ID: 1188702503

View in Genome Browser
Species Human (GRCh38)
Location X:33282226-33282248
Sequence CCACCTCGATGTCTTCCTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188702500_1188702503 21 Left 1188702500 X:33282182-33282204 CCAGGTCACTTATTATGATTGTG 0: 1
1: 0
2: 1
3: 4
4: 113
Right 1188702503 X:33282226-33282248 CCACCTCGATGTCTTCCTGTCGG 0: 1
1: 0
2: 0
3: 14
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188702503 Original CRISPR CCACCTCGATGTCTTCCTGT CGG Intronic
901398513 1:9000104-9000126 CCACCTCAATATCTTTCTTTGGG - Intergenic
902650404 1:17833573-17833595 CCACCTCCATGGCCTCCTGATGG - Intergenic
903096993 1:20986152-20986174 CCACCTCGATACCTTTGTGTTGG - Intronic
904320963 1:29697583-29697605 GCACGTCGAAGTCTTCATGTGGG - Intergenic
904383670 1:30127896-30127918 CCACCTCCATGCCTTTCGGTAGG - Intergenic
904606927 1:31703211-31703233 CCTCCTGTAGGTCTTCCTGTTGG + Intronic
905413497 1:37788677-37788699 GCACCTGGATGTTGTCCTGTGGG + Intergenic
908778548 1:67666708-67666730 CCCCCTGGAAGTCTTCCTTTTGG + Intergenic
914319010 1:146541443-146541465 CATCCTCGATGTCACCCTGTGGG - Intergenic
916305159 1:163322029-163322051 CGAACTCGCCGTCTTCCTGTCGG + Exonic
916328561 1:163591353-163591375 CCACCTGGATGTATACCTGCAGG - Intergenic
916329281 1:163596176-163596198 CCATCTGGATGTATACCTGTAGG - Intergenic
918114447 1:181484433-181484455 ACACCGCACTGTCTTCCTGTAGG + Intronic
918375003 1:183900218-183900240 TCACCTCGATGTAGTCCTGAAGG - Exonic
918475527 1:184920093-184920115 CCTCCTCAATGTCCTCCAGTTGG - Intronic
923062058 1:230484631-230484653 CCACCTCTCTGTCTTACAGTTGG - Intergenic
924582306 1:245332977-245332999 CCACCATGATGGCTTCATGTTGG - Intronic
1065320674 10:24506183-24506205 CCACCTGGATCTGTTCCTGCAGG - Intronic
1066484278 10:35828484-35828506 CCACCCCCATGTCCTCCTGGAGG - Intergenic
1069700560 10:70421868-70421890 CCACCTCCCCGTCTTCCTCTGGG + Exonic
1070272888 10:74975245-74975267 CCACCTAGATGTTTCTCTGTTGG - Intronic
1075059860 10:119248645-119248667 CCACCCCGCTGTGTTTCTGTAGG + Intronic
1076779163 10:132714490-132714512 CCTCCTCGCTGTCTCCCTGCGGG - Intronic
1077831279 11:5873986-5874008 CCACCTCTCTTCCTTCCTGTTGG + Intronic
1077958378 11:7046504-7046526 CCACCAGGAAGTCTTCCTCTGGG - Intronic
1077968360 11:7160149-7160171 CAACCTCAAAGTCTTCCTGGTGG + Intergenic
1079028575 11:16968123-16968145 ACACCTAGATGACTTCCTGTGGG - Intronic
1079213136 11:18481629-18481651 AGACCTGGATGTCTTCCTGAAGG - Exonic
1082190219 11:49234105-49234127 GCACTTCTATTTCTTCCTGTTGG + Intergenic
1083826968 11:65209527-65209549 CTCCCTGGACGTCTTCCTGTTGG + Intronic
1085329870 11:75639337-75639359 CCACATCCCTTTCTTCCTGTTGG + Intronic
1086675904 11:89606803-89606825 GCACCTCTATTTCTTCCTGTTGG - Intergenic
1088752960 11:112860256-112860278 CCACTTCAATGTCTTCCTACTGG + Intergenic
1089668986 11:120039352-120039374 CCACCTCCTTGTCTTCCTTTTGG - Intergenic
1090035201 11:123243699-123243721 CCAGCTCAAAGTCTTCCTGGGGG - Intergenic
1090832201 11:130427722-130427744 CCTCCTCGCTGTCCTCCTGGTGG + Exonic
1092471305 12:8784422-8784444 CCACCTTGGTGTCTGCCTTTTGG - Intergenic
1095539549 12:43292819-43292841 ACATCTTGATGTTTTCCTGTTGG - Intergenic
1095640406 12:44479886-44479908 CCAGCTCTCTGCCTTCCTGTAGG + Intergenic
1096171628 12:49476146-49476168 CCACCTGTGTGTCTTCCTGCTGG - Intronic
1097167290 12:57092682-57092704 CCACCTGGATGTCCTGCTTTTGG + Intronic
1100703840 12:97178842-97178864 GCACCTCGGTGTCTTCTTGTTGG + Intergenic
1102200998 12:111057591-111057613 CCATCTTCCTGTCTTCCTGTGGG + Intronic
1102635046 12:114315987-114316009 CCTCCTCACTGTCTTCTTGTGGG + Intergenic
1104870097 12:131988881-131988903 CCCCCTTGCTGTCTTCATGTAGG + Intronic
1105670387 13:22607259-22607281 CAACCAAGATGTCTTCCAGTGGG + Intergenic
1108783995 13:53872347-53872369 CCACCTGGTTTTCTTCCCGTTGG + Intergenic
1112753264 13:102603412-102603434 CCTCCTCGATGACCTCCTTTAGG - Intronic
1114234868 14:20814883-20814905 CCACCTGGATGTATACCTGTAGG + Intergenic
1114366855 14:22036742-22036764 CAACCCAGATGTCTTCCAGTGGG + Intergenic
1116316956 14:43409480-43409502 CCACCTAAATGTTATCCTGTTGG - Intergenic
1117445226 14:55797909-55797931 ACTCCTCCATGGCTTCCTGTTGG + Intergenic
1121232452 14:92367655-92367677 CCACCCCGATCCTTTCCTGTAGG - Intronic
1124507631 15:30292012-30292034 CCACCTGGAGGTCTTCCTGGAGG - Intergenic
1124735925 15:32246646-32246668 CCACCTGGAGGTCTTCCTGGAGG + Intergenic
1126978262 15:54210829-54210851 CCACCTCCAAGTCATCCTGTGGG - Intronic
1127069334 15:55273107-55273129 CAACCTCTATGTCTTTCAGTTGG - Intronic
1128806195 15:70532896-70532918 CCACCTCCATGGCTGCCTGTGGG - Intergenic
1129309675 15:74697415-74697437 CCACCAAGATGTCTTTCAGTAGG - Intergenic
1131511369 15:93051200-93051222 TCACCTCGCTGTCCTCCTCTGGG + Intronic
1132955877 16:2593186-2593208 CCAGCTCAATGTCTTCATTTAGG + Intronic
1133034690 16:3028258-3028280 CCACCTGCATGTCGTCCTGCGGG + Exonic
1133988643 16:10688231-10688253 CCACCCCGATGTCTTTCTAGGGG + Intronic
1134116016 16:11549502-11549524 CCACCTTCATGTCTTCTTTTGGG - Exonic
1135227454 16:20674176-20674198 CCACCTCTTTCTCTTCCTCTGGG - Intronic
1138286174 16:55811967-55811989 CCACCTGGATGTCTTCATCCTGG - Intronic
1138306713 16:55983724-55983746 CAACCAAGATGTCTTTCTGTAGG - Intergenic
1140014511 16:71168641-71168663 CATCCTCGATGTCACCCTGTGGG + Intronic
1142160149 16:88553162-88553184 CCACCTCTGTGGCGTCCTGTGGG - Intergenic
1142740066 17:1926687-1926709 CCACTTGGATTTCTTCCTCTTGG + Intergenic
1143617727 17:8063932-8063954 TCACCTGGAGGTCTTCCTTTCGG - Intergenic
1145922418 17:28620207-28620229 CCACCTCCATCCCATCCTGTTGG - Intronic
1149270279 17:54969341-54969363 CCCCCTCGAGTTCGTCCTGTGGG - Intronic
1150159143 17:62879940-62879962 CCATCTGGATGGCTTCCTTTTGG - Intergenic
1152305626 17:79518771-79518793 CTTCCTCAATGCCTTCCTGTGGG - Intergenic
1153808615 18:8732664-8732686 CCAACTGAATGTCTCCCTGTTGG + Intronic
1159291941 18:66434553-66434575 CCTCCTCAAAGTCTTCCTGTAGG + Intergenic
1161850004 19:6733262-6733284 GAACCCCGATGGCTTCCTGTCGG - Exonic
1162833372 19:13300593-13300615 CCACCTCCTTGGCTTTCTGTAGG + Exonic
1163224079 19:15942995-15943017 CTACTTGGATGTGTTCCTGTCGG + Intergenic
1163318389 19:16556993-16557015 CCACCAGGATGCCTTCATGTTGG + Intronic
1164156569 19:22601031-22601053 CCACCTGCAGGTCTTCCTGCAGG + Intergenic
926337994 2:11878819-11878841 CCACTTCAGTGTCTTCCTGATGG + Intergenic
933073836 2:77897291-77897313 CCATCTGGATGTATTCCTGCAGG - Intergenic
933530161 2:83498857-83498879 CAACCTAGATGTCCTCCAGTAGG + Intergenic
936871085 2:117134734-117134756 CCACCTGGATGTGTACCTGCAGG - Intergenic
938097615 2:128473931-128473953 CCATCTGGATGTCTTCCGGGAGG + Intergenic
943928992 2:193825407-193825429 CCACCAAGATGTCTTTCAGTAGG + Intergenic
946194657 2:218025866-218025888 CCACCTCCATGGTTCCCTGTTGG + Intergenic
946486921 2:220109748-220109770 CCACCTCGTTGTATTCATGGAGG - Intergenic
948525188 2:238567050-238567072 CCCCCTCGTAGTCTTCCTGCTGG + Intergenic
1169122031 20:3102554-3102576 CCAGCTTGATGTCATCCTTTGGG + Intergenic
1170323613 20:15130569-15130591 CCACCTTGATGTCTCCATGATGG + Intronic
1171811062 20:29744315-29744337 CCACTTCGATGTCTGCGAGTGGG - Intergenic
1175628636 20:60512063-60512085 TCACTTCAATGTCTTCCCGTTGG + Intergenic
1175733888 20:61372188-61372210 CAAACTCCATGTCTTCCTGATGG + Intronic
1175851509 20:62096637-62096659 CCACCTCGACCTCTCCCTCTGGG + Intergenic
1178306134 21:31491506-31491528 CCTTCACGATGACTTCCTGTCGG + Intronic
1180997606 22:19973225-19973247 CCACCACGGTGTCTTCCTCCAGG + Exonic
1182041846 22:27244235-27244257 CCGCCTCACTGTCTTCCAGTTGG - Intergenic
1182871276 22:33650034-33650056 ACACCTAGCTGTCATCCTGTAGG - Intronic
950456360 3:13095125-13095147 CTACCTCCATCTCTGCCTGTGGG + Intergenic
950908635 3:16563648-16563670 CAACCTCCTTGTCTTCCTGTTGG - Intergenic
954162148 3:48730507-48730529 CCATCTGGATGTATACCTGTAGG + Intronic
954717248 3:52533021-52533043 ACACCTCGATGTCGCCCTGGAGG - Intronic
957698695 3:83680459-83680481 CCACGTGAATGTCTTCCTTTAGG - Intergenic
960283333 3:115800013-115800035 GCACCGGGCTGTCTTCCTGTGGG + Intergenic
960372819 3:116861979-116862001 GCACCACTATCTCTTCCTGTTGG + Intronic
968511886 4:999450-999472 CTGCCTGGATGTCTTCCTGCTGG + Intronic
973644002 4:52931987-52932009 CCACCTGGAAGGCTTCCTGGAGG + Intronic
974460828 4:62185443-62185465 CCCTTTGGATGTCTTCCTGTTGG + Intergenic
977277539 4:94996410-94996432 CAAACTCGAGGTCTTCCAGTTGG + Intronic
979883575 4:125994287-125994309 CCACCTCGGTGTCTCACGGTGGG - Intergenic
998304145 5:141056269-141056291 CCACCTGGCTGTTTACCTGTTGG + Intergenic
1003350201 6:5309494-5309516 CCACCCAGATTTCTTCCTGGAGG - Intronic
1005570450 6:27140023-27140045 CCACCACGAAGTTTTCCTGGAGG - Intergenic
1006196359 6:32245050-32245072 CTCCCTCGGTGTCTTCCTGCTGG + Intergenic
1011238729 6:85247453-85247475 CCACTTGTATGTCTTCCTTTGGG + Intergenic
1014686005 6:124501229-124501251 CCACTTCCATGACTTACTGTGGG + Intronic
1016734765 6:147465870-147465892 CCACCAAGATGTCTTTCAGTAGG + Intergenic
1017013370 6:150080353-150080375 CCACCTCAATATATTGCTGTGGG + Intergenic
1017390654 6:153935502-153935524 CCACATGGATGTCTTCTTTTGGG + Intergenic
1020082063 7:5291523-5291545 GCACCTGGAGGGCTTCCTGTAGG - Intronic
1025196855 7:56940615-56940637 GCACCTGGAGGGCTTCCTGTAGG + Intergenic
1025675093 7:63636322-63636344 GCACCTGGAGGGCTTCCTGTAGG - Intergenic
1025710463 7:63903164-63903186 CAACCTAGAAGTCTTCCTCTAGG + Intergenic
1028370549 7:90087184-90087206 CCACCTCAGTGTTTTCCTGGTGG + Intergenic
1032102718 7:128996201-128996223 CCACATCGATTTCATCCTGTTGG - Intronic
1032260051 7:130328389-130328411 CCTCCTTGATGTCTTACTGGTGG - Intergenic
1032491760 7:132329212-132329234 CCCACTCCATGCCTTCCTGTAGG + Intronic
1033535839 7:142311430-142311452 CCAGCTGGATGACTTCCTATGGG - Intergenic
1033599161 7:142876643-142876665 CCACCCTGAGGTCTTCCTGAAGG + Intronic
1033608490 7:142944319-142944341 CCACATCGTTGTATTCTTGTCGG + Exonic
1036623387 8:10444207-10444229 ACACCTTGATTTCTTCCTCTAGG - Intergenic
1038681636 8:29673817-29673839 CCACCTTGATTTCATCCTCTGGG + Intergenic
1038701295 8:29851846-29851868 CCACATTGATGTCTGCCTCTAGG + Intergenic
1041818628 8:62003335-62003357 CCACCCCCATGTCTTCCACTGGG - Intergenic
1043027184 8:75084589-75084611 CCACCTACATGTCTTCCAATGGG + Intergenic
1043311422 8:78864453-78864475 CCTCATTGATATCTTCCTGTTGG + Intergenic
1046208588 8:111038922-111038944 CCAGCTTGATGTCTTCCTAAGGG - Intergenic
1047588826 8:126304252-126304274 CCACCTTGATGTCTGCTTCTTGG - Intergenic
1048584422 8:135759757-135759779 ACACCAGGAAGTCTTCCTGTAGG - Intergenic
1048925891 8:139270919-139270941 CCATCTCCATGGCTTTCTGTGGG - Intergenic
1048960938 8:139576371-139576393 GGACCTAGATGTCTTACTGTAGG - Intergenic
1051751717 9:20349877-20349899 CTACCTTGATGTATTCTTGTGGG - Intronic
1057876935 9:98764464-98764486 CCACCTCTCTCTCTTCCTGTAGG + Intronic
1185666138 X:1767030-1767052 CCAGCTCCATGTCTTCCATTTGG + Intergenic
1186304956 X:8246637-8246659 ACACCTTGATGGCTACCTGTGGG - Intergenic
1187168711 X:16829701-16829723 CCAGCTCAATGTTTTCCTGTCGG - Exonic
1188059011 X:25577393-25577415 CCATCTGGATGTATTCCTGCAGG - Intergenic
1188702503 X:33282226-33282248 CCACCTCGATGTCTTCCTGTCGG + Intronic
1195001266 X:100645443-100645465 CTACCTCGCTGACTTCCTGCTGG + Intronic
1195495979 X:105533846-105533868 CTACCTAAATGTCTTCCAGTGGG - Intronic