ID: 1188694481

View in Genome Browser
Species Human (GRCh38)
Location X:33173361-33173383
Sequence GTTTATGTATTTTCATCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 477
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 446}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188694481 Original CRISPR GTTTATGTATTTTCATCAAA AGG Intronic
900821546 1:4893326-4893348 ATTTATGTATTTTTTTCAGATGG - Intergenic
902499893 1:16903474-16903496 GTATATGTATATGCAACAAAAGG - Intronic
903101225 1:21031418-21031440 GTTTATGCATTTTCGGCACAAGG + Intronic
903518322 1:23927743-23927765 GATTATGCATTTACTTCAAAGGG + Intergenic
905501183 1:38438905-38438927 GTTTAAGTATTTCAATTAAAAGG - Intergenic
905591053 1:39164092-39164114 TTTTATGGAATTCCATCAAATGG + Intronic
906661739 1:47587878-47587900 GTTTATTTTTTTCCATCATAGGG - Intergenic
906860274 1:49351957-49351979 ATTTGTGTTTTTTCATTAAAAGG + Intronic
908990711 1:70085231-70085253 CCTTTTGTATTTTCATCAAAGGG + Intronic
909315813 1:74216781-74216803 GTTTAAGCATTTTCCTGAAATGG + Intronic
909409774 1:75336530-75336552 GTTTACGTATTTAAAACAAAAGG + Intronic
910251641 1:85203555-85203577 GTTTATGAATTTTCTTGTAAAGG - Intergenic
910424462 1:87105667-87105689 TTTTATGTATTTGGACCAAAAGG + Exonic
910665571 1:89722703-89722725 ATTTATGTACTTTGATCAGACGG + Intronic
911552707 1:99303710-99303732 GTTTTTTTATTTTCATAAACAGG + Intronic
911768197 1:101704677-101704699 TGTTATGTTTTTTCATAAAAAGG - Intergenic
912275850 1:108257622-108257644 ATGTATGTACTTTCAACAAATGG - Intergenic
913970700 1:143413560-143413582 GTTGTTGTATTTTCATTAAGGGG - Intergenic
914004647 1:143721631-143721653 ATTTATGTATATGCAACAAAAGG + Intergenic
914065077 1:144239171-144239193 GTTGTTGTATTTTCATTAAGGGG - Intergenic
914096463 1:144548216-144548238 ATTTATGTATATGCAACAAAAGG + Intergenic
914114074 1:144727183-144727205 GTTGTTGTATTTTCATTAAGGGG + Intergenic
914302047 1:146385724-146385746 ATTTATGTATATGCAACAAAAGG - Intergenic
916728561 1:167545633-167545655 TTTTTTGTATTTTCATAAAGAGG - Intronic
917731399 1:177878469-177878491 GTTTATTTATTTTCTACAGAAGG - Intergenic
918691854 1:187490683-187490705 GTTTATGTATATACATACAATGG + Intergenic
919042218 1:192404069-192404091 GTGTATATAATTTCTTCAAATGG - Intergenic
919668763 1:200319452-200319474 GTTTATGCTTTTTCTTCCAAAGG - Intergenic
919783693 1:201241282-201241304 GTTTATCAATTTTAATGAAAGGG - Intergenic
919799160 1:201342416-201342438 TTTTATAGCTTTTCATCAAAGGG - Intergenic
920317539 1:205088935-205088957 GGTTATGTATTTTCTTAAAAAGG - Intronic
920997282 1:211006914-211006936 GTTTATATATTTTATTAAAATGG - Intronic
921830410 1:219722653-219722675 TTTTATGTGTTTTCATCCATGGG + Intronic
923162687 1:231330216-231330238 GTTTATTTATTTTCATAGTATGG - Intergenic
924657164 1:245983255-245983277 ATAAATGCATTTTCATCAAAAGG + Intronic
1063107915 10:3009716-3009738 GTATTTGTACTTTCCTCAAATGG + Intergenic
1065507742 10:26446321-26446343 GTTTATGAAATTTAATCAGAAGG - Intronic
1065564711 10:26997053-26997075 GTATATTTTTTTTTATCAAAAGG - Intronic
1066181783 10:32969311-32969333 GTTTATACATTTTCATAATATGG + Intronic
1066788914 10:39041524-39041546 GTTTATGTACTTTCAACGAATGG + Intergenic
1066803181 10:39212841-39212863 GTTTCTGTATATTCTGCAAATGG - Intergenic
1066804018 10:39224989-39225011 GTTTTTGTAGAATCATCAAAGGG + Intergenic
1066807179 10:39269988-39270010 GTTTTTGTAGACTCATCAAAAGG - Intergenic
1066807384 10:39273374-39273396 GTTTTTGTAGTATCTTCAAAGGG - Intergenic
1067988846 10:51185900-51185922 GTTTATGAATTTTTATCCTAAGG - Intronic
1068400600 10:56522316-56522338 GTTTATATATTAACACCAAAGGG + Intergenic
1068708816 10:60108915-60108937 GTTTATGTCTCTTTACCAAACGG + Exonic
1069230141 10:65998372-65998394 GTTTATTTTTTTTCAAAAAAGGG - Intronic
1070220718 10:74441126-74441148 GTATATGTGTTTTCATAAAGTGG - Intronic
1070408587 10:76118543-76118565 GTGTATGTATTAGCCTCAAATGG - Intronic
1071316844 10:84409510-84409532 GTGTTTTTATTTTCATAAAATGG + Intronic
1071324363 10:84497417-84497439 GTTTATGTATTTATTTCACAAGG + Intronic
1071332640 10:84575115-84575137 ATTTATGTAGCTTCAGCAAAGGG + Intergenic
1073643547 10:105276775-105276797 CTTTATTTATGTTCATCTAATGG + Intergenic
1074934290 10:118162602-118162624 GTTTATTTATTGACATTAAATGG + Intergenic
1078835322 11:15022881-15022903 GTTTTTGTAGTTTACTCAAAAGG + Intronic
1079521566 11:21333569-21333591 GTGTATTTAGTTTCATCACATGG + Intronic
1080407598 11:31993661-31993683 GTATGAGTATTTACATCAAATGG + Intronic
1080408662 11:32002623-32002645 GGTTATGTAATTTCATGAGATGG - Intronic
1081152197 11:39647107-39647129 CTTTAGGTATTTTCATCAAAGGG - Intergenic
1081308560 11:41543247-41543269 GTTTTTCTATTTTCATTATAAGG + Intergenic
1082145607 11:48664318-48664340 GTTTTTGTACTTTCTGCAAATGG + Intergenic
1082145647 11:48664833-48664855 GTTTTTGTACTTTCTGCAAATGG + Intergenic
1082265555 11:50113929-50113951 GTTTTTGTAGTATCTTCAAAGGG - Intergenic
1082290534 11:50364640-50364662 GTTTTTGTAGTATCTTCAAAGGG + Intergenic
1082291572 11:50380383-50380405 GTTTTTGTACAATCATCAAAAGG + Intergenic
1082298977 11:50481793-50481815 GTTTTTGTATATTCTGCAAAGGG - Intergenic
1082299165 11:50484874-50484896 GTTTTTGTCATTTCTTCAAATGG - Intergenic
1082306156 11:50578434-50578456 GTTTATGTAGAATCTTCAAAGGG - Intergenic
1082310649 11:50643459-50643481 GTTTATGTATAATCTGCAAAAGG + Intergenic
1082575165 11:54794328-54794350 GTTTATGTAGACTCTTCAAAGGG - Intergenic
1082577379 11:54825004-54825026 GTTTTTGCAGTATCATCAAAGGG + Intergenic
1082595506 11:55075344-55075366 GTTTTTGTCCTTTCAGCAAATGG + Intergenic
1082596909 11:55093402-55093424 GTTTTTGTATAATCAGCAAAGGG - Intergenic
1082628383 11:55512091-55512113 TTTTATTTATTCTCAACAAAAGG + Intergenic
1083118388 11:60486906-60486928 GTATTTATATTTTCATGAAATGG - Intergenic
1083168508 11:60906954-60906976 GTTTCTGTATTTTCTTCACCAGG - Intergenic
1087536805 11:99457796-99457818 TTTTATGTATTTTTTTTAAATGG + Intronic
1087565112 11:99845753-99845775 CTTTATCTACTTTCATGAAAAGG - Intronic
1087940134 11:104086725-104086747 GTTTATGTATTATGCTCTAAGGG - Intronic
1088151004 11:106745207-106745229 GTTTCTGTATTTTTATTTAATGG + Intronic
1088483345 11:110317429-110317451 CTTTGTATATTTTCATAAAATGG - Intergenic
1088577645 11:111287182-111287204 TTTTCTGTATTTTCTTTAAAGGG - Intergenic
1089891089 11:121881708-121881730 GCTTAAGTATTTTCAAGAAAGGG + Intergenic
1089942172 11:122430376-122430398 TTTTATTTATTTTCATAAATAGG - Intergenic
1090978980 11:131700259-131700281 GTTTCTGAAGTTTCAACAAAAGG - Intronic
1091120324 11:133052105-133052127 TTTGGTGTATTTTAATCAAAGGG - Intronic
1091147979 11:133297266-133297288 GATTATCTATTTTAAGCAAAGGG + Intronic
1091891908 12:4062955-4062977 GTTGGTGTATATTCATAAAATGG - Intergenic
1091958412 12:4668886-4668908 TTTTATGTAATTACATCAGAAGG + Intronic
1092643927 12:10549052-10549074 GTTTTTCTAGTTTCATGAAATGG - Intergenic
1092731149 12:11535882-11535904 GTTTATGTAATTTCAGCGGAGGG + Intergenic
1093533104 12:20190490-20190512 GTTTTTGTATTTTAAAAAAAAGG + Intergenic
1093542480 12:20304298-20304320 GTTTATTTATTTTTTTGAAAGGG - Intergenic
1094301993 12:28974620-28974642 TTTTTTTTTTTTTCATCAAAAGG + Intergenic
1094370376 12:29731180-29731202 GTTTATTTATTTATATAAAAAGG + Intronic
1094485158 12:30919867-30919889 CGTTAAGTATTTTCAGCAAAAGG + Intergenic
1094859111 12:34439940-34439962 GTTTTTGTCTCTTCTTCAAATGG - Intergenic
1094877122 12:34661611-34661633 GTTTTTGTATTATCTGCAAAGGG + Intergenic
1095246315 12:39927151-39927173 GTTCATGTATCATAATCAAATGG + Intronic
1095362068 12:41354350-41354372 ACTTATGTATTTGCATCAGAGGG + Intronic
1095828338 12:46554610-46554632 GTTTATTTTCTTGCATCAAAAGG + Intergenic
1097532551 12:60822884-60822906 GTTTGTTTAATTTCATAAAAGGG + Intergenic
1098688773 12:73460205-73460227 GTTTATGTATCTGCAACCAATGG + Intergenic
1099355017 12:81623150-81623172 ATGTATCTATTTTAATCAAATGG + Intronic
1099666598 12:85638454-85638476 TTTTTTTTATTTTCATAAAAGGG + Intergenic
1099900566 12:88706168-88706190 GTTAATTTATTATCATCAAGTGG - Intergenic
1100004923 12:89883433-89883455 GTTTACGCATTTTATTCAAAAGG - Intergenic
1100758486 12:97778543-97778565 GATTATGTATGTCCCTCAAAGGG + Intergenic
1102743112 12:115225360-115225382 ATTTATGTATTTTCAAAATAAGG - Intergenic
1107917325 13:45166140-45166162 GGTTATGTATTTTTCTAAAAAGG - Intronic
1109684618 13:65800990-65801012 GTCTAAGTTTTTTCATCAAATGG + Intergenic
1110580315 13:77114318-77114340 TATTAAGTATTTGCATCAAAAGG + Intronic
1111776162 13:92665057-92665079 GTATCTATATTTTCATCATATGG - Intronic
1112085123 13:96022219-96022241 TGTAATTTATTTTCATCAAAAGG - Intronic
1112889835 13:104215717-104215739 TTTAATCTATTTTTATCAAAAGG + Intergenic
1113258231 13:108530926-108530948 GTTTATGGTTTTTTTTCAAATGG + Intergenic
1113972987 13:114204540-114204562 ATCAATGTATTTTCAACAAAGGG + Intergenic
1114360246 14:21963990-21964012 GTGTATGAGTTTCCATCAAATGG - Intergenic
1114701498 14:24682922-24682944 TTTTATAAATTTTCATTAAAGGG - Intergenic
1115025641 14:28742180-28742202 CTTTATTTATTTTCTTTAAAAGG - Intergenic
1115878427 14:37888193-37888215 GTCTGTGTATTTTCATAAAAGGG + Intronic
1116208532 14:41903547-41903569 GTTTAAATATTTTTATAAAATGG + Intronic
1117205908 14:53443460-53443482 GTTTATTTCTCTTCCTCAAAAGG + Intergenic
1120381458 14:83785472-83785494 TTTTATTTATTTTCATGAAAAGG + Intergenic
1121295549 14:92818815-92818837 GTTTCTATATTTTCCCCAAATGG - Intronic
1121399461 14:93659907-93659929 GAATATGTTTTTTCATTAAATGG - Intronic
1121807554 14:96843749-96843771 GTTAAGGTATTTTCTTCAACAGG + Intronic
1124268217 15:28256434-28256456 GTTTATGTATTTTTAAAAACTGG + Intronic
1124437249 15:29661087-29661109 GTTTACTAATTTTCATTAAATGG - Intergenic
1125444718 15:39741702-39741724 GTTCATGTAATTTAATCCAAAGG - Intronic
1127026981 15:54817423-54817445 ATTTATGTATTTTTATTACAAGG - Intergenic
1127207597 15:56736445-56736467 GTTAATGTATTTTCATTCAAAGG + Intronic
1127428802 15:58882036-58882058 ATTTTTGTATTTTTAGCAAATGG - Intronic
1127651133 15:61008912-61008934 GTCTTTCTAATTTCATCAAATGG - Intronic
1127804273 15:62504532-62504554 ATCAATGGATTTTCATCAAAGGG + Intronic
1130182266 15:81642512-81642534 GTTTATGTTTTTTAAAAAAATGG + Intergenic
1130693386 15:86105523-86105545 GTTTATTTATTGACATCAATTGG - Intergenic
1130832963 15:87620453-87620475 GTTTATCCTTTCTCATCAAAAGG + Intergenic
1132488421 16:210281-210303 GTTTATGTATTTTTTTGAGAGGG - Intronic
1134873227 16:17671259-17671281 ATTTGTGTATTTACATCTAAAGG + Intergenic
1135822433 16:25695879-25695901 GTTTTTGTGTTTTCAGCAAGAGG + Intronic
1136741624 16:32535988-32536010 GTTTTTGTATATTCTTGAAATGG - Intergenic
1136864617 16:33736199-33736221 GTTTTTGCATTTTAATTAAAAGG - Intergenic
1137021924 16:35436566-35436588 GTTTATGTATGTTCATCTTTAGG - Intergenic
1138201732 16:55093563-55093585 GTTTATTTATTCTTATCCAATGG - Intergenic
1139013628 16:62663718-62663740 GTTCATTTATTTTGATAAAATGG - Intergenic
1139382795 16:66544328-66544350 TTTTCTGTATTTTCTTCAATGGG - Intronic
1139622548 16:68158314-68158336 GTATCTGGACTTTCATCAAATGG + Intronic
1140352412 16:74275165-74275187 TTTTATGTATATTGATAAAATGG + Intergenic
1141536298 16:84682892-84682914 GTTTTTTCATTTTAATCAAATGG + Intergenic
1141591530 16:85072411-85072433 GTTAATATATTTTCTTCACATGG - Intronic
1141796000 16:86274655-86274677 GTTGCTGTAGTTTCATAAAATGG - Intergenic
1203011852 16_KI270728v1_random:300112-300134 GTTTTTGTCTTTTCTGCAAACGG + Intergenic
1203012067 16_KI270728v1_random:303755-303777 GTTTTTGTCTTTTCTGCAAATGG + Intergenic
1203027978 16_KI270728v1_random:539246-539268 GTTTTTGTATATTCTTGAAATGG + Intergenic
1203030187 16_KI270728v1_random:573271-573293 GTTTTTGTCTTTTCTGCAAACGG + Intergenic
1203030402 16_KI270728v1_random:576914-576936 GTTTTTGTCTTTTCTGCAAATGG + Intergenic
1203041319 16_KI270728v1_random:757517-757539 GTTTTTGTCTTTTCTGCAAATGG - Intergenic
1203041534 16_KI270728v1_random:761160-761182 GTTTTTGTCTTTTCTGCAAACGG - Intergenic
1203043743 16_KI270728v1_random:795185-795207 GTTTTTGTATATTCTTGAAATGG - Intergenic
1143936425 17:10490295-10490317 GGTTATGAATTTTCCTTAAATGG + Intergenic
1144249147 17:13398069-13398091 GTGTAAGTATGTTCATGAAAAGG - Intergenic
1144426513 17:15147525-15147547 TTTTCTGTATTTTATTCAAAAGG - Intergenic
1145032370 17:19514369-19514391 GTTCATGTATTTTTAAAAAATGG - Intronic
1147052796 17:37809058-37809080 GCTCACGTATTTTCATCAAAAGG - Intergenic
1148765079 17:50033940-50033962 GTGGATGGATTTTCACCAAATGG - Intergenic
1149053193 17:52331387-52331409 GTGTATGTATTTATATCTAAGGG - Intergenic
1153190141 18:2529117-2529139 GTTTAAGCATTTTCTTCAATTGG + Intergenic
1153554829 18:6300998-6301020 GTTTTTTTATTTTAAACAAATGG - Intronic
1153671592 18:7417509-7417531 TTTTATTTATTTTTGTCAAAAGG + Intergenic
1154352417 18:13595743-13595765 GTTATTGTATTTTAATCATAGGG + Intronic
1156078090 18:33304889-33304911 GTTTATGTCTTTTCTGGAAATGG - Intronic
1156359804 18:36374850-36374872 TTTTATGTATTGTTTTCAAAAGG + Intronic
1157257461 18:46151844-46151866 GTTGATTTCATTTCATCAAAAGG + Intergenic
1157917504 18:51680630-51680652 ATATATGTATTTGCATTAAAAGG - Intergenic
1158200210 18:54931147-54931169 GTTAATGGATTTTCATAAACAGG + Intronic
1158930463 18:62320153-62320175 GTTTATGTATTTTTTTCATGTGG - Intergenic
1159245545 18:65800006-65800028 TTTTATATATTTTACTCAAAAGG - Intronic
1159399378 18:67911235-67911257 GTTTTTGTATTTTCAGTAGAGGG + Intergenic
1159580345 18:70228773-70228795 ATTTATGCATTTTCATTAAAAGG + Intergenic
1160201579 18:76800686-76800708 GTTTATGTATTTTTTTTTAAGGG + Intronic
1160403860 18:78630963-78630985 CTTCATGAATTTTCATCTAATGG + Intergenic
1160489209 18:79322733-79322755 TTTCATTTATTTTCAGCAAAAGG + Intronic
1162827291 19:13261022-13261044 GTGTAACTATTTACATCAAATGG - Intronic
1163150353 19:15408911-15408933 GTTTTTGTTTTTTAAACAAATGG + Intronic
1164351794 19:27355625-27355647 GTTTATGTAGTATCTGCAAATGG - Intergenic
1165508286 19:36249096-36249118 ATTTATTTATTTTAATAAAAAGG + Intergenic
1165796356 19:38522265-38522287 ATTTATGTATTTCGATGAAAAGG + Intronic
1167122343 19:47525485-47525507 TTTTTTGTCTTTTCAACAAAAGG + Intronic
1167404633 19:49297090-49297112 AATTATGTCTTTTCATCAAAAGG + Intronic
925853730 2:8109253-8109275 GTTTATGTAAATGCAACAAAAGG + Intergenic
926520490 2:13906737-13906759 GTATATGTATTGTGATCATATGG + Intergenic
926796464 2:16623415-16623437 GTTCATGAAGTTTCATCCAAGGG - Intronic
926877831 2:17503728-17503750 ATTTGTGTATTTTCATCAATAGG - Intergenic
927842204 2:26452725-26452747 CTTTATGTATTCACATGAAAAGG + Intronic
929017268 2:37510950-37510972 GTTGTGGTATTTTCATAAAACGG + Intergenic
929617122 2:43320141-43320163 TTTTATGTATTTTCTTTGAAAGG - Intronic
930285887 2:49427417-49427439 ATTTATCTGTGTTCATCAAAAGG - Intergenic
930702696 2:54474985-54475007 GTTTTTGTATTTTCACCATGTGG - Intronic
930722430 2:54650205-54650227 GTTTATTTATTTTAATCATGGGG - Intronic
931131720 2:59343564-59343586 GTTTATGTAGGTTAATCAATTGG - Intergenic
932028495 2:68158992-68159014 GTTTATATATTTTTTTCATATGG + Intronic
933034592 2:77378507-77378529 TTATATGTATTTTCAACAATTGG + Intronic
933191775 2:79341909-79341931 TTTTATGTATGTCCATGAAAGGG + Intronic
934175396 2:89574486-89574508 GTTGTTGTATTTTCATTAAGGGG - Intergenic
934285712 2:91648849-91648871 GTTGTTGTATTTTCATTAAGGGG - Intergenic
935440324 2:103086880-103086902 GTTTTTTTTTTTTCAACAAATGG + Intergenic
936605012 2:113943274-113943296 GTATATGTATTTTTGTCAGAAGG + Intronic
937724439 2:125145102-125145124 GTTTATTTATTTTTAAAAAATGG + Intergenic
938242708 2:129755725-129755747 GTTTCTTTATCTTCAACAAAGGG - Intergenic
939377871 2:141393200-141393222 GTTTATGTGTTTTGATAGAATGG - Intronic
939405568 2:141751680-141751702 GTTTATGTATTTTCCTCTTCTGG - Intronic
939911534 2:147989389-147989411 GTTTTTATATTTTTAACAAATGG - Intronic
940773464 2:157862964-157862986 GTTTATATATATTCATAGAATGG - Intronic
941278628 2:163522123-163522145 GTGTATGTGTTCTCATCAATTGG + Intergenic
941479692 2:165991172-165991194 GGTGATGTATTTTTATCAACAGG - Exonic
941696286 2:168554925-168554947 GTGTCTGTATATTCATAAAAAGG + Intronic
942080929 2:172398996-172399018 GTTTATGTTTTCTCATTTAAAGG - Intergenic
943010719 2:182445184-182445206 GTTTCTATATTTTCAGTAAATGG - Intronic
943328073 2:186525498-186525520 GTTAAAATTTTTTCATCAAAGGG + Intergenic
943346649 2:186745679-186745701 GTTTATGTATTTATGGCAAAAGG + Intronic
943406635 2:187495251-187495273 GGCTATTTATTTTCATCAACTGG - Intronic
943417990 2:187632088-187632110 ATTAATATATTTACATCAAAAGG + Intergenic
944167226 2:196735580-196735602 ACTTATGTATTGTCCTCAAAGGG + Intronic
944190829 2:197001929-197001951 GTTTATGAATTTTCCTGAATTGG + Intronic
944369728 2:198967884-198967906 GTTTTTATTTTTTCCTCAAAAGG - Intergenic
944717365 2:202388874-202388896 TTTAATCTATTTTCATTAAAAGG - Intronic
945649995 2:212545439-212545461 ATTTATGTATTTTCTTCAGAAGG + Intergenic
945712734 2:213319567-213319589 GATTTTGTATATTCATCTAATGG + Intronic
946318955 2:218937358-218937380 AATTATTTATTTTTATCAAATGG - Intergenic
1169148626 20:3271425-3271447 ACTTCTGTATTTTCACCAAAAGG - Intronic
1169697157 20:8402976-8402998 GTTTATGTATTTTGATGACTTGG + Intronic
1170548978 20:17459393-17459415 GTATCTGTATGTTCACCAAAAGG - Intronic
1174766805 20:53262385-53262407 GTTCATGATTGTTCATCAAACGG + Intronic
1175018674 20:55820642-55820664 GTCTATGAATATTCATCAAAAGG - Intergenic
1175397204 20:58674386-58674408 GGTTACGTATTTTCTTTAAAAGG + Intronic
1177048077 21:16196697-16196719 ATTTATGTACTTTCATTAGAGGG - Intergenic
1177197163 21:17915347-17915369 GCTTATGTATTATTATCAAGTGG + Intronic
1177391093 21:20473440-20473462 ATTTAAGTATTTTTTTCAAAGGG - Intergenic
1177689662 21:24488952-24488974 CTTTTGGTATTTTCATCATAAGG - Intergenic
1177755204 21:25338347-25338369 GCTTATTTATCTTTATCAAAGGG - Intergenic
1178112348 21:29381282-29381304 GTTGATGTATTTTGAAGAAATGG + Intronic
1179448460 21:41450788-41450810 GTTCTTGTATTTTTTTCAAATGG + Intronic
1179832256 21:44004558-44004580 ATTTTTGTATTTTCAGCAGATGG - Intergenic
1180627115 22:17201037-17201059 TTTTTTGTATTTTCAGTAAATGG - Intronic
1181869097 22:25883917-25883939 GTTTTTTTATTTTCATAAGAAGG + Intronic
1182048806 22:27297771-27297793 CTTTATTTATTTTTCTCAAATGG - Intergenic
949311885 3:2709140-2709162 TTTGCTGGATTTTCATCAAATGG - Intronic
949618638 3:5784976-5784998 GTTTATGTATTTCAATGAGAGGG + Intergenic
950879446 3:16311196-16311218 TTTTATATATTTTTTTCAAACGG + Intronic
951118476 3:18894033-18894055 TATTGTGTATTTTCAGCAAATGG + Intergenic
952015415 3:28951032-28951054 GTTGATGTATTATCATTAAATGG - Intergenic
952483401 3:33785545-33785567 ATTTATGTATTTTTATGAGATGG + Intergenic
952941610 3:38449425-38449447 TTTTATTTATTTTTAACAAACGG + Intergenic
955296571 3:57740764-57740786 GTATATCAATTTACATCAAAAGG - Intergenic
957461212 3:80522905-80522927 GTTTATTTCTTTTCATGAAGAGG - Intergenic
958639886 3:96792349-96792371 ATTTATATATTTAGATCAAATGG - Intergenic
958804849 3:98797929-98797951 ATTTATGTATTTTTATCATATGG + Exonic
959093797 3:101932006-101932028 GGGTATGTATTTACAACAAAGGG - Intergenic
959596608 3:108135970-108135992 GTTTATTTATGTTCATCATTTGG - Intergenic
959677933 3:109057374-109057396 TTTCATGCATTTTGATCAAACGG + Exonic
959862169 3:111228956-111228978 TTTTAAGTATTTTGACCAAAAGG + Intronic
959882823 3:111465314-111465336 ATTTATGTTTTTGAATCAAATGG + Intronic
961671685 3:128536808-128536830 GTTTTTTTTTTTTCAACAAATGG + Intergenic
961810823 3:129520787-129520809 GTTTATTTATTTTGATTTAATGG + Intergenic
961986183 3:131137580-131137602 GTGTCAGTATTTTCATCCAATGG + Intronic
962644468 3:137422437-137422459 GTTTATGTATGCTCCTCAACAGG - Intergenic
963331116 3:143917475-143917497 CTTTATATATTTTCATTGAAAGG + Intergenic
964584626 3:158283535-158283557 AGTTATGTATTTTCACGAAATGG - Intronic
964671085 3:159227076-159227098 GTTTATGTCTTTGCATTAACAGG + Intronic
964726481 3:159819161-159819183 GTTTGTGTGTTTTCATGACATGG + Intronic
964917719 3:161856272-161856294 GTCAATGTATGTTCATCAATTGG + Intergenic
965042139 3:163522391-163522413 GATTAAGTATTTTGATCTAAAGG - Intergenic
965129202 3:164673187-164673209 ATTTATGTCATTTCATCTAAGGG - Intergenic
965312764 3:167151486-167151508 GTTTATGTATTTTCAATAATTGG - Intergenic
965673907 3:171174689-171174711 TTTTATGTAAGTTTATCAAAAGG + Intronic
966654300 3:182337430-182337452 GTTTATCTATTTTCCTTTAATGG - Intergenic
967214054 3:187195017-187195039 GTTTATATCATTTCAGCAAATGG - Intergenic
967251857 3:187547913-187547935 AGTCATGTATTTTCAACAAAAGG + Intergenic
967361938 3:188641149-188641171 CTTTACTTATTTTCATCCAAGGG - Intronic
969942465 4:10748004-10748026 GATGATGTATTTTAATGAAAGGG + Intergenic
970484463 4:16510303-16510325 GCTTAAAGATTTTCATCAAATGG + Intronic
971034239 4:22675755-22675777 GATTGTGTATTTACATCAATAGG - Intergenic
971070599 4:23087138-23087160 TTGTATGTTTTTACATCAAAAGG - Intergenic
971689874 4:29819566-29819588 GTTTATGTATATATCTCAAAAGG - Intergenic
971894200 4:32569562-32569584 CTTTGTGTATTTTCAGTAAAAGG + Intergenic
971903157 4:32689741-32689763 CATTATGTAGTATCATCAAATGG + Intergenic
972007556 4:34129937-34129959 GTTTTTTTTTTTTCCTCAAATGG - Intergenic
972664951 4:41156523-41156545 TTTTATTTATTTTATTCAAAGGG + Intronic
973954860 4:56052466-56052488 CTTTATTTCTTTTCTTCAAATGG + Intergenic
975248437 4:72148135-72148157 GTGTGTGTATTTTCCCCAAATGG + Intergenic
975478666 4:74853081-74853103 ATTTTTGTTTTTTAATCAAAAGG + Intergenic
975554594 4:75649076-75649098 GTTTATGTATTTACATGGAGTGG - Intronic
976866320 4:89731760-89731782 GTGTATGTACTTCCATCAGAGGG - Intronic
977083136 4:92559150-92559172 GTTTATGTATATTTATCAAATGG - Intronic
977570428 4:98623278-98623300 GTTTCTATTGTTTCATCAAAGGG + Intronic
978237758 4:106480432-106480454 ATTTATGTATTTTCAAGATAAGG + Intergenic
978262508 4:106777686-106777708 GTTTTTTTTTTTTCAACAAATGG + Intergenic
978278116 4:106976810-106976832 GTTGATGCAGTTTCTTCAAAGGG + Intronic
978361695 4:107937675-107937697 TTTTTTGTATTTTTATCAGAGGG + Intronic
978511600 4:109526121-109526143 GTTTATGATTTTGAATCAAAAGG - Intronic
979203715 4:118009342-118009364 GTTTATGTATTTTCCACATGTGG - Intergenic
981495596 4:145388522-145388544 GTTTATGTAGTTTTATAGAAAGG - Intergenic
982577334 4:157130807-157130829 AATTATATATTTTCCTCAAAGGG - Intronic
983167000 4:164490228-164490250 GTTTTTCTATTTTAATGAAAGGG + Intergenic
983446240 4:167856661-167856683 AATTCTGAATTTTCATCAAAAGG - Intergenic
983541471 4:168916097-168916119 CTTTATGTAATTTCCCCAAAAGG - Intronic
983671142 4:170239191-170239213 GTCTAAGTACTTTCATTAAATGG + Intergenic
983749792 4:171252817-171252839 ATTTATTTTTTTTCATCGAATGG + Intergenic
983798793 4:171901348-171901370 GTTCATGTATGTTCTTCAGAAGG - Intronic
983908760 4:173212911-173212933 GTTTTAGTATTTTCCACAAAAGG - Intronic
984452862 4:179925771-179925793 ATTCATGTTTCTTCATCAAAAGG + Intergenic
985505094 5:274764-274786 GTTCCTGTATTTTCACCAGAGGG + Intronic
985743027 5:1630871-1630893 GTTCCTGTATTTTCACCAGAGGG - Intergenic
986281505 5:6326830-6326852 GACTTTGTATTTTAATCAAATGG - Intergenic
986387698 5:7251277-7251299 GATTATGTAATTTCAACAGATGG + Intergenic
986403854 5:7406169-7406191 GTATGTATATTTTCTTCAAAAGG - Intronic
986513711 5:8538419-8538441 ATATATATATTTTCACCAAATGG + Intergenic
986956043 5:13150847-13150869 GTTTATATATTTTCATCTGTGGG - Intergenic
987626438 5:20406822-20406844 GTTTATGTATTTCTAACAAAAGG - Intronic
987917316 5:24230745-24230767 ATTTAGTTATTATCATCAAAAGG + Intergenic
988260352 5:28878739-28878761 TTTTATGTATTTTTAGCAATTGG - Intergenic
989435164 5:41404086-41404108 CTTAATGTATTTTAATCTAAAGG - Intronic
989626055 5:43430434-43430456 TTGTATTCATTTTCATCAAAAGG + Intergenic
989835673 5:45986750-45986772 GTTTTTGTAGAATCATCAAAGGG + Intergenic
989835879 5:45990244-45990266 GTTTTTGTATTATCAGCAAAGGG + Intergenic
989853917 5:46254392-46254414 GTTTTTGTAGATTCTTCAAAGGG - Intergenic
989854285 5:46260871-46260893 GTTTTTGTAGTTTCTGCAAAGGG - Intergenic
989946514 5:50238655-50238677 CTTTATGTAGTTTCTGCAAATGG - Intergenic
990078589 5:51883278-51883300 GTTTATAGATTTTTATAAAAAGG + Intergenic
990452864 5:55952890-55952912 ATTTTTGTATTTTCAGTAAAGGG - Intronic
990694846 5:58404555-58404577 TTGTATGTCTTTTCATCGAATGG + Intergenic
990744453 5:58944733-58944755 ATTTATATATTTTCCTTAAAAGG + Intergenic
991548991 5:67816106-67816128 ATTCATGTATTTTGATCACAGGG + Intergenic
993132000 5:83910194-83910216 CTTTATGTATTGTCATCTTAAGG + Intergenic
993480383 5:88417244-88417266 TTTTATCTATCTTCATCAGAAGG + Intergenic
993902856 5:93596204-93596226 GTTTATCTGTTTTCATCAGAGGG - Intergenic
994098200 5:95866479-95866501 TTTTATTTAGTTTCACCAAAGGG + Intergenic
994144514 5:96378861-96378883 GTATATGTATTTTTACCTAATGG + Intergenic
994491859 5:100458075-100458097 CTTTATGCATTTTAAGCAAATGG - Intergenic
994894378 5:105683655-105683677 GTTTGTGTATTTTCATCTCCTGG + Intergenic
995004602 5:107176422-107176444 GGTTAAGTACTTCCATCAAAAGG + Intergenic
995615825 5:113962192-113962214 ATTTATGTGTTTTCAAAAAAAGG + Intergenic
995736420 5:115305157-115305179 GTTAATTTATTTACACCAAAAGG - Intergenic
995850008 5:116535055-116535077 GTTTGTGTATTTCCTGCAAAAGG - Intronic
995930905 5:117441698-117441720 GTTTAAGAATTTTCATAAACAGG - Intergenic
996711386 5:126546837-126546859 CTTAATGTATTTCTATCAAATGG - Intronic
998581337 5:143379264-143379286 CTTTATGTATTTTAAAGAAAGGG - Intronic
998881617 5:146651144-146651166 TTTTATGTCTTTTCATCTCATGG + Intronic
999095465 5:148974080-148974102 GTTTATGCATCCTCCTCAAACGG + Intronic
999472946 5:151872375-151872397 GCTTTTTTATTTTCACCAAATGG - Intronic
999936480 5:156492296-156492318 GTGTATGGATTTTTATCATAAGG + Intronic
1000013511 5:157256636-157256658 ATTTCTGTCTTTTCCTCAAAAGG - Intergenic
1000293883 5:159896246-159896268 GTTTATTTATTTTTAACAGAAGG - Intergenic
1001777544 5:174339911-174339933 ATTGAAGTATTTTCTTCAAATGG + Intergenic
1004212882 6:13669947-13669969 GTTTTTTTTTTTTCAACAAATGG + Intronic
1005682465 6:28220199-28220221 GTTTATGTATTTTTAACTTAAGG + Intergenic
1007150535 6:39686098-39686120 TTTTGTTTATTTTCATCAAAAGG - Intronic
1008651331 6:53566281-53566303 GTTTTTGTATTTTCAGTAGACGG - Intronic
1008699401 6:54080598-54080620 GTGTATGTCTTTTTATCACATGG - Intronic
1009260524 6:61480291-61480313 GTTTTTGTATGTTCTGCAAATGG + Intergenic
1009261883 6:61501489-61501511 GTTTTTGTCTTTTCTGCAAATGG - Intergenic
1009262027 6:61503729-61503751 GTTTCTGTAGAATCATCAAAGGG - Intergenic
1009262252 6:61507726-61507748 GTTTATGTAGATTCTGCAAAGGG - Intergenic
1009609280 6:65918973-65918995 TTTTATGAATTTTCATTAACTGG + Intergenic
1011094109 6:83638672-83638694 GGTGATGTATTTCCATTAAATGG + Intronic
1011096400 6:83669854-83669876 ATTTTTGTATGTTCATCTAATGG - Intronic
1011191118 6:84729378-84729400 GTTTAGGTATGTTCTTCAAGAGG + Intronic
1011400622 6:86957731-86957753 TTTTATGCATTTGCATGAAAAGG + Intronic
1011968453 6:93190665-93190687 GCTTCTGCATTTTTATCAAAGGG + Intergenic
1012289175 6:97430444-97430466 GTTTATGTTTTTTAAGGAAATGG + Intergenic
1013946184 6:115725590-115725612 GATTATTTATTTTCATCCACTGG + Intergenic
1014652750 6:124061043-124061065 GTTCATGTGATTTGATCAAAGGG + Intronic
1014887164 6:126795984-126796006 ATTTGTATATTTCCATCAAAAGG - Intergenic
1015012715 6:128371376-128371398 TTTTACGTATTCTCATAAAAAGG + Intronic
1015163933 6:130182499-130182521 TTTTTTGTATTTTCAAGAAAAGG - Intronic
1015188639 6:130448227-130448249 GTTTATGAAATTCCACCAAAAGG + Intergenic
1016071393 6:139743262-139743284 CTATATGTATTCTCTTCAAAGGG + Intergenic
1016527503 6:145018724-145018746 TTTTATTTATTTTAATCAACAGG + Intergenic
1016565668 6:145450476-145450498 GTATATGTATTCTCACCAAAAGG + Intergenic
1016754103 6:147664603-147664625 TTTTATTTATTTTCATTATATGG - Intronic
1017795333 6:157839401-157839423 GCATATGTATTTTCATGTAATGG + Intronic
1018173384 6:161159613-161159635 GTGTGTGTGTGTTCATCAAAAGG + Intronic
1018260682 6:161967782-161967804 ATTTATGCATTTTCCTTAAAAGG + Intronic
1018965786 6:168487811-168487833 ATGTATGTTTTTTAATCAAAAGG - Intronic
1020565544 7:9789942-9789964 GATAATGTATATTCATTAAATGG - Intergenic
1020709801 7:11593027-11593049 GTTTATGTATTTTCTATAATAGG - Intronic
1020862359 7:13510525-13510547 GATTTTGTAGTTTCATCAATTGG - Intergenic
1021264670 7:18505320-18505342 GTTCATTTATTTTGACCAAAAGG + Intronic
1021640684 7:22733571-22733593 GTTTATGTATCTTCATCTTCAGG + Intergenic
1021695302 7:23270398-23270420 GCTGATTTTTTTTCATCAAAAGG - Intronic
1021863014 7:24925946-24925968 GTTTATCTTGTTTCATTAAAAGG + Intronic
1022657480 7:32332972-32332994 GTTTATGGGTTTTCATGAAATGG - Intergenic
1022863599 7:34393786-34393808 GTTTTTGCATTTTACTCAAAAGG - Intergenic
1024114005 7:46175050-46175072 CATTATCTAATTTCATCAAATGG - Intergenic
1024144091 7:46493600-46493622 GTTTATCTATTCTGATCAAATGG + Intergenic
1024409170 7:49019329-49019351 ATTCATATATTTTAATCAAAAGG + Intergenic
1025529069 7:61853991-61854013 GTTTTTGTCTTTTCTGCAAATGG - Intergenic
1025531469 7:61890578-61890600 GTTTTTGTATATTCTTGAAATGG - Intergenic
1026285893 7:68962491-68962513 TTTTATGGATTTTCATGGAATGG + Intergenic
1027364008 7:77438336-77438358 GGTTTTGGTTTTTCATCAAAGGG - Intergenic
1027718524 7:81707442-81707464 GTGTATTTATTTTTAACAAATGG - Intronic
1027916371 7:84328305-84328327 GTTTACGTATGTTTATCAAATGG - Intronic
1028242220 7:88435350-88435372 CTTTATGTCTTTTCATTTAAGGG - Intergenic
1028458710 7:91067209-91067231 AATTATGTTTTTTCATCTAATGG + Intronic
1028947473 7:96596823-96596845 ATTTTTGTATTTTCAGCAGATGG - Intronic
1029555393 7:101265262-101265284 TTTTATGTATTTTTATAAAGAGG - Intergenic
1029781007 7:102732857-102732879 GTAAAAGTATTTTCAACAAATGG - Intergenic
1030477469 7:110054657-110054679 GGTTATCTATTTTCATCCATTGG + Intergenic
1031178958 7:118391133-118391155 TTTTTTGTATTTTCATTAGAGGG + Intergenic
1031656096 7:124357689-124357711 GTCTATGTATTTCCCTAAAATGG - Intergenic
1031775010 7:125897489-125897511 GTTTATGTATTACCTTCATAAGG - Intergenic
1032267044 7:130376889-130376911 GTGTTTGTATTTTCAGAAAAGGG - Intergenic
1034020608 7:147637769-147637791 GATTGTGTATTTTCATCCAAAGG + Intronic
1034096367 7:148411775-148411797 GTTTTTTTTTTTTCAACAAATGG - Intronic
1034606544 7:152321224-152321246 ATTTATTTATTTTCTTGAAAGGG - Intronic
1035970932 8:4248111-4248133 GTTTATTTTTTTTAAACAAATGG + Intronic
1036197219 8:6730003-6730025 GTATATATATGTTCAGCAAAAGG - Intronic
1037189681 8:16108525-16108547 ATCTAGGTATTTTCTTCAAAAGG - Intronic
1037806872 8:22062862-22062884 GTCTTTGTGTTTTCAGCAAAGGG - Intronic
1038067397 8:23977170-23977192 GTTTATGTTTTTTCCTCAGGGGG - Intergenic
1038971699 8:32643949-32643971 GCTTTTGTTATTTCATCAAAAGG - Intronic
1039156390 8:34563258-34563280 GTTCATGTACTTACATCACATGG + Intergenic
1040005382 8:42616572-42616594 GTTTGCATATTTTCATCTAAAGG - Intergenic
1040116770 8:43630612-43630634 CTTTTTGTATAATCATCAAAGGG + Intergenic
1040344294 8:46472699-46472721 GTTTATGTATAATCTGCAAAGGG - Intergenic
1040347578 8:46522392-46522414 GTTTTTGTAGATTCAGCAAAAGG + Intergenic
1040714984 8:50240173-50240195 GTTAATTTACTTTCTTCAAATGG - Intronic
1040886923 8:52274270-52274292 TTTGATGTATTTTCTTCTAAAGG - Intronic
1041040164 8:53838502-53838524 GTATATATATTTACAACAAAAGG - Intronic
1042539546 8:69894360-69894382 ATTTATTTATTTTGATCAGAAGG + Intergenic
1042688296 8:71465615-71465637 GTTTATTTATTTTTTTGAAATGG - Intronic
1043349522 8:79343394-79343416 GTTTTTGTCTTTTTATAAAAAGG - Intergenic
1043686802 8:83096598-83096620 GTTTATGGATATTCATCTATAGG + Intergenic
1044393408 8:91680328-91680350 ATTTAGGTATGTTTATCAAAGGG - Intergenic
1044460515 8:92439154-92439176 GTTTCTTCATTTTCATCACAGGG + Intergenic
1044886776 8:96787401-96787423 GATTATGTATTGTAATCAAGTGG - Intronic
1045735142 8:105286700-105286722 GTTTATGTATATTTATGACATGG + Intronic
1046107709 8:109686265-109686287 GTTTTTAAATTTTAATCAAAGGG - Intronic
1046201066 8:110928514-110928536 ATCAATCTATTTTCATCAAATGG - Intergenic
1046257173 8:111716122-111716144 TTTTATATCTTTTCAACAAAAGG - Intergenic
1046348574 8:112972164-112972186 GTTTATCTGTTTTCATAAACTGG - Intronic
1046479246 8:114793372-114793394 GTTTATGTATTTTTATTACTTGG - Intergenic
1047009983 8:120661871-120661893 GTTTATGTATGTTCAGAGAATGG + Intronic
1047891884 8:129321619-129321641 GTCTATGTAATTTTATCAGATGG - Intergenic
1048708570 8:137182670-137182692 GTTTATGAATCTTCATCTGATGG - Intergenic
1048754611 8:137723964-137723986 GTTTTTGTAGTTTCTTAAAATGG - Intergenic
1050576747 9:7004728-7004750 ATATAAGTATTTCCATCAAAAGG - Intronic
1050582110 9:7069689-7069711 TTTTATGTAATTTTATCACATGG + Intronic
1050771965 9:9213340-9213362 GTTGATGTCTATGCATCAAATGG - Intronic
1051011534 9:12420622-12420644 GTTTTTTAATTTTCACCAAAAGG - Intergenic
1052632135 9:31055368-31055390 GTTCATATAATATCATCAAAAGG + Intergenic
1054810304 9:69429019-69429041 GGTTATGTATGTTCACCTAAAGG - Exonic
1055723783 9:79205285-79205307 TATTATTTATTTTCATCACATGG - Intergenic
1056295533 9:85189612-85189634 CTTTATATATTTTAATCACATGG - Intergenic
1056904156 9:90631036-90631058 ATTCATGTATTTTTGTCAAATGG - Intronic
1058269956 9:102959396-102959418 GTTTATGTGTTTCCTTAAAATGG + Intergenic
1059598875 9:115754131-115754153 GTTTAGCTTTGTTCATCAAAAGG + Intergenic
1059787644 9:117603442-117603464 GTTTTTGTTTTATAATCAAATGG - Intergenic
1185977206 X:4734501-4734523 GTGTGTGTATTTTCATAAATGGG + Intergenic
1186125584 X:6410316-6410338 GTTTCTCTTTTTCCATCAAAGGG - Intergenic
1186770140 X:12810381-12810403 GTTTATTTGTTTTCAGCAAAGGG + Intronic
1188380932 X:29490974-29490996 GTTGTTGTATTTTCATCATTAGG + Intronic
1188694481 X:33173361-33173383 GTTTATGTATTTTCATCAAAAGG + Intronic
1188773585 X:34185629-34185651 GTTTATTTATTTTTTTCAGACGG - Intergenic
1188969942 X:36602708-36602730 ATTTATGTAATTTAATGAAATGG + Intergenic
1191573403 X:62662132-62662154 CTTTTTGTATTATCATCAAATGG + Intergenic
1192717656 X:73660845-73660867 GTTTATGTCTTTCCATAAAACGG + Intronic
1195284298 X:103368349-103368371 ATTTTTATATTTTTATCAAATGG + Intergenic
1195646316 X:107234590-107234612 GTTTCTGTATTTCTGTCAAATGG + Intronic
1196236553 X:113287876-113287898 GTTTATATAATTTAATTAAAAGG - Intergenic
1197315462 X:124960598-124960620 GTCTGTGCAGTTTCATCAAAAGG - Intronic
1197587853 X:128371548-128371570 GATTATATATTTGCATCAAGAGG - Intergenic
1199183456 X:144886718-144886740 GAATATATATTTACATCAAAGGG + Intergenic
1199306829 X:146277382-146277404 GTTTATGTGATTTCTTCATAGGG + Intergenic
1200932000 Y:8705422-8705444 GTTTTTGTTTTTTCTTCAGAGGG + Intergenic