ID: 1188704882

View in Genome Browser
Species Human (GRCh38)
Location X:33315106-33315128
Sequence ACCGCACCTAGCCACCTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 99}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188704871_1188704882 23 Left 1188704871 X:33315060-33315082 CCACCCGCCTCAGCCTCCCAAAG 0: 20304
1: 108143
2: 164903
3: 177131
4: 137557
Right 1188704882 X:33315106-33315128 ACCGCACCTAGCCACCTTGAAGG 0: 1
1: 0
2: 1
3: 8
4: 99
1188704873_1188704882 19 Left 1188704873 X:33315064-33315086 CCGCCTCAGCCTCCCAAAGTGCT 0: 60215
1: 147830
2: 155736
3: 113395
4: 79914
Right 1188704882 X:33315106-33315128 ACCGCACCTAGCCACCTTGAAGG 0: 1
1: 0
2: 1
3: 8
4: 99
1188704880_1188704882 6 Left 1188704880 X:33315077-33315099 CCAAAGTGCTGGGATTACAGGCA 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
Right 1188704882 X:33315106-33315128 ACCGCACCTAGCCACCTTGAAGG 0: 1
1: 0
2: 1
3: 8
4: 99
1188704872_1188704882 20 Left 1188704872 X:33315063-33315085 CCCGCCTCAGCCTCCCAAAGTGC 0: 59629
1: 175979
2: 229415
3: 270535
4: 297068
Right 1188704882 X:33315106-33315128 ACCGCACCTAGCCACCTTGAAGG 0: 1
1: 0
2: 1
3: 8
4: 99
1188704877_1188704882 10 Left 1188704877 X:33315073-33315095 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1188704882 X:33315106-33315128 ACCGCACCTAGCCACCTTGAAGG 0: 1
1: 0
2: 1
3: 8
4: 99
1188704875_1188704882 16 Left 1188704875 X:33315067-33315089 CCTCAGCCTCCCAAAGTGCTGGG 0: 84188
1: 205795
2: 234195
3: 260821
4: 298692
Right 1188704882 X:33315106-33315128 ACCGCACCTAGCCACCTTGAAGG 0: 1
1: 0
2: 1
3: 8
4: 99
1188704879_1188704882 7 Left 1188704879 X:33315076-33315098 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1188704882 X:33315106-33315128 ACCGCACCTAGCCACCTTGAAGG 0: 1
1: 0
2: 1
3: 8
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188704882 Original CRISPR ACCGCACCTAGCCACCTTGA AGG Intronic
900411672 1:2515371-2515393 ACCGCTCCTGGCCACCTGGTGGG - Intronic
903347010 1:22692838-22692860 ACTGCACCCAGCCTCCTAGAGGG - Intergenic
905927463 1:41762159-41762181 CCCGGACCCAGCCACATTGAGGG + Intronic
907792328 1:57679058-57679080 ACCGCACCTGGCCACCTGTGAGG + Intronic
908208848 1:61879071-61879093 ACCGCACCTGGCCAAATTTATGG + Intronic
909476746 1:76089338-76089360 ACCGCACCCGGCCACACTGAAGG + Intronic
912979532 1:114358162-114358184 ACCTCACCCAGCCCCCTTCACGG + Intergenic
915233037 1:154459997-154460019 ACTGCACCCAGCCACCTCCATGG - Intronic
915318345 1:155042386-155042408 ATCGCACCCAGCCACATTAAGGG + Intronic
916755256 1:167763223-167763245 ACCGCACCCAGCCTTCTTCAAGG - Intronic
919751608 1:201041289-201041311 ACCTCACTCAGCCACCTAGATGG + Intronic
1070728789 10:78810636-78810658 GCAGCCCCTAGCCACCTTCATGG - Intergenic
1074297009 10:112199243-112199265 ACTGCGCCCAGCCACCTGGAGGG + Intronic
1077088380 11:766109-766131 ACTGCACCCGGCCACCTTTACGG + Intergenic
1083953510 11:65970009-65970031 ACCACACCCGGCCACCTAGAAGG + Intronic
1085121554 11:73970619-73970641 ACCGCACCCAGCCACCTTCAAGG - Intergenic
1085388031 11:76168312-76168334 ACCGCCCCTGGCCACCCTCAAGG + Intergenic
1089272945 11:117314707-117314729 ACCTCCACCAGCCACCTTGAAGG + Intronic
1093855157 12:24093230-24093252 ACCGCGCCCAGCCGCTTTGAAGG - Intergenic
1094571310 12:31643848-31643870 ACCGCACCTGGCCCCCTAGCAGG + Intergenic
1102983370 12:117259828-117259850 ACCGCACCCGGCCAGCTCGATGG - Intronic
1104065599 12:125302805-125302827 ACCGCACCCAGCCTGCTTAATGG - Intronic
1104453529 12:128890707-128890729 ACCGCACCTGGCCACCTCCTGGG - Intronic
1104639697 12:130459584-130459606 GCCGCCCTTAGCCCCCTTGATGG - Intronic
1121462903 14:94095734-94095756 AGGGCACCAAGCCACCATGAGGG + Intronic
1122418959 14:101563641-101563663 ACCGCACGCACCCACCTGGACGG + Intergenic
1124152668 15:27195935-27195957 ACCGCACCCAGCCAGCATGATGG + Intronic
1125962979 15:43847937-43847959 ACTGCACCCAGCCAGCATGAGGG - Intronic
1129310044 15:74700901-74700923 ACCACACCCAGCCACCTTTTGGG + Intergenic
1129387666 15:75204797-75204819 ACAGCACCTAGCCACCTCCCTGG + Intronic
1130357056 15:83143293-83143315 ACTGCACCTGGCCCCCTTTAAGG - Intronic
1130863120 15:87908753-87908775 ACCGCAGCAACCCACCTTCAAGG + Intronic
1133421162 16:5648147-5648169 ACTGCACCTGGCCACCTTGTAGG + Intergenic
1133838411 16:9386745-9386767 ACCGCACCCAGCCTCCTGGCTGG - Intergenic
1134060375 16:11196002-11196024 ACCGCACCTGGACAACTTGGTGG + Intergenic
1134688469 16:16175195-16175217 ATCCCAGCTAGCCACCCTGAGGG - Intronic
1135346861 16:21696180-21696202 ACCGCACCTGGCTGACTTGATGG + Intronic
1137399077 16:48138675-48138697 ACTGCACCTGGCCACAGTGAAGG - Intronic
1140780676 16:78293686-78293708 ACCGCACCCAGCCACCTTTTAGG - Intronic
1142606351 17:1083488-1083510 TCCCCACATAGCCACCCTGAGGG - Intronic
1143987881 17:10930780-10930802 ACTGCCCCCAGCCACCTTAATGG - Intergenic
1144003440 17:11076759-11076781 ACCACACCTGGCCACCCTGCAGG - Intergenic
1144442294 17:15294346-15294368 ACCGCACCTGGCCAGCTTTCAGG + Intergenic
1145873101 17:28292910-28292932 ACCGCACCCAGCCGCCTTCTTGG - Intergenic
1146225942 17:31066369-31066391 ACCGCACCCGGCCACCTTTCAGG - Intergenic
1147848903 17:43426003-43426025 ACCGCACCTGGCCAGCTTAGTGG + Intergenic
1151672061 17:75576267-75576289 ACTGCGCCCAGCCACCTTTATGG - Intergenic
1152648894 17:81482891-81482913 ACCGCTCCCAGCCACCCCGATGG - Intergenic
1156526011 18:37768062-37768084 ACTGCACCTAGCCACTTAGTAGG - Intergenic
1159048571 18:63394752-63394774 ACCGCGCCCAGCCAACTTGGGGG + Intronic
1161989443 19:7676453-7676475 ACCGCACCCAGCCTCCTCCAGGG + Intergenic
1162972603 19:14189844-14189866 ACCTCACCTAGACACCTTTCTGG + Intronic
1164646448 19:29861965-29861987 ACCGCGCCTAGCCACCTTTGTGG - Intergenic
1165749970 19:38253520-38253542 ATCCCACCCACCCACCTTGAGGG - Intronic
925394630 2:3524374-3524396 ACCGCGCCTGGCCAACTTGTTGG - Intergenic
925665191 2:6246740-6246762 ACCGCGCCCAGCCAGCTTCATGG - Intergenic
926767900 2:16338288-16338310 ACCTGAGCAAGCCACCTTGAAGG + Intergenic
927230856 2:20823030-20823052 ACCTCACCTGTCCACCTGGAAGG + Exonic
928305898 2:30170172-30170194 CAAGCACCTAGCCACCCTGAAGG + Intergenic
929501831 2:42496914-42496936 ACCACACCCAGCCACCTTTCAGG - Intronic
929813227 2:45209313-45209335 ACCTGATCCAGCCACCTTGATGG - Intergenic
931958756 2:67458323-67458345 ACCGCACCTGGCCATCTGAACGG + Intergenic
940918907 2:159286611-159286633 ACCGCCCGTGGGCACCTTGAAGG - Intronic
941303816 2:163835699-163835721 ACCGCACCCGACCACCTTCAGGG + Intergenic
947785431 2:232814271-232814293 ACCACACCCAGCCAGCCTGAAGG - Intronic
1170177901 20:13493352-13493374 ATAGCACCTACCCACATTGAGGG - Intronic
1171936466 20:31279102-31279124 ACCGCACCCAGCCATCTTTGTGG - Intergenic
1172605670 20:36212008-36212030 ACAGCATATAGCCACCATGAGGG + Intronic
1174783756 20:53413376-53413398 ACCGCACCTGGCCACACTGCAGG - Intronic
1180189011 21:46153901-46153923 ACAGCACCGGGCCACCTTCACGG - Intronic
1180711594 22:17842830-17842852 ACCGCACCCAGCCAGAGTGATGG - Intronic
955240924 3:57177322-57177344 ACCGCACCCAGCCTGCTTGGTGG + Intergenic
961270692 3:125685483-125685505 ACTGCACCCAGCCATGTTGAGGG - Intergenic
963122787 3:141790285-141790307 ACCGCACCCAGCCAGCATTATGG + Intronic
966954554 3:184861109-184861131 ACCGCACCTGGCCAACTTCTTGG + Intronic
970788875 4:19833122-19833144 ACCGCACCCAGCCCCACTGAAGG - Intergenic
981454441 4:144937382-144937404 ACCGCGCCTAGCCACTTCCAGGG - Intergenic
985315425 4:188654319-188654341 ACCGCACCTGGCCAACGTCAGGG - Intergenic
987337417 5:16909217-16909239 ACCGCACCTGGCCAATTTGATGG - Intronic
988513853 5:31888479-31888501 ACCGCACCCGGCCCCATTGAAGG + Intronic
989250918 5:39314158-39314180 ACCGCGCCCAGCCTACTTGAGGG - Intronic
992629730 5:78668552-78668574 ACCGCGCCTGGCCTCATTGATGG + Intronic
992900757 5:81292736-81292758 ACCACACCCAGCCAGCTTTAGGG - Intergenic
1003208624 6:4038550-4038572 ACTGCACCCAGCCACAATGAGGG + Intronic
1005022855 6:21434218-21434240 ACCGCACATGGCCTCCCTGAGGG - Intergenic
1005573689 6:27172080-27172102 ACCGCGCCCGGCCACCATGAAGG + Intergenic
1006073771 6:31516201-31516223 ACCTCACCTAGTCACACTGAGGG - Intergenic
1006709155 6:36050465-36050487 ACCACACCCAGCCATCTTCATGG - Intronic
1017450845 6:154553093-154553115 ACCCCACCCAGCCGCCATGAGGG + Intergenic
1018309805 6:162495958-162495980 ACCGCACCTGGCCACATTAAAGG - Intronic
1019112564 6:169727850-169727872 ACTGCACCCAGCCAACTTGAAGG + Intergenic
1019670180 7:2273612-2273634 ACCGCACCTGGCCTCTTTTATGG - Intronic
1023926627 7:44674382-44674404 AGGGAACCAAGCCACCTTGAAGG - Intronic
1025923343 7:65935596-65935618 ACTGCACCTGGCCCCCTTCATGG + Intronic
1026176353 7:68001241-68001263 ACTGCACCTAGCCAGATTGTTGG - Intergenic
1033243228 7:139698152-139698174 ACTGCACCTAGCCATCTTAATGG + Intronic
1035795087 8:2348490-2348512 ACAGCACATATCCACCTTGCTGG + Intergenic
1037912103 8:22749614-22749636 GCCGCAGCTACCCACCTGGATGG - Intronic
1039272992 8:35903338-35903360 AGGGCACCAAGCCACCCTGAGGG - Intergenic
1046948548 8:119998373-119998395 ACCGCACCTGGCCTCATTGTGGG + Intronic
1050766085 9:9135563-9135585 ATCGCACTTAGCCACCTTCTGGG - Intronic
1061522985 9:131132401-131132423 ACCACACCCAGCCACGTTCATGG + Intronic
1203775812 EBV:72650-72672 ACCGCCCCTGTCCACCTTGTAGG + Intergenic
1188556896 X:31422297-31422319 ACCGCACCTGGCCAGATTGCAGG + Intronic
1188704882 X:33315106-33315128 ACCGCACCTAGCCACCTTGAAGG + Intronic
1193216563 X:78871114-78871136 ACAGCACCCAGCCAACTTCAGGG + Intergenic
1197222937 X:123930939-123930961 ACCGCGCCCAGCCAATTTGATGG + Intergenic
1197788348 X:130223345-130223367 ACTGCACCTGGCCAATTTGAGGG + Intronic
1200391138 X:155948359-155948381 ACTGCACCCAGCCAGATTGAAGG + Intergenic