ID: 1188688474

View in Genome Browser
Species Human (GRCh38)
Location X:33099370-33099392
Sequence TTTCTATTGTCCCCAGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 1, 2: 3, 3: 29, 4: 258}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188688467_1188688474 19 Left 1188688467 X:33099328-33099350 CCTCACATTTTACCTTTTTTAGG 0: 1
1: 0
2: 2
3: 42
4: 356
Right 1188688474 X:33099370-33099392 TTTCTATTGTCCCCAGAGCCAGG 0: 1
1: 1
2: 3
3: 29
4: 258
1188688473_1188688474 -4 Left 1188688473 X:33099351-33099373 CCTAGTGGTGGGTTATGTCTTTC 0: 1
1: 0
2: 4
3: 23
4: 127
Right 1188688474 X:33099370-33099392 TTTCTATTGTCCCCAGAGCCAGG 0: 1
1: 1
2: 3
3: 29
4: 258
1188688466_1188688474 20 Left 1188688466 X:33099327-33099349 CCCTCACATTTTACCTTTTTTAG 0: 1
1: 0
2: 3
3: 50
4: 552
Right 1188688474 X:33099370-33099392 TTTCTATTGTCCCCAGAGCCAGG 0: 1
1: 1
2: 3
3: 29
4: 258
1188688471_1188688474 7 Left 1188688471 X:33099340-33099362 CCTTTTTTAGGCCTAGTGGTGGG 0: 1
1: 0
2: 2
3: 5
4: 80
Right 1188688474 X:33099370-33099392 TTTCTATTGTCCCCAGAGCCAGG 0: 1
1: 1
2: 3
3: 29
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188688474 Original CRISPR TTTCTATTGTCCCCAGAGCC AGG Intronic
901467207 1:9429965-9429987 TTTCTTTTTTCCCCAGAATCCGG + Intergenic
902260862 1:15223821-15223843 TTTCCATTGTCCACAGTGCTGGG + Intergenic
903648032 1:24906355-24906377 TTTCTCAATTCCCCAGAGCCTGG - Intronic
903705983 1:25286315-25286337 TTTCTATTTTCTGCAGAGACAGG - Intronic
903706298 1:25288187-25288209 TTTCTATTTTCTGCAGAGACAGG + Intronic
903721254 1:25407092-25407114 TTTCTATTTTCTGCAGAGACAGG + Intronic
905032861 1:34899539-34899561 TTCCCAGTTTCCCCAGAGCCAGG + Intronic
905522655 1:38612353-38612375 TCTCTATTGTGCCCAGCTCCTGG + Intergenic
905916319 1:41686927-41686949 TGTATATTGTGCCCAGTGCCTGG - Intronic
906801773 1:48744214-48744236 TTTCCTTTGTCCCCAGCACCTGG + Intronic
907321431 1:53605229-53605251 GTTGTAGTGGCCCCAGAGCCAGG - Intronic
911159796 1:94672654-94672676 TTTGTAAAGTACCCAGAGCCTGG + Intergenic
913446463 1:118955654-118955676 TTTCTAATGGCCCTAGAGCAGGG - Intronic
916193768 1:162204122-162204144 TTTGTATTGTCCCCAGAGCATGG - Intronic
917799944 1:178561225-178561247 TTTCTCTTGTGCCCAATGCCAGG - Intergenic
918663894 1:187123944-187123966 ATTCTATTCTCCACAGAGCATGG - Intergenic
920825789 1:209423259-209423281 TTTCTATTATCTCCAGCACCTGG + Intergenic
921122286 1:212147586-212147608 TTTCAACTGGCCCCAGGGCCTGG + Intergenic
922893789 1:229083851-229083873 TTTCTATTTTCCGTAGAGACGGG + Intergenic
923117644 1:230958293-230958315 TTTTTTTTTTTCCCAGAGCCAGG - Exonic
923147644 1:231209324-231209346 CTTCTGCTGTCCCCAAAGCCAGG + Intronic
923452083 1:234127562-234127584 TTTCTATTTTACCTAGAGCCAGG - Intronic
923781705 1:237030847-237030869 TTTGTATTTTCCCTAGAGACTGG - Intergenic
1067083053 10:43222409-43222431 TCTCTCTTGTCCCTAGAGCTGGG - Intronic
1067167446 10:43877092-43877114 TGTCTATTCTCCCCAGTTCCCGG + Intergenic
1067284188 10:44895397-44895419 TCTCTGTAGTCCCTAGAGCCCGG - Intergenic
1067713449 10:48668533-48668555 ACCCTATTGGCCCCAGAGCCAGG + Intergenic
1068154272 10:53176682-53176704 TTTTTATAGTCACCAAAGCCTGG + Intergenic
1068857504 10:61812432-61812454 TTTCTATTTTTCGCAGAGGCGGG - Intergenic
1070306881 10:75245022-75245044 TCTCTATTTGCCCCAGGGCCAGG + Intergenic
1070591901 10:77807489-77807511 TTTCTGGTGTCCCCCAAGCCAGG - Intronic
1070950627 10:80428232-80428254 TCTCTATAGGCCCAAGAGCCAGG + Intronic
1071930030 10:90458632-90458654 TCTTTATTGTCCCCAAAGCCTGG - Intergenic
1072426566 10:95335303-95335325 TTTGTATTCTGCCCAGAGGCTGG + Intronic
1072695045 10:97596875-97596897 TTTCTCTTGGTCCCAGTGCCAGG + Intronic
1072756865 10:98027252-98027274 TTTCTTCTGTTCCGAGAGCCTGG - Intronic
1072998923 10:100271036-100271058 TTTCCACCGTCCCCAGAGCGTGG + Intergenic
1073135709 10:101219004-101219026 TTTCCAGGGTCCCCAGAGCTGGG + Intergenic
1073772650 10:106752262-106752284 TTTCTTTTGTCCCCAAAAGCAGG + Intronic
1075796069 10:125120556-125120578 TTTCTATTTTCTGCAGAGACAGG + Intronic
1077536297 11:3126413-3126435 TTCCTGCTGTCCCCAGAGCCAGG + Intronic
1080404029 11:31962639-31962661 TTTCCACTGTCCTCAGACCCTGG + Intronic
1080612865 11:33919967-33919989 TCTCTGATGTCCCCAGAGTCAGG + Intergenic
1081283497 11:41240295-41240317 TTTGTATTTTCCCCAAAGCATGG - Intronic
1081572257 11:44299001-44299023 TTCCAACTTTCCCCAGAGCCTGG - Intronic
1084866737 11:72064460-72064482 TTTTTTTTTTCCCCAGAGACGGG - Intronic
1087273649 11:96138771-96138793 TTTCTATGATCCCCAGAACCTGG + Intronic
1087279101 11:96190597-96190619 TTTTTATTGGCCCCAGTTCCAGG - Intronic
1087955997 11:104288775-104288797 TTTCTATAGTCCCCATGGGCAGG - Intergenic
1088065044 11:105707145-105707167 TTTCTATTGTCATCAAAGCCAGG - Intronic
1088651716 11:111963065-111963087 TCTCTAATGTCCCCATAGCTAGG - Intronic
1090896384 11:130979696-130979718 CTTCTCTTGTCTCCAGAGACAGG - Intergenic
1090997583 11:131880810-131880832 TTTCTTTTGCCCCCAAAGCTGGG + Intronic
1091755961 12:3051809-3051831 TTTGTATTTTCCACAGAGACAGG + Intergenic
1092669597 12:10848129-10848151 CTCCTATTGTCCTCAAAGCCAGG + Intronic
1093153149 12:15647892-15647914 TTTCCATGGACCCCAGGGCCGGG + Intronic
1095884439 12:47174235-47174257 TTTGTATTTTTCCTAGAGCCAGG - Intronic
1096378915 12:51138807-51138829 TTTCTATTTTCACTAGAGACGGG + Intronic
1096529640 12:52234581-52234603 TCTCTGTGGTCCCCAGGGCCTGG + Intronic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1097175465 12:57140004-57140026 TGTCTATTGGCCCCCAAGCCTGG - Intronic
1097703427 12:62843894-62843916 TTACCTTTGTCCCCAGACCCAGG + Intronic
1098370128 12:69749875-69749897 TTTCTTCTTTCCCCAGATCCTGG + Intronic
1099610091 12:84857303-84857325 TTACTATTGTCACTAGAGCTGGG + Intergenic
1101382436 12:104225885-104225907 TTTCTATTGTTTCCAGATACTGG - Intronic
1101977284 12:109370564-109370586 TTTTTACTGTGCACAGAGCCCGG - Intronic
1102088704 12:110167855-110167877 TTTTTTTTTTCCCCAGAGACAGG + Intronic
1102271290 12:111537682-111537704 TTTCAATTTTCCCCAGCTCCAGG - Intronic
1103787574 12:123444876-123444898 TTTTTATTTCCCCCAGAGACAGG + Intergenic
1106467876 13:30028837-30028859 ATTCTATTTTAACCAGAGCCTGG - Intergenic
1106583723 13:31039001-31039023 TTTCTCTTTTCCCCAGTGGCAGG + Intergenic
1108260865 13:48654745-48654767 TTTCTAATCTCCTCAGAGTCGGG - Intronic
1111069371 13:83144030-83144052 TTTCTATTGTCACCAGTGACAGG - Intergenic
1113493593 13:110712231-110712253 TTTCTCTTTTCCGGAGAGCCGGG - Intronic
1114610981 14:24040341-24040363 TTTCTTTTCCCCCCAGAGACAGG + Intergenic
1115449365 14:33528343-33528365 TTCCTTTTGTCCCCAGAGCATGG - Intronic
1118125489 14:62898061-62898083 TTTCATTGGTCCCCAGTGCCCGG - Intronic
1118317742 14:64736269-64736291 TGTATCCTGTCCCCAGAGCCTGG + Intronic
1118807406 14:69250250-69250272 TTTCTCTTGTCCCTAGCCCCTGG + Intergenic
1118988443 14:70777000-70777022 TTTCTATTTTCAGCAGAGACAGG + Intronic
1124094116 15:26632897-26632919 TTTCTCTTGTCTCAAGAGCAGGG + Intronic
1125396441 15:39253237-39253259 TTTCTATTGTCCATATAGGCAGG + Exonic
1125503934 15:40256000-40256022 TTACCATGGTCCCCAGAGCCTGG + Intronic
1128291629 15:66482655-66482677 TCTCTCTTGTCCCTAGTGCCTGG + Intronic
1128307653 15:66610573-66610595 TTTCAATTGTCAACAGACCCAGG - Intronic
1130654132 15:85780157-85780179 TTTCTCTGGACCCCAGAGCTGGG + Intronic
1130896375 15:88173419-88173441 TTTCTATTTTCCCCATTTCCAGG - Intronic
1131295366 15:91143349-91143371 TTTCAATGGTCCCCAGACCTGGG - Intronic
1132256139 15:100378076-100378098 TTTGTATTTTCCACAGAGACAGG - Intergenic
1134045946 16:11101233-11101255 TTCCTAGTGTCCCCAGTTCCTGG + Intronic
1137866226 16:51899380-51899402 TTGTTAGTATCCCCAGAGCCTGG + Intergenic
1137887665 16:52124345-52124367 TTTCTATTTTCCCCAGAAGAAGG - Intergenic
1139966643 16:70749494-70749516 TGTCTCTGGTCCCCAGAGGCTGG + Intronic
1140772310 16:78216245-78216267 TCTTTATAATCCCCAGAGCCTGG + Intronic
1141008536 16:80375797-80375819 TTTTTTTTTACCCCAGAGCCAGG + Intergenic
1142819375 17:2453029-2453051 TTTGTATTTTCCCTAGAGACAGG + Intronic
1143699754 17:8649469-8649491 TTCCTGTTGACCCCAGAGCCAGG - Intergenic
1145122273 17:20270611-20270633 TTTTTTTTTTCCCCAGAGACAGG - Intronic
1145793929 17:27644763-27644785 TTTCTATCCTCCCCAGAGCCAGG - Intronic
1145808727 17:27752298-27752320 TTTCTATCCTCCCCAGGGCCAGG - Intergenic
1145831536 17:27920455-27920477 TTTCTATCCTCCCCAGAAACGGG + Intergenic
1146042867 17:29473462-29473484 TTTCTATTTTCAGCAGAGACGGG - Intronic
1146563976 17:33896154-33896176 TTTCTTTTTGCCTCAGAGCCTGG + Intronic
1146708570 17:35020751-35020773 TTTCTATACTCCCCAGACCTGGG + Intronic
1146835914 17:36110439-36110461 TTTTTGTTTTCCCCAGAGACAGG - Intergenic
1147339074 17:39743164-39743186 TTGCCCTTGTCCCCAGAGCGGGG + Exonic
1147795067 17:43036498-43036520 CTTCTCTTCTGCCCAGAGCCCGG + Intergenic
1148564644 17:48625791-48625813 ATTTTATTGTCCCCGTAGCCGGG + Exonic
1148731376 17:49838852-49838874 TTGCTAATGTCTCCAGAGCATGG + Intronic
1148834540 17:50458935-50458957 TGTCTAATTTCCCCAGAGACAGG + Intronic
1149373765 17:56022849-56022871 TTTCTATTGTCTTCAGAGTATGG + Intergenic
1149838344 17:59935196-59935218 TTTCTATTCTCCCCAGTGAATGG - Exonic
1151376476 17:73692235-73692257 ATTTTATTGTCTCCAGAGCTGGG - Intergenic
1152502066 17:80718865-80718887 AGTCTTTTCTCCCCAGAGCCAGG - Intronic
1152686610 17:81696808-81696830 TCTCTTTTGTCCCCAGCTCCAGG + Exonic
1155235508 18:23815114-23815136 TGTGTAATGTTCCCAGAGCCAGG + Intronic
1155590067 18:27417804-27417826 CTACTATTCTCCCCAGACCCAGG + Intergenic
1158109321 18:53922795-53922817 TTTCCATTCTCCCCAGCCCCTGG - Intergenic
1158638316 18:59180528-59180550 TTTCTATTGGCACCAGCCCCAGG + Intergenic
1159196925 18:65127916-65127938 TTTCTCCTCTCCCCAGACCCTGG + Intergenic
1160671005 19:363362-363384 TTTCTATTTTCAGCAGAGACGGG + Intronic
1161069687 19:2253850-2253872 TGTCTCTTGTCCCCTGCGCCCGG - Intronic
1162993403 19:14318044-14318066 TTTTTTTTTTCCCCAGAGACAGG - Intergenic
1163540925 19:17909699-17909721 ATCCTATTCTCCCCAGAGCCAGG + Intergenic
1164413871 19:28029581-28029603 TTTCTATTGTTCCCAGAAAGGGG - Intergenic
1165293870 19:34910225-34910247 TTTCTACAGGCCCAAGAGCCTGG - Intergenic
1167524471 19:49975111-49975133 TGTCTTCTGTCTCCAGAGCCCGG - Intergenic
926141379 2:10370532-10370554 TTTGTCTGGTCCCCAGAGCGGGG + Intronic
926657141 2:15420380-15420402 CTTCTCATTTCCCCAGAGCCTGG - Intronic
928275029 2:29892946-29892968 ATTCCATTGTGCCCAGAGCCTGG + Intronic
928526009 2:32141329-32141351 TTTATATGGTCTGCAGAGCCAGG + Intronic
929509614 2:42556480-42556502 TTTCCATTTCCCCCAGTGCCTGG + Intronic
930457343 2:51622253-51622275 TTTCCTTTTTCCCCAGACCCAGG + Intergenic
932828105 2:74959547-74959569 TTTCTGTTGGCCACAGTGCCAGG + Intronic
933188684 2:79308215-79308237 TTTCTATTTTCTGCAGAGACAGG + Intronic
935456195 2:103270149-103270171 TTTCTATTGTCACCACAGATGGG + Intergenic
935693368 2:105749753-105749775 TCTCTCTTGTCCCCACATCCTGG + Intronic
936959997 2:118062961-118062983 TTCATAGTATCCCCAGAGCCTGG + Intergenic
937104013 2:119293757-119293779 TTTCTTTTACCCCCACAGCCAGG - Intergenic
938738535 2:134208875-134208897 TATTTATTTTCCCCAGAGGCTGG - Intronic
941162522 2:162052145-162052167 TTTCTATTGTTAGCAGAGACAGG - Intronic
942087642 2:172458125-172458147 TTGGTATTTTCCCCACAGCCAGG - Intronic
942454690 2:176129876-176129898 TTTCTTTTCCCTCCAGAGCCGGG + Exonic
942642513 2:178074638-178074660 CTTCTTTTGTCCCCAGAGCCTGG - Intronic
942649540 2:178152126-178152148 TTTCATTTGTCCCCAGAGGTTGG + Intergenic
944241167 2:197486399-197486421 TTTCTATTTTCCCCGGTGCAAGG - Intergenic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
944424282 2:199563294-199563316 TTTTTGTTCTCCCCAGACCCTGG + Intergenic
944458572 2:199920281-199920303 TTTCCATTGTTCCCAGATCTGGG + Intronic
1169297312 20:4411358-4411380 TTTGCCTTTTCCCCAGAGCCTGG + Intergenic
1171116367 20:22528129-22528151 TTTGAACTGTCCACAGAGCCAGG + Intergenic
1171192711 20:23170523-23170545 CTTCTGTTGGTCCCAGAGCCAGG - Intergenic
1171418575 20:25000760-25000782 TCTCTGTTGTTCCCAGATCCTGG - Intergenic
1172771654 20:37385729-37385751 TTTGTTTTGTTTCCAGAGCCAGG - Intronic
1173404236 20:42751352-42751374 TTTCCTTTGTCCCCAGACCCGGG + Intronic
1174437073 20:50516317-50516339 TTTCTAGTGTCCCCTGTGTCTGG + Intronic
1175182988 20:57161589-57161611 TTCCTCCTGACCCCAGAGCCTGG + Intergenic
1175322290 20:58097601-58097623 CTTTTCTTGTCCACAGAGCCTGG - Intergenic
1175473471 20:59251272-59251294 TTTCTGGTGTCACCACAGCCTGG - Intronic
1175534749 20:59701446-59701468 TAACTAGTGTCCCCAGAGACTGG - Intronic
1175546266 20:59780039-59780061 TTTCTACTGCGCCCAGAGCTGGG - Intronic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1178064853 21:28893549-28893571 TTACTCTTCTCCCCACAGCCTGG + Intergenic
1178711812 21:34923926-34923948 CTTCTATAGTCCCCAGTGCCAGG + Intronic
1179717933 21:43299594-43299616 TGTCCAGTGTCCTCAGAGCCCGG + Intergenic
1179901738 21:44397731-44397753 CTCCTCTGGTCCCCAGAGCCAGG + Exonic
1179939767 21:44629802-44629824 ATCCTGTTGTCCCCAGTGCCTGG + Intronic
1180665129 22:17504840-17504862 TTTCTAGGGTCCCAAGGGCCAGG + Exonic
1181002151 22:19992860-19992882 CATCTTTAGTCCCCAGAGCCAGG - Intronic
1181341565 22:22184306-22184328 TTTCTAGTTTCCCTAGATCCAGG - Intergenic
1181998455 22:26901707-26901729 TTTGTATTTTCCGCAGAGGCAGG - Intergenic
1182112140 22:27731399-27731421 GTTCTGTGATCCCCAGAGCCTGG - Intergenic
1184292155 22:43503148-43503170 TTGCTTCTGTCCCCAGGGCCTGG + Intronic
1184687696 22:46103992-46104014 CTTCTTTTGCCCCCAGACCCGGG - Intronic
949475903 3:4445341-4445363 TTTGTTTTCTCCCCAGAGACAGG + Intronic
949831682 3:8221690-8221712 TTTGTATTTTTCCCAGAGACAGG + Intergenic
953717830 3:45331043-45331065 TTTCTAGGATTCCCAGAGCCAGG + Intergenic
954395831 3:50292765-50292787 TTCCCATGGTCCCCAGACCCAGG - Exonic
954595673 3:51821973-51821995 TTTCCATTATCCCCAGCCCCTGG + Intronic
955600198 3:60636894-60636916 TTTCTATAGAACCCAGAGTCAGG - Intronic
955626172 3:60921925-60921947 TTTCTACTGTGGGCAGAGCCTGG - Intronic
956730326 3:72190505-72190527 GTTCTGTTGTCCTCAGAGCATGG - Intergenic
956752564 3:72354953-72354975 TTACTATGGTGCCCAGACCCTGG + Intergenic
957043751 3:75358222-75358244 TTTCTATTTTCACTAGAGACCGG - Intergenic
958125997 3:89355764-89355786 TTTCTATTTCCCCCAGACACGGG - Intronic
958970281 3:100603495-100603517 TTCCTACTCTCCCCAGAGCCAGG - Intergenic
961766941 3:129218843-129218865 TTTCTTTTCTACCCTGAGCCAGG + Intergenic
963451018 3:145482217-145482239 TTTCTCTTGACTTCAGAGCCAGG - Intergenic
964793631 3:160475263-160475285 TTTCTATGATCCAAAGAGCCAGG - Intronic
967414654 3:189202728-189202750 TTTCTCTTTCCCCCAGAGCCAGG - Intronic
968849181 4:3066710-3066732 CTTCTAGTGTCCCAGGAGCCTGG + Intergenic
969834458 4:9828870-9828892 TTTCTTGTATTCCCAGAGCCCGG + Intronic
969921316 4:10542993-10543015 TGTCTTTTTTCCCCAGTGCCTGG - Intronic
971217721 4:24676403-24676425 TTATTATACTCCCCAGAGCCAGG - Intergenic
971435466 4:26618116-26618138 TTGCTATTGTGCACAGAGCCAGG + Intronic
974019555 4:56680660-56680682 TTTCTCTAAACCCCAGAGCCTGG + Intronic
974945820 4:68527754-68527776 TTTCTATTGTTCACACTGCCAGG + Intergenic
976778581 4:88733679-88733701 TTACTGCTGTCCCCAGAGCTTGG + Intronic
980561514 4:134482814-134482836 GCTCTATTGTCTCCAGAGGCAGG + Intergenic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
981886906 4:149687029-149687051 TTTCTATTGTCCACAGATAATGG + Intergenic
983222121 4:165053520-165053542 TTTGTATTTTCCACAGAGACAGG + Intergenic
983881800 4:172941209-172941231 TTAATATTGTCCCCATAGCTTGG - Intronic
986645250 5:9910692-9910714 TTGCCCTTGTCCCCTGAGCCTGG + Intergenic
987200927 5:15577309-15577331 CCTCTATTGTCCCCAGGGGCAGG + Intronic
987539348 5:19234251-19234273 TTTCAATTGTCACCAAAACCTGG - Intergenic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
989673168 5:43943715-43943737 TTTCCATCATCCCCAGAACCTGG + Intergenic
991371766 5:65926262-65926284 TCTCCGTTGCCCCCAGAGCCGGG - Intergenic
991678656 5:69115123-69115145 TTTTTTTTTTCCCCAGAGACAGG - Intronic
994868233 5:105307316-105307338 TTTGCTTTGTCTCCAGAGCCTGG - Intergenic
995180086 5:109222884-109222906 TCTCTGTTCTTCCCAGAGCCAGG - Intergenic
996160667 5:120159223-120159245 TTTCTATTATCACTAGCGCCTGG + Intergenic
998061243 5:139120300-139120322 ATGCCATTGACCCCAGAGCCTGG - Intronic
998313389 5:141157115-141157137 TTTCCATTGTTCCCGGAGTCCGG - Intergenic
998461217 5:142311508-142311530 TCTCGACTGGCCCCAGAGCCGGG + Exonic
999093974 5:148961880-148961902 TTTCTATTGACCCATGAGACAGG - Intronic
999895296 5:156026116-156026138 TTTCTATCTTCCTGAGAGCCTGG - Intronic
1000194352 5:158943377-158943399 TCTCTTGTGTCCTCAGAGCCTGG - Intronic
1000287001 5:159835413-159835435 CTTATTTTGTCCCCAGTGCCTGG - Intergenic
1000334198 5:160229780-160229802 TTCTTATTATCCTCAGAGCCTGG - Intronic
1000342101 5:160285784-160285806 TTTCTATTGCCCTCAGAGTAGGG - Intronic
1001242206 5:170079493-170079515 TTTCTATAGCCCCCAGCCCCAGG + Intronic
1002932602 6:1644707-1644729 TTTCTGGTGACCACAGAGCCAGG + Intronic
1006810665 6:36818420-36818442 TCCCTATTTTCCCCAGCGCCTGG + Intronic
1007420040 6:41713717-41713739 TTTCTATTCTCCCCAGAGCCAGG + Intronic
1007722355 6:43892530-43892552 TCTCTTTTGGCCCCAGGGCCTGG + Intergenic
1008086352 6:47248840-47248862 TCTCTCTTGCCTCCAGAGCCTGG + Intronic
1008256092 6:49302516-49302538 TGCCTATTCTCCCCAGAGTCTGG - Intergenic
1009719586 6:67450155-67450177 TTTCTTTTATTCCTAGAGCCTGG + Intergenic
1011553794 6:88553906-88553928 TTTCTAAGGTCCCAAGAGACAGG + Intergenic
1014621005 6:123666989-123667011 TTTCTTCCCTCCCCAGAGCCAGG + Intergenic
1017334257 6:153236966-153236988 TTTGGATTTTCCCCAGAGTCGGG + Intergenic
1018098293 6:160412713-160412735 TGTCTATAGTCCTCATAGCCAGG + Intronic
1018356244 6:163020898-163020920 TTGCTGTTGTCTCCAAAGCCTGG + Intronic
1019391767 7:791865-791887 TTTCTTTTTTCCTCTGAGCCAGG + Intergenic
1019593349 7:1846683-1846705 TTTCTGTTGTTCCCAGAGCGAGG + Intronic
1020863680 7:13527727-13527749 TTATTTTTGTCCTCAGAGCCTGG + Intergenic
1022448392 7:30490081-30490103 TTTCTCCTTTCCCCAGACCCTGG - Intergenic
1023819445 7:43972500-43972522 TTTCTACTCTCCCCAGAAGCCGG - Intergenic
1023955263 7:44881392-44881414 TTTCTATTGTCCCTAGTGACTGG + Exonic
1024812622 7:53231193-53231215 TTTTTTTTTTCCCCACAGCCTGG + Intergenic
1028599244 7:92583298-92583320 TTCCTCTTCTCCCCAGACCCTGG - Intronic
1029241249 7:99164773-99164795 TTTCTTCTGTCCCCAGCCCCTGG + Intergenic
1029744496 7:102509469-102509491 TTTCTACTCTCCCCAGAAGCCGG - Intronic
1029762487 7:102608631-102608653 TTTCTACTCTCCCCAGAAGCCGG - Intronic
1030204078 7:106935678-106935700 TTTCAATCATCCCCAGTGCCAGG - Intergenic
1032802482 7:135328059-135328081 TTTCTATCCTTCCCAGTGCCTGG - Intergenic
1035068439 7:156124297-156124319 TTTCTGTTGGCCCCAGAACGTGG + Intergenic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1036425307 8:8640299-8640321 TATATGTTGTCCCCAGAACCAGG + Intergenic
1036635036 8:10543352-10543374 TTTTTATAGCCCCTAGAGCCAGG + Intronic
1036660273 8:10703281-10703303 TTCCCACTGACCCCAGAGCCTGG - Intronic
1038517512 8:28199847-28199869 GTTCTTGTGTTCCCAGAGCCTGG + Intergenic
1038892708 8:31744566-31744588 TTTTGGTTGTCCCCAGAGGCTGG + Intronic
1039613109 8:38934640-38934662 TTTCTAATGTCCCCACTGGCAGG - Intronic
1039689596 8:39849922-39849944 TTTTTATTGACCCCAGAGGCAGG - Intergenic
1042085371 8:65101852-65101874 TTGCTAGTGTCCCCTGAACCTGG + Intergenic
1042505031 8:69550626-69550648 TTTCGGTTGTGCCCAGATCCCGG + Intronic
1048880995 8:138872426-138872448 TCTCTCCTGTCCCCACAGCCAGG - Intronic
1049262754 8:141648617-141648639 TTGCTATTGTCACCATAACCAGG - Intergenic
1050488333 9:6159944-6159966 TTTCTCTTGCCCCCAGCTCCTGG - Intergenic
1051897127 9:21998501-21998523 TTTCTGTTGTCCCAAAGGCCAGG + Intronic
1052959440 9:34282357-34282379 TTTCTCCTGCCCCCAGTGCCTGG - Intronic
1053091000 9:35276395-35276417 TTTCTATTGTACTCAAGGCCAGG - Intronic
1053174724 9:35914528-35914550 TTCCTATTGTCCCCAAGGGCAGG + Intergenic
1057496012 9:95561898-95561920 TTTCTACTGTCTGCAGAGCAGGG + Intergenic
1060950996 9:127602724-127602746 TTTGTATTTTTCCCAGAGACAGG + Intergenic
1061506056 9:131032402-131032424 TTCCCATTGTCCCCTCAGCCTGG + Intronic
1062135712 9:134926742-134926764 ATACTATTTTCCCCATAGCCAGG + Intergenic
1062344300 9:136107736-136107758 TCTCTCTTCTCCCCACAGCCTGG - Intergenic
1187549715 X:20290092-20290114 TTTTTTGTATCCCCAGAGCCTGG + Intergenic
1187565877 X:20449069-20449091 TATCAAGTGTCCTCAGAGCCCGG + Intergenic
1188090489 X:25958673-25958695 TTTTTTTTGCCCCCAGAGACAGG + Intergenic
1188688474 X:33099370-33099392 TTTCTATTGTCCCCAGAGCCAGG + Intronic
1192217977 X:69177238-69177260 CTTCTCTTCTCCCCAGAGCCAGG + Intergenic
1193693597 X:84679864-84679886 TGTAGATTGTCCGCAGAGCCAGG + Intergenic
1197267540 X:124391470-124391492 TTTCTATTATTCCCAGACACAGG + Intronic
1197783160 X:130176418-130176440 TTTGTCTTGTCCCCAGGGCTGGG - Intronic
1198744218 X:139873262-139873284 TTTCTTTTCTCCCCAGCCCCTGG - Intronic
1198815768 X:140588525-140588547 TTTCTTTTGTTCCCAGGGACAGG - Intergenic
1199879944 X:151965957-151965979 TTTCTACTGTCCCAAGTGGCTGG + Intronic
1200765069 Y:7073956-7073978 TTTCTAGTGCCCCCAGTTCCTGG + Intronic
1200855870 Y:7937614-7937636 TTACACTTGTCCCCAGAGCCAGG - Intergenic
1201851648 Y:18489568-18489590 TTTCTATTGTTCACATGGCCAGG + Intergenic
1201881672 Y:18830812-18830834 TTTCTATTGTTCACATGGCCAGG - Intergenic
1202263297 Y:22992348-22992370 TGACGCTTGTCCCCAGAGCCAGG + Exonic
1202346971 Y:23941398-23941420 TTTCTATTGTTCACATGGCCAGG - Intergenic
1202416287 Y:24626089-24626111 TGACGCTTGTCCCCAGAGCCAGG + Exonic
1202454500 Y:25043997-25044019 TGACGCTTGTCCCCAGAGCCAGG - Exonic
1202523800 Y:25728692-25728714 TTTCTATTGTTCACATGGCCAGG + Intergenic