ID: 1188692278

View in Genome Browser
Species Human (GRCh38)
Location X:33144839-33144861
Sequence TCTATGATGAAGGAAATGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 222}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188692278_1188692283 -8 Left 1188692278 X:33144839-33144861 CCCACCATTTCCTTCATCATAGA 0: 1
1: 0
2: 0
3: 26
4: 222
Right 1188692283 X:33144854-33144876 ATCATAGATTAAGAAAGAGTGGG 0: 1
1: 0
2: 0
3: 22
4: 241
1188692278_1188692282 -9 Left 1188692278 X:33144839-33144861 CCCACCATTTCCTTCATCATAGA 0: 1
1: 0
2: 0
3: 26
4: 222
Right 1188692282 X:33144853-33144875 CATCATAGATTAAGAAAGAGTGG 0: 1
1: 0
2: 0
3: 25
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188692278 Original CRISPR TCTATGATGAAGGAAATGGT GGG (reversed) Intronic
903117385 1:21189438-21189460 TCTATGAAGCTGGAAATGGCTGG + Intergenic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
911475130 1:98364863-98364885 TATATGATGAAGAAAAAGATGGG - Intergenic
911795546 1:102071134-102071156 TCTATGTTGTAGGATAGGGTAGG + Intergenic
911947126 1:104126058-104126080 TCTTTCATGAAGGACCTGGTAGG + Intergenic
912644929 1:111383446-111383468 CCGATGATGAAGGTGATGGTGGG + Intergenic
913153773 1:116073723-116073745 TATATTATCAAGGAAATGGGGGG - Intergenic
913357402 1:117938180-117938202 GCTGTGATGATGGAAATGATAGG + Intronic
913657673 1:120976656-120976678 GCTTTGATGAAGAAAATGGTAGG + Intergenic
914009022 1:143759738-143759760 GCTTTGACGAAGAAAATGGTAGG + Intergenic
914351901 1:146847233-146847255 TTTTTGAAGAAGGAAAAGGTGGG - Intergenic
914522238 1:148427926-148427948 GCTTTGATGAAGAAAATGGTGGG + Intergenic
914647652 1:149668390-149668412 GCTTTGATGAAGAAAATGGTAGG + Intergenic
916595513 1:166238783-166238805 TGTATGATGACAAAAATGGTTGG - Intergenic
917906491 1:179591345-179591367 TCCCTGATGAAGGAATGGGTGGG - Intergenic
920819823 1:209369941-209369963 TCTATGATGCAGAAATTGCTAGG + Intergenic
921411496 1:214841019-214841041 TATATGATGAAGGGTAGGGTAGG + Intergenic
923525556 1:234770009-234770031 TCTGTGATGAAAGAAACGGAAGG + Intergenic
923998930 1:239529038-239529060 TGGATTATGAAGGAAATGGGAGG - Intronic
924756012 1:246941676-246941698 TCTATAATGAAGGTAATGAAGGG - Intergenic
1063198101 10:3761799-3761821 ACTCTGTTGAAAGAAATGGTAGG + Intergenic
1063286429 10:4693713-4693735 CCTATGGTCAAGGAAATGCTGGG - Intergenic
1065868350 10:29933825-29933847 TCTGTGAGGAAGGGAATGGAGGG + Intergenic
1065964180 10:30757513-30757535 TCGGTGATTAAGGAAAAGGTGGG - Intergenic
1066224755 10:33371301-33371323 AGTATGATGAAGGAAATAGGTGG - Intergenic
1066540971 10:36446605-36446627 ACTATAATGATGGAAATAGTTGG + Intergenic
1067233621 10:44428332-44428354 TCTAGGAGGAAGGGAAGGGTGGG + Intergenic
1069207990 10:65717100-65717122 ACTATGATAAAGATAATGGTAGG - Intergenic
1069313234 10:67065592-67065614 TCTAACATGAAGGAAGTGGTGGG + Intronic
1076440193 10:130476324-130476346 TCAATGGTGGAGGAAGTGGTGGG - Intergenic
1078029234 11:7732329-7732351 ACACTGATGAAGGAAATTGTAGG + Intergenic
1078861998 11:15257079-15257101 TCTATCATTAAGGAAATAGCAGG - Intergenic
1079339324 11:19599013-19599035 TCCATGATGGATGAAATGGCAGG + Intronic
1081347677 11:42010464-42010486 TCTATAGTGAGGGAGATGGTGGG + Intergenic
1082236772 11:49826964-49826986 TCTATGCAAAAGAAAATGGTAGG - Intergenic
1082241926 11:49882737-49882759 TCTATGCAAAAGAAAATGGTAGG + Intergenic
1082656428 11:55863673-55863695 TCTATGCAAAAGAAAATGGTAGG + Intergenic
1085413522 11:76305859-76305881 TCCATGCTGAGGGAAGTGGTGGG + Intergenic
1085662046 11:78377249-78377271 TCCAGGATGAAGGAACTAGTAGG + Intronic
1087270937 11:96111011-96111033 TCTTTGATGGAGAAAATGATAGG - Intronic
1089551096 11:119278684-119278706 TTCATGATGAAGGAATTGGCTGG + Exonic
1090151052 11:124384627-124384649 TCTATGACGGTGGACATGGTGGG - Intergenic
1090695642 11:129238723-129238745 TCTATGATTATGCAATTGGTTGG - Intronic
1092518252 12:9238515-9238537 TCTGAGATGAAGGAAATTGAGGG + Intergenic
1092554800 12:9546022-9546044 TCTATGTTCAAGGATATGCTTGG + Intergenic
1092942390 12:13421989-13422011 TCTATGAACCAGGAAATGGTTGG + Intergenic
1094517301 12:31144608-31144630 TCTATGTTCAAGGATATGCTTGG - Intergenic
1096536831 12:52280180-52280202 ACTATGGTGGAGGAAATTGTGGG + Intronic
1097389867 12:58996991-58997013 TCACTGAAGAATGAAATGGTTGG + Intergenic
1099518272 12:83626376-83626398 GCTATGATAAAGGAAATGAGAGG - Intergenic
1100097517 12:91059869-91059891 ACCATGATGGAGGAGATGGTTGG - Intergenic
1100145829 12:91676349-91676371 TCAAAGATGAAGGAAATGCCAGG + Intergenic
1100409625 12:94302348-94302370 TTTATGATGAATGAATGGGTAGG - Intronic
1100491299 12:95081391-95081413 TCTTTGATGAAGGGTCTGGTTGG + Exonic
1101240902 12:102839103-102839125 TTTCTGATGAAAGAAATAGTTGG + Exonic
1102630126 12:114270876-114270898 TTTATTATTAAGGAAAAGGTAGG + Intergenic
1104449803 12:128859809-128859831 TCTATCATGAAGGAAATCACAGG - Intronic
1107098117 13:36558727-36558749 TTTCTGCTGAAGGAAAAGGTGGG + Intergenic
1107366671 13:39686457-39686479 TCTAAGGTGAAGGAACTGGTAGG - Intronic
1107572682 13:41679863-41679885 TCTAGGGGGCAGGAAATGGTGGG - Intronic
1108164466 13:47677630-47677652 TCTTTGATGCAGGAAATGAGTGG + Intergenic
1108317530 13:49251612-49251634 TCTATTAGGAAGGAATTGATTGG + Intronic
1111684243 13:91482344-91482366 TCCATGATCAAGGCACTGGTAGG - Intronic
1111974512 13:94951615-94951637 CCTATGATGAAGGAACTGAGTGG + Intergenic
1113406521 13:110045972-110045994 TCTGTGATGCAGGAGAAGGTGGG - Intergenic
1115886306 14:37975453-37975475 TCTATGTTTATGGAAATGGCAGG + Intronic
1116391340 14:44394335-44394357 TCTATGATTAAGAAGAGGGTAGG - Intergenic
1116994334 14:51306683-51306705 TGTATGAAGAATGAACTGGTAGG - Intergenic
1118437463 14:65784739-65784761 CCTATTAGGAAGGAAATGATTGG + Intergenic
1119568174 14:75646508-75646530 GCTGTGCTGAAGGAAAAGGTGGG - Exonic
1119633274 14:76252823-76252845 CCTATGATCAAGGAAGAGGTAGG - Intronic
1119687233 14:76642568-76642590 TCTATGAAGAAGGATCAGGTTGG - Intergenic
1121819126 14:96951683-96951705 GCCGTGATGAAGGAAATGGATGG + Intergenic
1123838119 15:24217212-24217234 ACTATGACAAAGGAAATGTTGGG - Intergenic
1126495883 15:49290183-49290205 TTTCAGATGAAGGAAATGGGTGG - Intronic
1131567728 15:93502246-93502268 CCTATTATATAGGAAATGGTAGG + Intergenic
1133468610 16:6052210-6052232 CCTACTATGAAGGAAATGGAAGG - Intronic
1135874194 16:26182358-26182380 TGTGGGATGAAGGCAATGGTGGG + Intergenic
1136669978 16:31847514-31847536 TTTATTAGGAAGGAAATGGAGGG + Intergenic
1136987444 16:35122420-35122442 TGTATTAAGAAGGAAATGGAGGG + Intergenic
1137355146 16:47755200-47755222 GATAGGATGAAAGAAATGGTTGG - Intergenic
1137643617 16:50055540-50055562 TCTTTAATGAAGGAACTGGGAGG + Intergenic
1137902838 16:52287587-52287609 TCTATGATCAAGGAAAAGATTGG + Intergenic
1138403184 16:56765895-56765917 TCCATGATAAGGGAAAAGGTAGG + Intronic
1139147020 16:64337568-64337590 CCTATAATGAAGACAATGGTGGG + Intergenic
1139475663 16:67201428-67201450 TCTATAAGGTAGGAAGTGGTGGG + Exonic
1139982132 16:70868303-70868325 TTTTTGAAGAAGGAAAAGGTGGG + Intronic
1143912706 17:10265130-10265152 TCAGTGATGAAGCAAACGGTCGG - Intergenic
1145071535 17:19813199-19813221 TCTTTGATGAATGATATGGCGGG - Intronic
1146363818 17:32202503-32202525 TTTATGATGAAATAAATGTTTGG + Intronic
1147553046 17:41458447-41458469 TCTATCCTGAAGGCAATGGGAGG - Intergenic
1147937557 17:44021697-44021719 GTTCTGATGAAGGAAGTGGTGGG - Intronic
1154040334 18:10848846-10848868 ATTATGATGAAGGAAATCATAGG + Intronic
1155909820 18:31494744-31494766 TTTCTGATGAAGGAAGGGGTGGG + Intergenic
1156246712 18:35307075-35307097 TCTCTGATGAAGAATAAGGTTGG - Intergenic
1156639037 18:39067810-39067832 TCTAATATGAAGGAAAATGTTGG + Intergenic
1158794900 18:60833097-60833119 TCCATGTTGTAGCAAATGGTAGG - Intergenic
1159101390 18:63962845-63962867 TCTGTGTTGAAGGAGATGGAGGG + Intronic
1163790180 19:19301854-19301876 TTTATGATGAGGGAAATGGCAGG - Intronic
1163871560 19:19825461-19825483 TTTATGATGAAGGAAGGGGTGGG + Intergenic
1163885487 19:19961223-19961245 TTTCTGATGAAGGAAGGGGTGGG + Intergenic
1163888905 19:19993624-19993646 TTTCTGATGAAGGAAGGGGTGGG - Intergenic
1163907923 19:20163171-20163193 TTTCTGATGAAGGAAGGGGTGGG + Intergenic
1163935053 19:20434979-20435001 TTCCTGATGAAGGAAGTGGTGGG + Intergenic
1163968857 19:20773353-20773375 TTTCTGATGAAGGAAGGGGTGGG - Intronic
1164127056 19:22328015-22328037 AATGTGATGAATGAAATGGTTGG - Intergenic
1164785390 19:30926442-30926464 TCTAGGATGAAGGAGTTTGTTGG + Intergenic
1167134347 19:47608409-47608431 TCGAGGATGAAGGAAATGGAGGG - Intronic
1167959383 19:53094186-53094208 TTTATGTTTAAGGGAATGGTTGG + Intronic
925519465 2:4725943-4725965 TCTATATTTAAGGAAATGATAGG - Intergenic
927749696 2:25656559-25656581 ATTATGAGGAAGGAAATGGCAGG - Intronic
929846211 2:45530979-45531001 TCTGTGATGAAGAAAGTGGGTGG - Intronic
930744106 2:54863196-54863218 TCTGTATTGAAGTAAATGGTTGG + Intronic
931825398 2:65995268-65995290 ACTAAGAGGAAGGAGATGGTTGG - Intergenic
933125969 2:78606286-78606308 TCTATCATTCAGAAAATGGTAGG - Intergenic
935132613 2:100271905-100271927 TCTGTGATGACGGACATTGTTGG - Intergenic
935685500 2:105679368-105679390 TCCAGGATGCAGGGAATGGTGGG - Intergenic
935948489 2:108307475-108307497 TCTATCATTAAGGGAATAGTTGG - Intronic
936381116 2:111987011-111987033 TCTGAGATGAAGGAAATTGAAGG - Intronic
938794700 2:134707678-134707700 ACTGTGATGAAGGAAATTGGCGG + Intronic
938841016 2:135163592-135163614 TCTCAGATGAAGCAAATGATTGG + Intronic
939438715 2:142213446-142213468 TCAAAGATGAAGGAAAGGATGGG - Intergenic
939774008 2:146361823-146361845 TCTATGGTGTAGGTAATGTTTGG - Intergenic
941253897 2:163203229-163203251 TCTATGACAGTGGAAATGGTAGG - Intergenic
941270902 2:163427173-163427195 GGTCTGATGTAGGAAATGGTTGG + Intergenic
941645171 2:168032471-168032493 ACCATTATGAAGGAAATTGTTGG - Intronic
942529081 2:176888997-176889019 TCTATGAATAAGGAAATGCCTGG - Intergenic
943903187 2:193467537-193467559 TCTGTGATGATGGAAATATTAGG + Intergenic
944390539 2:199214257-199214279 TCTATGTTGTTGCAAATGGTAGG - Intergenic
947222981 2:227812236-227812258 TCTAGGATAAAGCATATGGTAGG - Intergenic
1169504734 20:6197183-6197205 TCTATGTTGTTGCAAATGGTAGG + Intergenic
1170903206 20:20486252-20486274 TTTATGATGAAGGAAAGGCAAGG + Intronic
1174786671 20:53439061-53439083 TTTATGATGAACAAAATGCTAGG - Intronic
1174927574 20:54777595-54777617 TCTAAGATCAAGGTACTGGTTGG + Intergenic
1175016196 20:55793415-55793437 ACTATGAAGAAGCAAATAGTAGG + Intergenic
1175616087 20:60399526-60399548 TCTGTGGGGATGGAAATGGTCGG - Intergenic
1176961558 21:15164578-15164600 TCTGTGTTGTAGGAAATGGCAGG + Intergenic
1178747076 21:35263122-35263144 TTTATGATGAAGAAGATGGGAGG - Intronic
1179380610 21:40895700-40895722 TACAGGAAGAAGGAAATGGTAGG + Intergenic
951586897 3:24224143-24224165 ACTATGTTAAAGGAAATGATGGG - Intronic
951701318 3:25499695-25499717 TCATTGATGAAGGGAATAGTAGG + Intronic
953824519 3:46239426-46239448 GCTAAGATGAAGCACATGGTAGG - Intronic
954269148 3:49493857-49493879 TCTATGACCAGTGAAATGGTGGG - Intronic
956531596 3:70226010-70226032 TCTATATTGAAGAATATGGTAGG + Intergenic
956910731 3:73813962-73813984 TCTCTGATGGAGCAAATGGGGGG + Intergenic
957735350 3:84195877-84195899 TCAATGATGCAAGAAATGGGAGG + Intergenic
957832062 3:85534405-85534427 TCTCTGATGATGGAAATAGTTGG - Intronic
958415882 3:93872129-93872151 TCTAGAATTAAGGAACTGGTGGG - Intergenic
962613539 3:137102087-137102109 TCCAAGATGAAGGAATTGGTGGG - Intergenic
964309067 3:155372954-155372976 TCTCTGATGAAGGACATACTGGG + Intergenic
965187098 3:165478686-165478708 TTCATGAGGAAGGAGATGGTTGG + Intergenic
970247974 4:14083490-14083512 TCCATGATGATGAAAATTGTTGG + Intergenic
971002445 4:22338266-22338288 GTTCTGATGAAGGAAACGGTGGG - Intergenic
972949861 4:44305800-44305822 TTTATGATCCAGTAAATGGTTGG - Intronic
973106063 4:46339315-46339337 TCTGTGATAATGGAAATGTTCGG - Intronic
974439115 4:61894306-61894328 TCCATGGTATAGGAAATGGTGGG + Intronic
974679948 4:65147539-65147561 TCTCAGATGGAGGAAATTGTTGG - Intergenic
974709301 4:65568926-65568948 TCTATGATAAAGGAAAATATTGG - Intronic
974881446 4:67762962-67762984 TCTATGTTGACACAAATGGTGGG + Intergenic
976082256 4:81368570-81368592 TCTTTGATGCATGAAATGGTTGG + Intergenic
976425716 4:84900972-84900994 TCTAAGATCAAGGCAATGGCCGG + Intronic
977801721 4:101242563-101242585 TCCATGATGCAGGATATGGGTGG - Intronic
978299965 4:107256935-107256957 TCTATTATTAAAGAAATGCTGGG + Intronic
979937149 4:126711999-126712021 TCTATTATGTAAGAATTGGTTGG - Intergenic
982971326 4:161991795-161991817 GCTATGATGAAGGAAAAAGAAGG + Intronic
986112469 5:4733597-4733619 TCTCTGCTGTAGGACATGGTGGG + Intergenic
986925860 5:12749659-12749681 TCTTTTATGAAGGACATGGCAGG + Intergenic
988286761 5:29228643-29228665 TCAATGATGGAGGACATGCTGGG - Intergenic
989272460 5:39549165-39549187 TCAATGAGGATGGAAATTGTAGG + Intergenic
989424013 5:41274793-41274815 TCAATGATGAAGGGAAAGGTAGG - Intergenic
989719890 5:44512951-44512973 TCAATGCTGAAGGAAATGTATGG + Intergenic
990874498 5:60468926-60468948 TTGAAGATGCAGGAAATGGTGGG - Intronic
991985458 5:72281329-72281351 TTTATGAGGGAGGAAATGGATGG + Intronic
992698558 5:79315751-79315773 TCTCTCATGTAGGAAATGATAGG + Intronic
993127173 5:83850020-83850042 TCTATGAGGAAGGAAATGAATGG + Intergenic
994801209 5:104379302-104379324 TCAATAATTAAGTAAATGGTTGG + Intergenic
995716434 5:115085684-115085706 TCTTTGATGAATGATCTGGTAGG - Intergenic
996863814 5:128094940-128094962 TCTGTGATGATGGAAATCTTTGG - Intronic
998022163 5:138778830-138778852 TCTCTGAAGAAGGCAGTGGTTGG + Intronic
1001224521 5:169932319-169932341 TCTAAGAGGTAGGAAGTGGTTGG + Intronic
1003049787 6:2769075-2769097 TATCTGATAAATGAAATGGTTGG + Intronic
1003408784 6:5845193-5845215 TCTATTAACAAGGAAATGGAGGG + Intergenic
1006356459 6:33561558-33561580 TCTATTATGAAAGAAATTGCCGG - Intergenic
1008916780 6:56796594-56796616 TCTAGGATGCAGGCAATGGTTGG + Intronic
1010702900 6:79073288-79073310 TATATGATGAATAAAATGTTAGG - Intronic
1010885172 6:81228071-81228093 TCTATCAACAGGGAAATGGTTGG - Intergenic
1012383249 6:98646001-98646023 TCTATGAAGAATGAAATTGTTGG - Intergenic
1013711218 6:112901545-112901567 TCTATAATGAATGAAAATGTAGG + Intergenic
1015631860 6:135239266-135239288 TCTAAGAGAAAGGAAATGGGAGG + Intergenic
1015862206 6:137692727-137692749 AGGATGATGAAGGATATGGTAGG - Intergenic
1016462754 6:144295469-144295491 TGTTTGATGAATGAAATAGTTGG + Intronic
1017808378 6:157966277-157966299 TATATGATGAAGCAAAATGTAGG + Intergenic
1018444811 6:163846020-163846042 TCCATGCTGTAGGAAATGGAAGG + Intergenic
1021005417 7:15388900-15388922 ACTATGCTGAAGGAAATGTGAGG + Intronic
1021439769 7:20664724-20664746 TAAATGATGAAGTAAATGGTGGG - Intronic
1022223073 7:28333700-28333722 TCTATGTTGTTGCAAATGGTAGG + Intronic
1023919580 7:44617227-44617249 TCTATGACTAAAGAAATGGTTGG - Intronic
1023933991 7:44726096-44726118 TGTTTGATAAAGGAGATGGTTGG - Intergenic
1024554736 7:50593536-50593558 TCCATGATGAAGCAACTGTTGGG + Intronic
1024839157 7:53564280-53564302 TCTATAATGCAGCAATTGGTTGG + Intergenic
1030236165 7:107264811-107264833 TCTAAGAATAAGGGAATGGTTGG + Intronic
1031672549 7:124567817-124567839 CCTGTGATGATGGAAATGTTTGG - Intergenic
1033491542 7:141848263-141848285 TCCATGCTGGAGGACATGGTTGG - Intergenic
1033515430 7:142100834-142100856 TGGATGATGAAGGAACTGCTGGG + Exonic
1034230878 7:149527528-149527550 TCTATGAACATGCAAATGGTGGG + Intergenic
1034816061 7:154172992-154173014 TGTAACATGAAGGGAATGGTAGG + Intronic
1037030824 8:14102467-14102489 TCCATGATCAAGGATCTGGTGGG + Exonic
1037347035 8:17912071-17912093 TCTATGTTACAAGAAATGGTGGG - Intergenic
1037379179 8:18266046-18266068 TGTAAGATGAAGGAAAAGTTGGG - Intergenic
1037487191 8:19358728-19358750 GCTCTGATGAAGGAATTGGTGGG + Intronic
1040490666 8:47918803-47918825 ACTAGGATGAAAGAAATGATGGG + Intronic
1040656089 8:49509973-49509995 TCTATGATAGAGCAAATGTTGGG - Intergenic
1042497886 8:69475909-69475931 TCTCAGATTAAGAAAATGGTTGG + Intronic
1043969889 8:86517046-86517068 TGTAGGCTGAAGGTAATGGTGGG - Intronic
1044516476 8:93144602-93144624 TCTATGTTGCTGTAAATGGTAGG - Intronic
1044519294 8:93179100-93179122 TCTAGGATGATGGAAGTGGATGG + Intergenic
1046550208 8:115706531-115706553 TCTTTGAAGAAGGAAATTGTTGG - Intronic
1046976209 8:120280923-120280945 TTTAAGATGATGGAAATGTTTGG + Exonic
1047117699 8:121862800-121862822 TATAGGATGTAGGGAATGGTAGG + Intergenic
1047190194 8:122672096-122672118 TCTAGGAAGCAGGAAATGCTGGG + Intergenic
1048721526 8:137331072-137331094 TGAATGAGGAAGAAAATGGTAGG + Intergenic
1049304722 8:141894990-141895012 TTTATGACCAAGGAAATGATGGG + Intergenic
1050060262 9:1701391-1701413 TCTAAGATCAAGGCAATGGTAGG - Intergenic
1051729754 9:20128143-20128165 TTTATGGTGAAAGAAAGGGTAGG + Intergenic
1051895537 9:21983795-21983817 ATTATGATTAAGGATATGGTTGG - Intronic
1051909745 9:22139663-22139685 TCTATTATCAAGGAAATGCTAGG + Intergenic
1052203328 9:25808690-25808712 TTTATGATGAAGAAAATAGGAGG + Intergenic
1053240677 9:36492331-36492353 GCTATTATGAAGAAAAAGGTAGG - Intergenic
1055748741 9:79480221-79480243 TATAGGATGAAGGAAATGGGTGG + Intergenic
1058792399 9:108463258-108463280 TCCATGTTGCAGTAAATGGTAGG - Intergenic
1059141830 9:111860484-111860506 TCCATGATGTGGCAAATGGTAGG + Intergenic
1059359941 9:113734344-113734366 TCCATGAGGAAGGAAATGGGAGG + Intergenic
1059627512 9:116083127-116083149 TCCATGATGGAGGAAAGTGTAGG - Intergenic
1059963786 9:119593423-119593445 TCTAAAATGAAGGTATTGGTAGG - Intergenic
1060214562 9:121730970-121730992 TCTCTGAAGAAGGATATGCTTGG + Intronic
1185980662 X:4774480-4774502 TTTCTGATGAAGGAAGGGGTGGG - Intergenic
1188692278 X:33144839-33144861 TCTATGATGAAGGAAATGGTGGG - Intronic
1189828759 X:44948582-44948604 TGTACTGTGAAGGAAATGGTGGG + Intronic
1190949342 X:55127564-55127586 TCTTTTGTGAAGGCAATGGTCGG - Intronic
1192458448 X:71297212-71297234 TCTGTGGAGAAGGAAATGATAGG + Intronic
1193798024 X:85900200-85900222 TCTATGTTGTTGCAAATGGTAGG - Intronic
1194740741 X:97571137-97571159 TATATGATGAAGGTAATAATAGG + Intronic
1194892688 X:99399302-99399324 ACTCTGGTGGAGGAAATGGTGGG + Intergenic
1197919246 X:131573304-131573326 TTTACTTTGAAGGAAATGGTAGG + Intergenic
1199363062 X:146944713-146944735 TCTGTCATGAAGGCAATGGAAGG + Intergenic
1199412702 X:147543159-147543181 AATATAATGAAGGAATTGGTAGG + Intergenic
1199951841 X:152714096-152714118 TGTTTGATGAAGGAATGGGTGGG - Intergenic
1199957842 X:152754352-152754374 TGTTTGATGAAGGAATGGGTGGG + Intergenic
1201748189 Y:17403407-17403429 TTTCTGATGAAGGAAAGGGTGGG + Intergenic