ID: 1188705140

View in Genome Browser
Species Human (GRCh38)
Location X:33318940-33318962
Sequence AAAGCTAATCCCCAAGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 255}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188705137_1188705140 -3 Left 1188705137 X:33318920-33318942 CCTCCAAAATTTAAATGTTGAAA 0: 4
1: 75
2: 671
3: 2086
4: 4295
Right 1188705140 X:33318940-33318962 AAAGCTAATCCCCAAGAGGTTGG 0: 1
1: 0
2: 0
3: 13
4: 255
1188705138_1188705140 -6 Left 1188705138 X:33318923-33318945 CCAAAATTTAAATGTTGAAAGCT 0: 1
1: 0
2: 100
3: 671
4: 2649
Right 1188705140 X:33318940-33318962 AAAGCTAATCCCCAAGAGGTTGG 0: 1
1: 0
2: 0
3: 13
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188705140 Original CRISPR AAAGCTAATCCCCAAGAGGT TGG Intronic
900845891 1:5100313-5100335 AAAGCTTCTCACCAAGAGTTTGG + Intergenic
900866086 1:5269595-5269617 AAACCTAACCCCCAAGGGGATGG - Intergenic
903350805 1:22715456-22715478 ACAGGTAATGCCCCAGAGGTGGG - Intronic
904888529 1:33760422-33760444 AAAGCTGAGCCCCAAGAGTGTGG - Intronic
905095224 1:35464655-35464677 AAAGTTAATCCCCAAGAAAATGG + Intronic
905763867 1:40583994-40584016 AAAGCTCCTCCCCCAGAGCTGGG + Intergenic
906463722 1:46057916-46057938 AAAGTTAATCCCCAAGACAATGG + Intronic
906471139 1:46132451-46132473 AGAGCGAATCCCCCAGAGGCCGG + Exonic
907392263 1:54165786-54165808 AATGTTAATCCCCAAGACCTTGG - Intronic
907617058 1:55936265-55936287 AAACCTAATCCCCAAGACGATGG - Intergenic
907909186 1:58812254-58812276 AAAACCAATCCCAAAGAGGGGGG - Intergenic
908574256 1:65442188-65442210 AAAGGTGATTCCCAAAAGGTTGG + Intronic
908971919 1:69845939-69845961 AAAGATAATCCTGAAGAGGATGG - Intronic
910956522 1:92712075-92712097 AAAGCTAATCCCAAAGGTGATGG - Intronic
911631233 1:100185719-100185741 AAACCTAATCCCCAAGGTGATGG - Intergenic
911880778 1:103236250-103236272 AATGTTAATCCCCAAGACGATGG + Intergenic
915665290 1:157438915-157438937 AATGCTAATCCTGAAGAGGAAGG + Intergenic
918119818 1:181528976-181528998 AATGTTAATCCCCAAGACGATGG + Intronic
918700057 1:187597209-187597231 AAAGATACAGCCCAAGAGGTGGG - Intergenic
918759851 1:188389991-188390013 AAACCTAATCCCCAATATGATGG - Intergenic
918831628 1:189405655-189405677 AATGTTAATCCCCAAGAGAATGG - Intergenic
920710275 1:208288156-208288178 AAAGGTAAACCCCAGGAGGGAGG - Intergenic
1064002616 10:11676031-11676053 TAAGACAATCCCCAAGAGGGTGG - Intergenic
1064298037 10:14096096-14096118 AAATCTAATTCCCAACACGTGGG + Intronic
1064815889 10:19261667-19261689 TGACCTAATCCCCAAGATGTGGG + Intronic
1065405298 10:25357348-25357370 AATGTTAATCCCCAAGACGATGG + Intronic
1066404517 10:35106061-35106083 AAACCTAATCCCCAATATGATGG + Intergenic
1067368393 10:45658322-45658344 AAAGCAAACCCCCAGGAGCTGGG + Intronic
1068221492 10:54051728-54051750 AATGCTAATCACCAAGACATTGG + Intronic
1068312288 10:55293386-55293408 AATGTTAATCCCCAAGAAATGGG - Intronic
1069095092 10:64249555-64249577 AATGATAATCCCCAAGACGATGG - Intergenic
1069241695 10:66148409-66148431 AAATCTAATCCCCATGGTGTTGG + Intronic
1069587716 10:69619631-69619653 AAATCTAATCCCCAAGACGATGG - Intergenic
1070577184 10:77687968-77687990 AAACCTAATCACCAAGGTGTTGG + Intergenic
1074148319 10:110736792-110736814 AAACCTGATCCCCAAGATGGTGG + Intronic
1075550289 10:123387988-123388010 AATGTTAATCCCCAAGAGAATGG + Intergenic
1078891815 11:15564477-15564499 AATGCTAATGACCAAGAGGATGG - Intergenic
1080651386 11:34225421-34225443 AAAGCTAGAGCCCAAGAGGGTGG - Intronic
1084268573 11:68017323-68017345 ACAGCTGAGCCCCAAGAGGGAGG - Intronic
1087511413 11:99100297-99100319 AAAGCAAATTCCAGAGAGGTAGG + Intronic
1090545541 11:127762751-127762773 GAAGCTACTCCCCAAGAGAAAGG - Intergenic
1092668620 12:10836422-10836444 ATAACTAATCCCCAAGAGAGAGG + Intronic
1093629102 12:21387282-21387304 AATGCTAATCACCAAGATGATGG + Intronic
1094520794 12:31186525-31186547 AAATCTAGTCCTCAAGATGTGGG + Intergenic
1095851698 12:46815877-46815899 AATGCTAATGCCCAAGTGGCTGG - Intronic
1095977436 12:47949363-47949385 AAAACAAATCCACAAGAGGCTGG - Intergenic
1097519027 12:60645176-60645198 AAAGCCAAACCCCAAGAAATAGG - Intergenic
1097522806 12:60689518-60689540 AATGCTAATCCCCAAGACAATGG - Intergenic
1098796800 12:74898855-74898877 AAAGAGAATCCCCAAGATGTTGG + Intergenic
1099746196 12:86708028-86708050 AATGCTAATCCCCAAGACCATGG + Intronic
1102148662 12:110673509-110673531 AATGTTAATCCCCAAGACCTTGG + Intronic
1102758695 12:115366748-115366770 AATGCTAATCCCCAAGACCATGG + Intergenic
1105644622 13:22303568-22303590 AAAGCTAATCACCAAGACAAAGG - Intergenic
1105929347 13:25037562-25037584 AAATCTAAGCCCCAAGATGATGG - Intergenic
1106049683 13:26178470-26178492 AATGCTAATCCCCCAGATGATGG - Intronic
1106496815 13:30286204-30286226 AAAGCTAATCACCAAGACAATGG + Intronic
1108175709 13:47790852-47790874 AATGCTAATCCCCAAGACCTTGG + Intergenic
1108885204 13:55171985-55172007 GAAGCTAATTCTCAAGAAGTAGG - Intergenic
1109167978 13:59059400-59059422 AAAGCTAATCACCAAGGTGATGG - Intergenic
1110377802 13:74814249-74814271 AAAGTTAATCCCCAAGAAAATGG + Intergenic
1111408717 13:87845647-87845669 AAAGCTAAAACCCAAGGTGTTGG + Intergenic
1111489520 13:88953742-88953764 AAAGGTAATGCCCAATAGTTAGG - Intergenic
1111809439 13:93080373-93080395 AAATCTAATCCCCAATGAGTTGG - Intergenic
1112407355 13:99133051-99133073 AAAGCTGGTCCCTAGGAGGTAGG + Intergenic
1113215393 13:108034835-108034857 AAAGCTGGTCCCCAAAAAGTTGG + Intergenic
1115208517 14:30940919-30940941 AAACCTAATCCCCAATATGATGG + Intronic
1115351047 14:32396264-32396286 AAAGCTAAACACCATGAGGCTGG - Intronic
1117181893 14:53200192-53200214 AATGTTAATCCCCAAGATGAGGG + Intergenic
1117828994 14:59732282-59732304 AAAGTTAATCCTGAAGAAGTAGG + Intronic
1118352366 14:64982187-64982209 AAACCTAATCCCCAATATGAAGG - Intronic
1118657550 14:67968297-67968319 AATGCTAATCCCCAAGACAATGG - Intronic
1119150465 14:72354734-72354756 AAATCTAATCCCCAACATGATGG - Intronic
1119206333 14:72796847-72796869 AAAGATGGACCCCAAGAGGTAGG + Intronic
1119265994 14:73263632-73263654 CAAGCTAATCCTGGAGAGGTGGG - Exonic
1121231659 14:92363057-92363079 AAAACTAATGACCAAGAGGAAGG + Intronic
1122580100 14:102766270-102766292 AAAGCAACTCCCCAAGAAGGCGG - Intergenic
1202940563 14_KI270725v1_random:141704-141726 AAATCTAATTCCCAATATGTTGG - Intergenic
1123791686 15:23727508-23727530 AATTCTAATCCCCAAGATGATGG + Intergenic
1123841447 15:24252081-24252103 AAAACTAATACACAAGAGGAAGG - Intergenic
1126126339 15:45297859-45297881 AATGTTAATCCCCAAGATGATGG + Intergenic
1126292898 15:47101535-47101557 AAATCTAATTCCCAATATGTTGG + Intergenic
1127321938 15:57855500-57855522 AAACCTAACCCCCAAGATGATGG + Intergenic
1129105941 15:73307338-73307360 AAAGCTGAGCTCCAAAAGGTTGG + Intergenic
1130293234 15:82623017-82623039 AATGAGAATCCCTAAGAGGTGGG - Intronic
1130824841 15:87533127-87533149 AATGTTAATCCCCAAGACATGGG - Intergenic
1131683670 15:94749409-94749431 AAAGCTAACCCCCAAGGTGATGG - Intergenic
1132317739 15:100902083-100902105 AAAGCTAATCCACAATCAGTGGG + Intronic
1132860194 16:2067054-2067076 AAAGCTCATCCTTAAGATGTTGG + Intronic
1138488593 16:57362901-57362923 AAATAGAATCCCCAAGAGTTGGG - Intronic
1140037618 16:71383197-71383219 AAAGTCACTCCCCAAGAGTTAGG + Intronic
1140348088 16:74234264-74234286 AAACCTAATCACCAAGGGGATGG + Intergenic
1142511730 17:400188-400210 AATCATAATCCCCAAGAGTTAGG + Intergenic
1143213143 17:5204247-5204269 AAATCTAACCCCCAAGATGATGG + Intergenic
1144237340 17:13274391-13274413 AAACCTAATCACCAAGATGATGG + Intergenic
1144451894 17:15388062-15388084 GAACCTAATCCTCAAGAGCTGGG - Intergenic
1145740071 17:27266481-27266503 AAAGCTCATTCCCAAGAGAAAGG - Intergenic
1149896669 17:60433567-60433589 AATGCTAATCCCCAAGACAATGG - Intergenic
1155544816 18:26903975-26903997 AAAGTTAATCACCAAGAAATGGG - Intergenic
1156720011 18:40058544-40058566 ACAGCAATTCCCCAAGAGTTAGG - Intergenic
1156867439 18:41904582-41904604 AAATCTAATCCCCAATATGAGGG + Intergenic
1158516984 18:58138852-58138874 AATCCTAATCCCCAAGATGGCGG - Intronic
1158939868 18:62397470-62397492 AAACCTAATCACCAAGAAGATGG - Intergenic
1162444596 19:10714605-10714627 AAACCTAATCCCCAACATGATGG - Intergenic
1164148545 19:22528808-22528830 AAAGGTAATCTCCAAGAACTAGG + Intronic
1164477800 19:28588762-28588784 AAAGCTAACCCCCAAAATGTAGG + Intergenic
1165123341 19:33577629-33577651 ACAGCTGAGGCCCAAGAGGTTGG + Intergenic
1165524669 19:36343925-36343947 AAACTTAATCCCCAATGGGTGGG - Intronic
927329065 2:21841467-21841489 AATGCTAATCCCCAAGACAATGG + Intergenic
928771467 2:34707076-34707098 AATCCTAATCCCCAAGATGATGG + Intergenic
929134060 2:38605975-38605997 AAGGCTCATACCCAAGAGATAGG + Intergenic
930207447 2:48602191-48602213 AAACCTAACCCCCAAGATGATGG - Intronic
930547336 2:52785415-52785437 AATTCTAATCCCCAAGATGATGG + Intergenic
933947255 2:87297212-87297234 AATGTTAATCCCCAAGACCTTGG - Intergenic
936257485 2:110929582-110929604 AATGCTAATCCCCAAGACAATGG + Intronic
936332937 2:111564356-111564378 AATGTTAATCCCCAAGACCTTGG + Intergenic
936831878 2:116656330-116656352 AAAGCTAATCCCCAAAACAATGG - Intergenic
937346513 2:121129492-121129514 ACAGCAAATCCTCAAGAAGTAGG - Intergenic
937460792 2:122084007-122084029 AAACCTAATCCCCAAGGTGATGG + Intergenic
938842007 2:135173178-135173200 ATAACTAATACCCAAGCGGTTGG + Intronic
938971626 2:136438300-136438322 AAACCTAATCCTCAAGGGGAAGG + Intergenic
939014574 2:136886933-136886955 AGAGCTACTACCAAAGAGGTAGG + Intronic
939079122 2:137639076-137639098 AATGCTAATCCCCAAGACCAAGG + Intronic
939369078 2:141275074-141275096 AAAGCTACTTCCCAGGAGGCTGG + Intronic
942082424 2:172413234-172413256 AAAGCAAATTCCCAAGAGTGAGG + Intergenic
942201199 2:173573163-173573185 AATGCTAATCCCCAAGGTGATGG + Intergenic
942468981 2:176240197-176240219 AAAGCTAATGCTCAGGAAGTCGG + Intergenic
942601283 2:177643665-177643687 AAAGTTAATCCCCAAGACAATGG + Intronic
947375564 2:229491450-229491472 AAACCTAATCACCAAGGTGTTGG - Intronic
948649606 2:239432584-239432606 AAGCCTAATCCCCAAGGTGTTGG - Intergenic
1169652544 20:7885710-7885732 AAAGCTAAGCCCCAAACGATTGG + Exonic
1169999311 20:11596815-11596837 AAGGTTAATCCCCAAGACTTTGG - Intergenic
1171536482 20:25897045-25897067 AAATCTAATTCCCAATATGTTGG - Intergenic
1171804626 20:29664113-29664135 AAATCTAATTCCCAATATGTTGG + Intergenic
1171839427 20:30192313-30192335 AAATCTAATTCCCAATATGTTGG - Intergenic
1176582583 21:8545240-8545262 AAATCTAATTCCCAATATGTTGG + Intergenic
1177736983 21:25103418-25103440 AAAGCTAATCCCCAATAAGATGG + Intergenic
1177980992 21:27915206-27915228 AATGCTAATCCCCAAGACCATGG + Intergenic
1178395600 21:32240227-32240249 AAACCTAATCCCCAACATGGTGG + Intergenic
1178839032 21:36123882-36123904 AAACCTAATCACCAAGATGATGG + Intergenic
1178911164 21:36674733-36674755 AAAGCCAGTTCCAAAGAGGTGGG - Intergenic
1178918050 21:36720077-36720099 AATGCAAATCCCCACGTGGTGGG - Intronic
1180265414 22:10522288-10522310 AAATCTAATTCCCAATATGTTGG + Intergenic
1182843851 22:33414707-33414729 AATCCTAATCTCCAAGAGGATGG + Intronic
951163338 3:19453583-19453605 AAACCTAATCCCCAATATGATGG + Intronic
954385338 3:50241144-50241166 AAACCTAGACCCCCAGAGGTTGG - Intronic
955456802 3:59130621-59130643 AAAGCTAATTCCCTACAGGAAGG - Intergenic
955803341 3:62708472-62708494 AAAGTGAAACACCAAGAGGTTGG + Intronic
956221826 3:66912510-66912532 AAAGCTAATCAGCAAGGGCTGGG + Intergenic
956546430 3:70408248-70408270 AATGTTAATCCCCAAGACATTGG - Intergenic
957703945 3:83755731-83755753 AATGTTAATCCCCAAGAGAATGG + Intergenic
959968346 3:112381259-112381281 AATGTCAATCCCCAAGAGGATGG + Intergenic
960080823 3:113538166-113538188 AAACTTAATCCCCAATAGGATGG - Intronic
960486453 3:118259017-118259039 AATGCTAATCCCCAAGACAATGG + Intergenic
963230196 3:142901641-142901663 AAAGCTCATTTCCAAGAGGAAGG - Intergenic
963958862 3:151285716-151285738 AAATCTAATCCCCAATGTGTTGG + Intronic
964680068 3:159328672-159328694 AGAGCTAAGCCCCAAGAGGCAGG + Intronic
965658250 3:171013705-171013727 AAAGGTAATGCACAAAAGGTGGG + Intronic
966641742 3:182199125-182199147 AAAGCTTATCCCCAGTTGGTAGG + Intergenic
966781810 3:183590624-183590646 AAAGCCAACCCCCTAGAGGAGGG + Intergenic
967180001 3:186895459-186895481 AATGCTAATCCTCAAGACTTGGG - Intergenic
967449965 3:189613108-189613130 AATGTTAATCCCCAAGAGCAAGG + Intergenic
967559870 3:190905414-190905436 AATGCTAATCCCCAAGACAATGG + Intergenic
968013959 3:195310319-195310341 AATGCAAATCATCAAGAGGTAGG + Intronic
968913640 4:3487802-3487824 AAAGCCAATGCCCCACAGGTGGG - Intronic
969128681 4:4974572-4974594 AATGTTAATCACCAAGACGTTGG + Intergenic
969244235 4:5922187-5922209 AAAGCTAATCCCAGAGTGGTGGG + Intronic
969515040 4:7642560-7642582 AAAGCTAATTCTCAAGAAGCAGG + Intronic
970012873 4:11479900-11479922 AAATCTAATCCCCAAGGTGATGG - Intergenic
971431342 4:26571138-26571160 AAATCTAATCACCAAGATATTGG - Intergenic
971814921 4:31475413-31475435 AATGCTAATCCCCAAGACAATGG - Intergenic
971815054 4:31476646-31476668 AATGCTAATCCCCAAGACAATGG - Intergenic
972721595 4:41704746-41704768 AAAGCTACAACCCAAGAGATTGG + Intergenic
973986324 4:56357430-56357452 AAATCTAATCCCCAATCTGTTGG - Intronic
975052610 4:69884044-69884066 AAAGTTAATCACCAAGAGAATGG - Intergenic
976051618 4:81016884-81016906 AAAGTTAATCCCCAAGACAATGG - Intergenic
976286492 4:83375794-83375816 AATGTTAATCCCCAAGACCTTGG - Intergenic
976563637 4:86529640-86529662 ACACATACTCCCCAAGAGGTTGG + Intronic
976780424 4:88752264-88752286 AAACTGAAACCCCAAGAGGTGGG + Intronic
978155214 4:105481979-105482001 ACAGCTAATCCCAAAGTGCTAGG - Intergenic
978353995 4:107850846-107850868 AAAGCAAAGCCCCCAGAAGTTGG - Intronic
978774402 4:112491097-112491119 AATGTTAATCCCCAAGACGATGG - Intergenic
979078348 4:116303395-116303417 AATGTTAATCCCCAAGACATTGG + Intergenic
980614073 4:135195192-135195214 AAATATAATCCCCAGGAGGTGGG + Intergenic
980802246 4:137766759-137766781 AATTCTAATCCCCAAGACGATGG - Intergenic
981820424 4:148880565-148880587 AAAGTTAATCCCCAAGACAATGG - Intergenic
982091295 4:151882041-151882063 AAATCTAACCCCCAAGATGATGG - Intergenic
982165185 4:152607787-152607809 AAATCTAATCACCAAGATGATGG + Intergenic
985169215 4:187130499-187130521 AAATCTAATTCCCAACATGTTGG + Intergenic
986430171 5:7673719-7673741 AAAGCCAATAGGCAAGAGGTGGG + Intronic
988149910 5:27364404-27364426 AATGCTAATCCCCAAGACAATGG + Intergenic
988820094 5:34874752-34874774 AAAGCAAAACCACAAAAGGTAGG + Intronic
988833205 5:35007036-35007058 AAACCTAATACCCAAGGGGATGG + Intronic
989112493 5:37919935-37919957 AAAGGTAATACCAAAGCGGTAGG - Intergenic
990682929 5:58265806-58265828 AAAGCTGTTCCACAAGAGGCTGG + Intergenic
991615969 5:68497739-68497761 AAAGTTAATCCCCAAGACAATGG + Intergenic
992763086 5:79969013-79969035 AAGGCTAAGCCCAATGAGGTAGG - Intergenic
993569909 5:89524266-89524288 AATGTTAATCCCCAAGAAATAGG - Intergenic
994471632 5:100215316-100215338 AAACCTAATCCCCAATATGATGG + Intergenic
995037611 5:107553026-107553048 AAAGCTAATTCCTTAGAGGAGGG - Intronic
995825863 5:116298375-116298397 AATGCTAATGCTTAAGAGGTAGG + Intronic
996033545 5:118733508-118733530 AAAGTTAATCCCCAAGACAATGG + Intergenic
996039934 5:118798190-118798212 AATGCTAATCCCCAAGACAATGG + Intergenic
998542270 5:142993725-142993747 ATAGCTTGACCCCAAGAGGTTGG - Intronic
1000185335 5:158852209-158852231 AAAGCTATTCCCCAAGGTGTGGG + Intronic
1003360609 6:5421414-5421436 AAAGTTAATCCCCAAGACAATGG - Intronic
1004503715 6:16230612-16230634 TAAGCTAACCCCCTAAAGGTTGG - Intergenic
1005824877 6:29626843-29626865 AAGGCTAATGATCAAGAGGTGGG - Intronic
1007799227 6:44377883-44377905 AAACCTAATCCCCAAGGTGATGG - Exonic
1008346823 6:50437809-50437831 AAAGCTAATCCCCAGTATGATGG + Intergenic
1008980057 6:57472891-57472913 CAATTTGATCCCCAAGAGGTTGG - Intronic
1009608263 6:65902673-65902695 AAAGCAAACCTCCCAGAGGTGGG + Intergenic
1010651079 6:78455908-78455930 AATGTTAATCACCAAGAGGATGG - Intergenic
1011441395 6:87391043-87391065 AAACCTAATCCCCAAGGTGATGG - Intronic
1012485838 6:99722143-99722165 AATGTTAATCCCCAAGACATAGG + Intergenic
1013639230 6:112057201-112057223 AGAGCTAAAGCTCAAGAGGTAGG + Intronic
1014863302 6:126496909-126496931 AATGTTAATCCCCAAGAGCATGG - Intergenic
1017054249 6:150423768-150423790 AAACCTAATCCCCAAGGTGATGG - Intergenic
1017073678 6:150599556-150599578 AAAGCTAAACCTGAAGAGCTAGG + Intergenic
1017299942 6:152845312-152845334 AATCCTAATCCCCAAGATGATGG + Intergenic
1019134318 6:169898815-169898837 ACAGCGAATCCCCAGGATGTGGG - Intergenic
1020500768 7:8917507-8917529 AAACCTAATCCCCAATGTGTTGG + Intergenic
1024556683 7:50609664-50609686 GAAACTCATCCCCAAGAGGGAGG - Intronic
1025287949 7:57683756-57683778 AAATCTAATTCCCAATATGTTGG - Intergenic
1026595930 7:71733924-71733946 AAAGATATTACCCAAGAGGTGGG + Intergenic
1027605415 7:80292974-80292996 AAAGTTAATCCCCAAGACAATGG - Intergenic
1030452612 7:109731424-109731446 AATGTTAATCCCCAAGATGATGG - Intergenic
1030563959 7:111127967-111127989 AAAGCTAAGCAGCAACAGGTTGG + Intronic
1031174987 7:118338873-118338895 AATGTTAATCCCCAAGACCTTGG + Intergenic
1033412065 7:141127137-141127159 GAACCAAATGCCCAAGAGGTAGG - Intronic
1034974443 7:155439666-155439688 AAAGCTAACCCCCCTTAGGTGGG + Intergenic
1035578287 8:723074-723096 AGAGCTCATCACCATGAGGTGGG - Intronic
1035951873 8:4030648-4030670 AAAGTTAATCCCCAAGACCATGG - Intronic
1037327347 8:17706040-17706062 ACAGTTAGACCCCAAGAGGTTGG + Intronic
1037770994 8:21799746-21799768 CAAGCTAATCCCCCTGAAGTGGG + Intronic
1037868489 8:22468009-22468031 AAACCTAATCCCCAACATGGTGG - Intronic
1038535141 8:28348397-28348419 CAAGCTAATCCCCTAGAGAGTGG + Exonic
1040468617 8:47717647-47717669 ACAGCTAATGCCCAACAGGGAGG - Intronic
1041748071 8:61231018-61231040 AAACCTAATCCCCAAGGTGATGG - Intronic
1041872627 8:62652160-62652182 AAACCTAATCCCCAAGATGATGG - Intronic
1042457829 8:69025875-69025897 AAAGCTGAACCTCAAGATGTAGG + Intergenic
1042739789 8:72030333-72030355 AAACCTAATCACCAAGAAGATGG - Intronic
1042755472 8:72205731-72205753 AAACCTAATCACCAAGAAGATGG - Intergenic
1046041308 8:108908653-108908675 AAAGCTAAACTCCAAGATTTGGG + Intergenic
1046656284 8:116898956-116898978 AATGCTAATCCCCAAGACCATGG + Intergenic
1047197615 8:122735655-122735677 AAATCGAATCCCCAATATGTTGG - Intergenic
1047619252 8:126589546-126589568 ACTGCTAATCCCCGAGAGCTTGG + Intergenic
1048446228 8:134495416-134495438 AAATCTAATCCCCAAAATGATGG - Intronic
1050685881 9:8168959-8168981 AAAGCCAATACCCAAGATCTTGG - Intergenic
1050695627 9:8276127-8276149 AAAGTTAATCCCCAAGACAATGG - Intergenic
1050730745 9:8706731-8706753 AAAGCTAATTGCCAAGAGTCAGG + Intronic
1050909896 9:11055577-11055599 AATGTTAATCCCCAAGAGGATGG + Intergenic
1052403470 9:28030043-28030065 AAAGCTGATCCCCAAGGAGAAGG + Intronic
1055700387 9:78938618-78938640 AATGCTAATGCCCAATAGGATGG - Intergenic
1061752966 9:132793320-132793342 AAATCTAATCCCCAAGACAATGG - Intronic
1061979842 9:134095817-134095839 AAACCCAATCCCCAAGACGATGG + Intergenic
1062157953 9:135064165-135064187 AATGTTAATCCCCAAGACGATGG - Intergenic
1186450943 X:9673121-9673143 AAATCTAACCCCCAAGGGGATGG - Intronic
1186890423 X:13954146-13954168 AATCCTAATCCCCAAGATGATGG - Intergenic
1187740466 X:22350000-22350022 AAAGATAATACCAAAGAGGATGG - Intergenic
1188069844 X:25705479-25705501 AATGCTAATCCCCAAGACAATGG + Intergenic
1188705140 X:33318940-33318962 AAAGCTAATCCCCAAGAGGTTGG + Intronic
1193614500 X:83671305-83671327 AAAGTTAATCCCCAAGACTGTGG + Intergenic
1194662060 X:96638894-96638916 AATGCTAATCCCCAAGACAAGGG + Intergenic
1194878209 X:99216511-99216533 AAAGCTACTCCTTAAGAGCTTGG + Intergenic
1197132979 X:123026522-123026544 AAAGGTAATCCACAACAAGTAGG - Intergenic
1197307120 X:124856496-124856518 AAAGTTAATTCCCAAGAGAAGGG + Intronic
1197355513 X:125434217-125434239 GAAGCTCAACCCCAAGAAGTAGG - Intergenic
1199511739 X:148630299-148630321 AAACCAAATCACCAAGATGTGGG - Intronic
1200393186 X:155964958-155964980 AAACCTAACCTCCAAGAGGATGG - Intergenic