-175433308 ACATTCTTTAAATGTAGCACTGG + Intronic
967381289 3:188861540-188861562 CCATTATTTACATATTACATAGG - Intronic
969783175 4:9428090-9428112 GCATTGTCTACACAGAACACAGG - Intergenic
971167100 4:24195121-24195143 CCACTGTTTCCATATAACATAGG - Intergenic
971573039 4:28238010-28238032 CCTTTGTTTCCATATAACTCTGG + Intergenic
972004959 4:34089510-34089532 ACATTTTTTATATATAATATAGG - Intergenic
972778190 4:42262907-42262929 ACAATGTTTATACATAACAAAGG + Intergenic
973749886 4:54004519-54004541 ACATTCTTTATATATTACAATGG - Intronic
974268471 4:59617747-59617769 AAATTGTTTACAAGCAACACTGG + Intergenic
974403550 4:61436233-61436255 ACATTGTTCATATAGAATACAGG + Intronic
974559715 4:63501647-63501669 ACATTGTTCAGATATGACATAGG + Intergenic
978253517 4:106663284-106663306 ACATTATTTAGATATAAAATTGG + Intergenic
978500637 4:109406054-109406076 ACATTGTTAAAATATAGCATTGG + Intergenic
978678193 4:111344404-111344426 AAATTGTTTACATATCATATAGG + Intergenic
980446436 4:132914865-132914887 ACATTTTTTACATATACTTCAGG + Intergenic
980791303 4:137622771-137622793 ACATTGTCTACATTTATAACAGG + Intergenic
982044379 4:151428535-151428557 ACATTGTTTAAATATTACTAAGG - Intronic
982282964 4:153704749-153704771 ACATCATTTTCATATACCACAGG - Exonic
983282859 4:165703018-165703040 ACACTGTTCAAATATAAAACAGG + Intergenic
983318155 4:166158841-166158863 ACACTACTTACATATAACAGAGG + Intergenic
985734203 5:1568175-1568197 ACCTTGATTCCATACAACACAGG + Intergenic
986720797 5:10560206-10560228 ACAATTTTTACACATAATACTGG + Intergenic
986809838 5:11345009-11345031 ACATTGTTTATATTTAACATAGG - Intronic
987219627 5:15776791-15776813 TCATTGTTTATACATAACAATGG + Intronic
989223850 5:39002953-39002975 CCATTGTTTATATAAAACAAAGG - Intronic
990093600 5:52084847-52084869 ACATTATTTTCATGTAATACTGG - Intergenic
990196772 5:53326055-53326077 ACTTTGTTTACATAGAACATGGG + Intergenic
992191643 5:74297852-74297874 ACATAGTTTACAAAAAACAACGG + Intergenic
992267242 5:75031584-75031606 ATATTGTATACACACAACACTGG + Intergenic
992547879 5:77832877-77832899 ACATTGTTTAAATAAAAGAATGG + Intronic
993832124 5:92772983-92773005 ACATTGCTTTCAGATAATACAGG + Intergenic
993952119 5:94188798-94188820 ATATTTTTTCCATAGAACACAGG - Intronic
994184228 5:96800681-96800703 ACTTTGATTACATATAACTATGG + Intronic
994189636 5:96855413-96855435 ACATTGTCTATATCTCACACTGG + Intronic
996016950 5:118549978-118550000 ACATTGATTACATTTTACAATGG + Intergenic
996407495 5:123120268-123120290 ACACTGTTTGGACATAACACAGG - Intronic
997550721 5:134750049-134750071 GCTTTATTTACATAAAACACTGG + Intronic
998303087 5:141045191-141045213 AAAATGTTTACATATTACATAGG + Intergenic
998884899 5:146684124-146684146 ACATTTGTTGCATATAACAATGG - Intronic
998924718 5:147109594-147109616 ACAGTGGGTACATATAAAACTGG + Intergenic
999857969 5:155615837-155615859 ACATTTTTTACATGAAATACTGG + Intergenic
999928371 5:156404220-156404242 ACATTATATACACATAATACAGG - Intronic
1001818046 5:174687844-174687866 ACAATGTGTACATTTGACACAGG - Intergenic
1002492992 5:179592670-179592692 ACAGTGTTTACAAGTAACTCTGG - Intronic
1003999447 6:11582821-11582843 AAATTGTGTTCACATAACACAGG - Exonic
1004754276 6:18594863-18594885 ATATTGTATACATATGACACAGG - Intergenic
1006150598 6:31985079-31985101 AGAGTGTTTACAGATAAGACAGG + Intronic
1006156899 6:32017817-32017839 AGAGTGTTTACAGATAAGACAGG + Intronic
1006480293 6:34287439-34287461 ACAGTGGTTACATAATACACTGG - Exonic
1008306613 6:49910031-49910053 AGGCAGTTTACATATAACACTGG - Intergenic
1009288141 6:61848984-61849006 ACAATCATTACATATCACACAGG + Intronic
1009523391 6:64713142-64713164 ATATTTATTACCTATAACACTGG - Intronic
1009992905 6:70865526-70865548 ATAGTGTTTACATATAACCTAGG - Intronic
1010515435 6:76768117-76768139 ACATTGGTTACATAGAAAATAGG + Intergenic
1011167079 6:84460782-84460804 ACATTGTATAAATATTACTCAGG - Intergenic
1011482249 6:87806648-87806670 ACATTCTTTAGAGATATCACTGG + Intergenic
1012696239 6:102388000-102388022 ACCCTGTTTACATATTAAACTGG + Intergenic
1013376139 6:109516429-109516451 ACATAATTTACAAATAATACAGG - Exonic
1015085656 6:129287963-129287985 ACCTGGTTTACATATCAGACAGG - Exonic
1016224801 6:141722244-141722266 ACATGGTGTACAGATCACACTGG + Intergenic
1017438903 6:154443900-154443922 ACATTGTTCAAAAAGAACACAGG - Intronic
1018333328 6:162757346-162757368 ACATTATATAAATATAACATGGG + Intronic
1020634086 7:10675283-10675305 ACTTTGGTTACAGATAAGACCGG + Intergenic
1020891559 7:13884617-13884639 AAATTGTTTAAATATAACCAAGG - Intergenic
1022058998 7:26771640-26771662 ACTTTCTTTACCTATAAAACAGG + Intronic
1022180795 7:27917378-27917400 ATATTGTTTACATCAATCACTGG + Intronic
1027388848 7:77685232-77685254 ACAGTGTTTAAGTATCACACGGG + Intergenic
1027958128 7:84908377-84908399 ACATTTTTTACTTTTAACAAAGG + Intergenic
1028271408 7:88795116-88795138 ACATTGTTTCCTGATAAAACTGG - Intronic
1028405821 7:90472760-90472782 ACTCTGTGTATATATAACACTGG - Intronic
1030994200 7:116337964-116337986 ACATTGTTCACATCTGACTCAGG - Intronic
1035043453 7:155947778-155947800 GCATTGTTGGTATATAACACAGG + Intergenic
1035065014 7:156097971-156097993 ACAATGTGTACTTTTAACACAGG - Intergenic
1036835876 8:12065960-12065982 GCATTGTCTACACAGAACACAGG + Intronic
1036857719 8:12312529-12312551 GCATTGTCTACACAGAACACAGG + Intergenic
1038588084 8:28809481-28809503 TTCTTTTTTACATATAACACAGG + Intronic
1038629681 8:29229933-29229955 ATATTCTTTTCAAATAACACTGG - Intronic
1039307679 8:36280599-36280621 ACATTTTTTACTTATTGCACTGG + Intergenic
1041946458 8:63449104-63449126 AAATTGATAACATATTACACAGG - Intergenic
1042711165 8:71719073-71719095 ACATTGTTTTGACATATCACTGG - Intergenic
1043264646 8:78249149-78249171 TCATTTTTTATATGTAACACTGG + Intergenic
1044104848 8:88191605-88191627 ACTTTATTTACATAAAACAGGGG - Intronic
1045303193 8:100933008-100933030 ACTTTGTTGACATTTAGCACTGG - Intronic
1049716158 8:144093936-144093958 AAACATTTTACATATAACACAGG + Intergenic
1050016320 9:1237711-1237733 ACATTTTTTACTTGTAAAACAGG + Intergenic
1051123960 9:13782895-13782917 ACATTGTTGAAATGAAACACAGG + Intergenic
1051774452 9:20620207-20620229 ACATTCTTTGCTAATAACACAGG + Intronic
1052046127 9:23796183-23796205 TCATTGTTAACATACAACTCTGG + Intronic
1055547162 9:77390493-77390515 AAATTATTTTTATATAACACTGG - Intronic
1055715905 9:79117644-79117666 ACATTTTGTACATCTAGCACTGG - Intergenic
1055752709 9:79524995-79525017 ACATTGTTTCCATTTAAAATTGG - Intergenic
1056728048 9:89139619-89139641 CCATTCTTTACTTATCACACAGG + Intronic
1056857634 9:90147838-90147860 CCATTGTCTAGATATACCACAGG + Intergenic
1057096881 9:92318906-92318928 AGATGGTTTACAAAAAACACTGG + Intronic
1057282609 9:93723573-93723595 ACATTGTTCACACACAACCCTGG - Intergenic
1057426734 9:94956842-94956864 ACATCCTTTACATCTAACACTGG - Intronic
1059594988 9:115710225-115710247 ACATTGTTAAGAAATAACAAAGG + Intergenic
1203535131 Un_KI270743v1:29072-29094 ACACTGTATAAATATAAAACAGG + Intergenic
1186395536 X:9205272-9205294 ACACTGCTTTCATATGACACTGG + Intergenic
1186527608 X:10263830-10263852 GCATTGTTTAGAAATAACAGAGG + Intergenic
1186734118 X:12442738-12442760 ACATTGTTTACATCTCACTTGGG - Intronic
1188469651 X:30523771-30523793 ACATTGTATACAGGTATCACAGG - Intergenic
1188688400 X:33098594-33098616 ACATTGTTTACATATAACACAGG - Intronic
1189114024 X:38325440-38325462 ACATTGTTAATATAAAAGACAGG + Intronic
1190966865 X:55309192-55309214 ACATTGTTTAACTAAAAAACTGG - Intergenic
1192388736 X:70702032-70702054 ACATTGTTGAAAGACAACACAGG + Intronic
1193256980 X:79360534-79360556 AAATTGTTCACATATAAGTCAGG + Exonic
1194203248 X:90980172-90980194 CCATTGTGTATATATACCACAGG + Intergenic
1194556335 X:95364958-95364980 AAAATGCTTACATATAACAAAGG + Intergenic
1195990646 X:110678899-110678921 AAAGTGCTTTCATATAACACAGG + Intronic
1199521075 X:148736517-148736539 ACAATGTATACATCTAACAAAGG - Intronic
1200549079 Y:4555598-4555620 CCATTGTGTATATATACCACAGG + Intergenic
1201358058 Y:13116885-13116907 ACATTGTTCACAAACAGCACGGG - Intergenic