ID: 1188702503

View in Genome Browser
Species Human (GRCh38)
Location X:33282226-33282248
Sequence CCACCTCGATGTCTTCCTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188702500_1188702503 21 Left 1188702500 X:33282182-33282204 CCAGGTCACTTATTATGATTGTG No data
Right 1188702503 X:33282226-33282248 CCACCTCGATGTCTTCCTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188702503 Original CRISPR CCACCTCGATGTCTTCCTGT CGG Intronic