ID: 1188705634

View in Genome Browser
Species Human (GRCh38)
Location X:33326115-33326137
Sequence TAGTAATATTAGAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 293}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188705630_1188705634 30 Left 1188705630 X:33326062-33326084 CCTAAACTGAATGAGGAGGAATC 0: 1
1: 1
2: 2
3: 18
4: 268
Right 1188705634 X:33326115-33326137 TAGTAATATTAGAGGGAAGAAGG 0: 1
1: 0
2: 1
3: 28
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188705634 Original CRISPR TAGTAATATTAGAGGGAAGA AGG Intronic
904582496 1:31556131-31556153 CAGTATTACTAGAGGTAAGATGG - Intergenic
904633669 1:31862935-31862957 TATAAATATTAGAAGGAAGGAGG + Intergenic
906884385 1:49628819-49628841 TATTTATATTTGAGAGAAGAGGG - Intronic
907365923 1:53959843-53959865 TACTAATTTCAGAGGGCAGAGGG - Intronic
908319860 1:62968675-62968697 TGGGACTATTAGAGGGAGGATGG + Intergenic
908690962 1:66780127-66780149 AACTAAGATTAGAAGGAAGATGG + Intergenic
909979324 1:82079789-82079811 TGTTAATATTAGGGGGAAGCTGG - Intergenic
910290807 1:85598724-85598746 TAGTAATATGAGAGCATAGAGGG + Intergenic
913711117 1:121484647-121484669 TAGAAATAATAGAGGCTAGATGG + Intergenic
916204693 1:162304522-162304544 AAGAAATATTAGAGGGAATGGGG + Intronic
917504848 1:175618429-175618451 TAGTAAAATTAAAGGGGAGAGGG - Intronic
919010585 1:191956755-191956777 TAGTAAAATTAGAGGCTAAAAGG + Intergenic
919524434 1:198629693-198629715 AAATAATATTAGAGGAAATATGG + Intergenic
919630668 1:199957406-199957428 CAGTAATAATATAGAGAAGAAGG - Intergenic
920270177 1:204756826-204756848 TAGGAAAATTAGAGGCAAGGTGG + Intergenic
921116889 1:212100364-212100386 TAGGAGTATTTGAAGGAAGAGGG - Exonic
921557551 1:216616704-216616726 TAGAGATAATAGAGAGAAGAGGG - Intronic
922058764 1:222067246-222067268 TAGAAATATTTTAGGGAATAAGG + Intergenic
924056559 1:240129879-240129901 TAATTATATTAGAAGGAAGAAGG - Intronic
924069809 1:240264864-240264886 CAATAATATCAGAGGGAAGGAGG - Intronic
1067782030 10:49214776-49214798 TATTAATAAAAGGGGGAAGAGGG + Intergenic
1067825508 10:49569671-49569693 TTGTAAGATTAGAAGCAAGATGG + Intergenic
1068438991 10:57027964-57027986 TAGTAATATTGAAGTTAAGAAGG - Intergenic
1068827331 10:61453876-61453898 TAGCAAGATAAGACGGAAGAAGG + Intergenic
1070079985 10:73176507-73176529 AAGTAATAGAACAGGGAAGATGG + Intronic
1073687384 10:105770110-105770132 CAGTAATATTTGAGGGAATCTGG + Intergenic
1074264692 10:111889819-111889841 AAGAAATATAAGAGGGAGGATGG - Intergenic
1079793347 11:24767144-24767166 TAGAAATTTTGGAGGGAAAATGG - Intronic
1080918142 11:36680956-36680978 TACTTATATTTGAGGGAAGATGG + Intergenic
1081165931 11:39809307-39809329 TAGTAAAAGAAGAGAGAAGAAGG + Intergenic
1081801613 11:45863611-45863633 TAGCAATACTAGATAGAAGAAGG + Intronic
1082681563 11:56178852-56178874 TAATAATATTATAGTGATGATGG - Intergenic
1086193153 11:84104409-84104431 GGGAAATATAAGAGGGAAGAAGG + Intronic
1086577394 11:88355557-88355579 TAATAATATTAAAAGAAAGAAGG + Intergenic
1088190926 11:107227369-107227391 TAGAAATAAAAGAAGGAAGAGGG - Intergenic
1090919480 11:131195443-131195465 TAGTATTATCAGAGTGTAGAGGG - Intergenic
1091511131 12:1127345-1127367 CAGTATTATTTGTGGGAAGAAGG + Intronic
1092511262 12:9159216-9159238 TAGCAACATGAGAAGGAAGAGGG + Intronic
1093507104 12:19880496-19880518 TTGTAATATTATAGGATAGAGGG - Intergenic
1094179040 12:27571427-27571449 TGGTAAAATGAGAGGGAAAATGG + Intronic
1096564070 12:52461533-52461555 AATTAAAATTAGAGGGAAGATGG + Intergenic
1097480818 12:60123668-60123690 TGGTAATGATAGAGAGAAGATGG - Intergenic
1099048762 12:77757423-77757445 TTGTAGAATTAGAGAGAAGAAGG - Intergenic
1099321707 12:81158894-81158916 TAGTACAGTTAGAGGAAAGAAGG - Intronic
1104203741 12:126616820-126616842 TAGTCGTATCAGATGGAAGATGG + Intergenic
1105512702 13:21063828-21063850 TGTTTATATTAGAGGGAAGGAGG + Intergenic
1105679348 13:22709600-22709622 TGGTAATATTGGAGAGAAAAGGG + Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106751307 13:32771654-32771676 TAGAAAAATTACATGGAAGATGG - Intronic
1107571091 13:41658860-41658882 CAGTAATATTACATGGGAGAAGG + Intronic
1107888141 13:44891539-44891561 TGCTAATATCAGAGGGAAAAGGG + Intergenic
1108281246 13:48864446-48864468 TAGTAATATTGGAAGGCAGAGGG - Intergenic
1108693825 13:52885142-52885164 TAGTAACACTAGTGGGAAGTGGG + Intergenic
1108893048 13:55286462-55286484 TAGTAAACTTAGAGTGAAAAGGG - Intergenic
1109065385 13:57682152-57682174 TAGGAGTATAAGAAGGAAGATGG - Intronic
1109382622 13:61584601-61584623 TAGTAATGTTTCAGGCAAGAGGG - Intergenic
1109816805 13:67595199-67595221 TAGTAACCATAGAGGGAAAAAGG + Intergenic
1109880544 13:68468487-68468509 TAGTAATATTATAAGGAAATAGG + Intergenic
1110967414 13:81716941-81716963 TAATAATAGTATAAGGAAGAGGG - Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1111870110 13:93821347-93821369 TAATAATGTTATAGGGATGAGGG + Intronic
1112245008 13:97725309-97725331 CAGTGTTATTAAAGGGAAGAAGG + Intergenic
1112317108 13:98372619-98372641 TAATAAGAAAAGAGGGAAGATGG + Intronic
1113519234 13:110927041-110927063 TAGTAAACAGAGAGGGAAGAGGG - Intergenic
1114539520 14:23444295-23444317 TAGGGATACTAGAGGCAAGAGGG - Intergenic
1115220123 14:31050402-31050424 TATTCATATTAAAGTGAAGATGG - Intronic
1115434437 14:33357165-33357187 ATGTGAAATTAGAGGGAAGATGG + Intronic
1115656627 14:35449521-35449543 TAATAATAGTACAGGTAAGAAGG + Intergenic
1115904192 14:38188880-38188902 TATAAAGATGAGAGGGAAGATGG + Intergenic
1117944347 14:61001758-61001780 AATGAATATTAGAAGGAAGAAGG - Intronic
1119672781 14:76532099-76532121 TTGTAATATTAGTGGGAAGAGGG - Intergenic
1120607826 14:86601623-86601645 GAATAATATTAAAGGTAAGATGG + Intergenic
1121186675 14:91978420-91978442 TACTAATTTTAGAGGAAAGTAGG - Intronic
1122319043 14:100842375-100842397 AAGTAAAATTAGAGGGCTGATGG + Intergenic
1124012819 15:25852327-25852349 TATTTAAATTGGAGGGAAGATGG - Intronic
1124705960 15:31964394-31964416 TAGAAATATGGGATGGAAGAAGG + Intergenic
1125255910 15:37762633-37762655 TAGTAAAATTGGCAGGAAGATGG + Intergenic
1125843206 15:42825147-42825169 AAGGAATATGAGAGGGAAGAGGG + Intronic
1126370906 15:47946109-47946131 TAGCAATGTCAAAGGGAAGAAGG - Intergenic
1126741424 15:51780094-51780116 AAGTAATATTTCAGGGAACAGGG + Intronic
1127675102 15:61230576-61230598 TAATATTATTAGAGGCCAGAAGG + Intergenic
1127720691 15:61695811-61695833 TAGAAACTTCAGAGGGAAGATGG + Intergenic
1128589033 15:68878090-68878112 TAGGAGTATTGGAGGGGAGAAGG + Intronic
1130534461 15:84773654-84773676 TCATAATACTAGAGAGAAGAGGG - Intronic
1131773124 15:95762766-95762788 TAGTATTAATAGAGAGGAGATGG - Intergenic
1133858825 16:9575010-9575032 AAGGAATATTAAAGAGAAGAAGG - Intergenic
1135257940 16:20956280-20956302 TAACAATTTTAAAGGGAAGATGG - Intronic
1139098795 16:63739700-63739722 TAACAATATTAGAGGTTAGAGGG + Intergenic
1141809557 16:86365872-86365894 TTGGAATATTTGAGGAAAGATGG - Intergenic
1143671005 17:8396155-8396177 AAGGAATACTAGAGGGAAAAAGG + Intronic
1144157382 17:12519289-12519311 AAGTACTATTAGAGTGCAGAGGG - Intergenic
1147306138 17:39565728-39565750 TAGAAATATGAGAGGGAAGCTGG - Intergenic
1147482168 17:40776451-40776473 TAGTGATATTTGAAGGTAGAAGG - Intergenic
1147511552 17:41073414-41073436 TGGTAATATTAGTGAGAAAAAGG + Intergenic
1147571435 17:41573458-41573480 GAGTATTCTTAGAGGGAAGAAGG - Intergenic
1148620724 17:49032638-49032660 TAGTATTATTAGATTGGAGAAGG - Intronic
1149529012 17:57380144-57380166 TAATAATAAGAGCGGGAAGAGGG - Intronic
1151349708 17:73524566-73524588 CAGTCATGCTAGAGGGAAGAGGG - Intronic
1153175040 18:2362212-2362234 TGGTAATATGACAGGGAACATGG + Intergenic
1155232558 18:23787635-23787657 TAGTAACAATAGAGGCAAGAAGG + Intronic
1155852945 18:30795126-30795148 TTGTAAAATTACATGGAAGAAGG + Intergenic
1156824835 18:41418568-41418590 CAGGAATAAAAGAGGGAAGAAGG - Intergenic
1158287105 18:55895898-55895920 TTGTAATATAGGATGGAAGAAGG + Intergenic
1159748301 18:72268032-72268054 AAGTAGGATTAGAGGCAAGAAGG - Intergenic
1160884107 19:1336947-1336969 TATTAATAATAGAAAGAAGAAGG - Intergenic
1162594756 19:11619676-11619698 CAGTCATATTAGTGAGAAGAGGG + Intergenic
1163686246 19:18713572-18713594 CAGTAACATTGGAGGGAGGAGGG - Intronic
1164787882 19:30950056-30950078 TAGTAATTTTACAGTGGAGAAGG - Intergenic
1164967027 19:32494183-32494205 TACTAAGATTGGAGGGAAGAAGG + Intergenic
1165648104 19:37461622-37461644 TTGTAATATTAGAGGAAGTAAGG - Intronic
1165755201 19:38288867-38288889 TCCTAATATTATAGGGAACACGG - Intronic
1167890751 19:52537237-52537259 GAGGAGTAATAGAGGGAAGAAGG + Intronic
1167898779 19:52602454-52602476 GAGAAGTAATAGAGGGAAGAAGG + Intronic
1167921256 19:52785182-52785204 GAGAAGTAATAGAGGGAAGAAGG - Intronic
1167940306 19:52941400-52941422 GAGAAGTAATAGAGGGAAGAAGG - Intronic
1167964361 19:53131672-53131694 GAGAAAGAATAGAGGGAAGACGG - Intronic
925395470 2:3530227-3530249 TAGTAGTACTACGGGGAAGAAGG + Intergenic
925395489 2:3530369-3530391 TAGTAGTAGTATGGGGAAGAAGG + Intergenic
925395504 2:3530480-3530502 TAGTAGTAGTACGGGGAAGAAGG + Intergenic
925395517 2:3530585-3530607 TATTATTAGTAGGGGGAAGAAGG + Intergenic
927505728 2:23613338-23613360 TAGAAAGATTAAAGGGAAAAGGG + Intronic
927730277 2:25465072-25465094 TAGCAATATTAGAAGAAACAGGG + Intronic
929232420 2:39573224-39573246 TAGAAATAGTGGAGGGGAGAGGG + Intergenic
930313203 2:49768269-49768291 TAGTAAGATTAGAGGATAAAAGG + Intergenic
931471966 2:62547445-62547467 TAATATTAGTAGTGGGAAGAGGG - Intergenic
932528980 2:72505565-72505587 TAGTTTTATTATAGGGAAGATGG - Intronic
932817575 2:74874192-74874214 CAGTAGTATAAGAGGGAAGAGGG + Intronic
933483545 2:82888564-82888586 TAGGAATATTAATGGGAAGTGGG - Intergenic
935037324 2:99391267-99391289 GAGTAAGCTGAGAGGGAAGAAGG + Intronic
935852861 2:107242094-107242116 AAGTAATATTAACAGGAAGAGGG + Intergenic
936724527 2:115296838-115296860 TATTACTAATGGAGGGAAGAAGG - Intronic
938632302 2:133180126-133180148 TAGGAATCTTGGAGGGCAGAAGG + Intronic
939719006 2:145623840-145623862 TAGTTATGTGAGAGTGAAGAAGG - Intergenic
940123491 2:150295021-150295043 TAATAATAATAAAGGGATGATGG - Intergenic
942500620 2:176586660-176586682 TAGTAACATTAGAGAGAAGGAGG - Intergenic
942578202 2:177388488-177388510 TAATACTATTAGTGGGAATAAGG - Intronic
943808751 2:192157670-192157692 TATTAAAATTTGAGGGAATAGGG - Intronic
944013853 2:195008220-195008242 TAGGAATATTACAAGTAAGAAGG - Intergenic
944126205 2:196295620-196295642 TAGTTATTTTAGTGAGAAGAGGG - Intronic
944214124 2:197236914-197236936 CAGAAATATTAGAGGAAAAATGG + Intronic
944875278 2:203958332-203958354 TGGTACTGCTAGAGGGAAGAAGG + Intronic
944980167 2:205108513-205108535 TTGTAATATTAGAGAGAGGGAGG - Intronic
945863705 2:215153098-215153120 TAGTAATTCTAGAGGAAAGGTGG - Intergenic
947975861 2:234365228-234365250 TAGTAATGTTACAGGAAAGGGGG - Intergenic
1169182619 20:3583227-3583249 TTGCAATTTTGGAGGGAAGAAGG - Intronic
1169684467 20:8255258-8255280 TAGTAATATCAGAGGTAGTAAGG + Intronic
1171818968 20:29815321-29815343 TAGTAAAATCAGAGGTAAAAAGG - Intergenic
1171938628 20:31302072-31302094 AAGAAATATTACAGGGCAGATGG + Intergenic
1172818068 20:37705667-37705689 TAGTAATATTAAAGAGACCACGG - Intronic
1173149969 20:40558646-40558668 AAGAAATAATGGAGGGAAGAAGG + Intergenic
1173239388 20:41280338-41280360 CAGTATTTATAGAGGGAAGAGGG + Intronic
1176901842 21:14451761-14451783 TGGTAATATTAGTGGGATTATGG - Intergenic
1177093542 21:16801186-16801208 TAGTACTAATAGAGGAAAGAAGG - Intergenic
1177415517 21:20788195-20788217 TAGTAAGATTATATGGAGGAGGG - Intergenic
1178005479 21:28215236-28215258 GAGTAAGATGAGAGGGAAAAGGG - Intergenic
1181118437 22:20649230-20649252 GAATAATATTACAGGGGAGAAGG + Intergenic
1181497875 22:23298184-23298206 AAGTAACATCAGGGGGAAGAGGG + Intronic
1182869239 22:33631753-33631775 TAATAATACTAGAGAGAAAATGG - Intronic
1182969795 22:34563090-34563112 TAGGGCTATTAGAGGGGAGAGGG - Intergenic
1182980313 22:34664258-34664280 TAGAAAAACTAGAGGGAAAAAGG + Intergenic
1183461810 22:37955605-37955627 TAGCAATATTTGGGGGCAGATGG + Intronic
1183914091 22:41102724-41102746 TGGAAAGATTTGAGGGAAGATGG + Intronic
949252421 3:2002483-2002505 TAGCTATTTTAGAGGGAAGATGG + Intergenic
951662343 3:25082999-25083021 TAGCAATAATACAGGCAAGAAGG - Intergenic
955104593 3:55885068-55885090 GTGTGATGTTAGAGGGAAGAGGG - Intronic
955473726 3:59313741-59313763 AAGTAAGATTAGAAGGAAGTAGG - Intergenic
956963523 3:74431719-74431741 TAGTTCTTTTAGAGGGAAAATGG - Intronic
957111828 3:75971349-75971371 AAGTAATATTTGAGTGATGAAGG + Intronic
957457960 3:80477675-80477697 TAGTAGTATTCTAGAGAAGAAGG + Intergenic
958028269 3:88074793-88074815 TAGTGATATCAGAAGGACGATGG + Intronic
958738626 3:98040848-98040870 TATTAATATTAGAGACAAAAAGG - Intergenic
959204964 3:103295556-103295578 AAGTAATTTTACAGTGAAGATGG - Intergenic
959749304 3:109814310-109814332 TGGTGAAGTTAGAGGGAAGATGG + Intergenic
959948025 3:112148430-112148452 TAATATTATTAAAGGGAAAAAGG - Intronic
960590364 3:119359948-119359970 TAATGATACTTGAGGGAAGAGGG - Intronic
961526829 3:127507507-127507529 TGTTAATATTAGAGGTTAGAGGG - Intergenic
961944437 3:130671319-130671341 GAGAAATATGAGTGGGAAGAGGG + Intronic
962302994 3:134259804-134259826 TAGGAATTTTAGAAAGAAGATGG - Intergenic
962690415 3:137891277-137891299 TAGGATTTTTATAGGGAAGAGGG + Intergenic
963190610 3:142467720-142467742 TAGAAATATTAGAGGGTATTTGG + Intronic
965001323 3:162957886-162957908 TACTAAAATAAGAGGCAAGAAGG - Intergenic
965570102 3:170163897-170163919 TAGTAATAATATAGGAAAGCAGG + Intronic
970459499 4:16258542-16258564 TAGGGATATTATAGAGAAGAAGG - Intergenic
970604422 4:17666045-17666067 TGCAAATATCAGAGGGAAGAGGG - Intronic
971272468 4:25163480-25163502 GAGTAATAAAAGAGGGAAGCTGG - Intronic
971500308 4:27311759-27311781 TAGAAACATTAGAGAGAAGTCGG + Intergenic
972485765 4:39538851-39538873 TATTAATACTAGAGGGCACAAGG + Intergenic
974893044 4:67905441-67905463 TAATAAAATTAGAGACAAGAAGG - Intergenic
975167220 4:71190142-71190164 TAGGAATCTTAGAGGAAAGGAGG + Intronic
975204859 4:71633378-71633400 AAGTAATATAAGAGGTCAGAAGG + Intergenic
975671498 4:76785487-76785509 TTTTAATCTTTGAGGGAAGATGG - Intergenic
976458367 4:85277755-85277777 TATTAACATTAGAGGCAAGTGGG - Intergenic
976794154 4:88913415-88913437 AAGTAGTAGTAGAGGGAAGAGGG + Intronic
977070617 4:92380998-92381020 AAATAATATTGGAGGGAAAAGGG - Intronic
977239412 4:94548728-94548750 TACTAAGCTTAGAGGGAAGTGGG - Intronic
977282042 4:95051902-95051924 TAGTAAAATTACAGGGCAGTTGG - Intronic
979001406 4:115225508-115225530 TAGAGATATTTGAGGAAAGATGG + Intergenic
979513247 4:121577729-121577751 TAGTAATAGTAGAGATAAAAAGG + Intergenic
980056035 4:128080834-128080856 TCAAAATATAAGAGGGAAGAGGG - Intronic
980191799 4:129533862-129533884 TAGTAATATTTGAGGGGTAAGGG - Intergenic
980681276 4:136165121-136165143 TAGTAATATTAGACTTAAAATGG + Intergenic
980820055 4:138003393-138003415 TGGTAAGGTTAGAGAGAAGAGGG + Intergenic
981119399 4:141031919-141031941 GAATAATATTACAGGGAACATGG - Intronic
981406298 4:144373780-144373802 TAGAAAGAGTTGAGGGAAGAAGG - Intergenic
983109405 4:163729704-163729726 TACTAATATCAGATGAAAGAGGG - Intronic
986366634 5:7039480-7039502 TAGTAATATTGGATTGATGAGGG + Intergenic
986500810 5:8397452-8397474 TAGGAATGGTAGAGGGAAGCGGG + Intergenic
986893395 5:12336206-12336228 TGGTAATGATAGAGGAAAGAGGG + Intergenic
986968306 5:13302100-13302122 TGGTAATATTAGACGGATAATGG + Intergenic
987138304 5:14920165-14920187 TTGTAAAGTTAAAGGGAAGAGGG + Intergenic
987688339 5:21233712-21233734 TATTAATAGTAGAGGAGAGAGGG + Intergenic
990477898 5:56179404-56179426 TAGTTATTTTAGAGGAATGAAGG + Intronic
991545409 5:67776453-67776475 TAGTAATAATAGAAGAAAAATGG - Intergenic
991914073 5:71588569-71588591 TAATAATTTTGTAGGGAAGATGG + Intronic
993245741 5:85450846-85450868 TAGAAATAGTAGAGGGAGGTGGG + Intergenic
993416471 5:87639317-87639339 TAGTGATATTGGAGGGATCAGGG - Intergenic
993878006 5:93330513-93330535 TACTTAAATGAGAGGGAAGAAGG - Intergenic
994757123 5:103808186-103808208 TTGTAATATTACATGGAAGAAGG - Intergenic
995277689 5:110295496-110295518 TTGAAAAATTAGAGGGAAAAGGG - Intronic
995813880 5:116144326-116144348 AAGTAAAGTTAGAGGGAAGCAGG + Intronic
995885644 5:116891335-116891357 TAGTAATTTTTGAGAGAACATGG + Intergenic
996108294 5:119533417-119533439 TAGTAATAATGGAGAGGAGAGGG + Intronic
996186063 5:120476758-120476780 TAGTAATTTTTAGGGGAAGAGGG - Intronic
996437398 5:123450058-123450080 TAGAAATATTAACGGGAAAAAGG - Intergenic
997293499 5:132754710-132754732 AAAGAATATTAGAGGGAAGTAGG - Intronic
997685890 5:135788077-135788099 TAGTAATATCTGAGGGGAGACGG + Intergenic
998078339 5:139254581-139254603 TATTAACATTAGAGGAAAGCTGG + Intronic
998495549 5:142585535-142585557 TAGTGATAGAAGAGGGAAGCTGG - Intergenic
999124513 5:149237394-149237416 TAGAAAGATAAGAGGGAAAAGGG - Intronic
999503575 5:152171045-152171067 TATTACTATTAGAGGAAAGCTGG + Intergenic
1003005312 6:2375723-2375745 TAGGAACATAAGAGAGAAGACGG - Intergenic
1003256162 6:4476741-4476763 AAGAAAATTTAGAGGGAAGAAGG - Intergenic
1005202089 6:23358805-23358827 TAGTAACAGTAGTGTGAAGAAGG + Intergenic
1005275169 6:24209276-24209298 TAGTAGTAATAAAGGGAATATGG - Intronic
1007055131 6:38875503-38875525 TAGTAAAATTAAAAGGAGGAAGG - Intronic
1007851883 6:44810989-44811011 TACTAATAATAGAGGAAAGTAGG - Intronic
1008636761 6:53418550-53418572 TAGGAATAGTAGAGGTAAGTAGG + Intergenic
1008638309 6:53434737-53434759 TACTAATATTAGAGTTGAGACGG + Intergenic
1009837422 6:69020511-69020533 TAATAACATTTAAGGGAAGAAGG - Intronic
1009856363 6:69269884-69269906 TTGTAATATTTGATGGAAGAAGG - Intronic
1010192398 6:73207751-73207773 TAGTTTTATTAGAAGAAAGATGG + Intergenic
1010457166 6:76069969-76069991 TGGGACTACTAGAGGGAAGAGGG + Intronic
1011829433 6:91353425-91353447 GGGTATTATTGGAGGGAAGAGGG - Intergenic
1012729532 6:102864111-102864133 AAGTACTACTAGAGGGGAGAAGG + Intergenic
1014074990 6:117225420-117225442 TTGTAATATTAGAGGCCAGGAGG - Intergenic
1014142772 6:117963511-117963533 CGATAATATTAGAGGGAAAAAGG + Intronic
1015112737 6:129611301-129611323 TAGTATTATTATAGGTAATATGG + Intronic
1015615653 6:135071927-135071949 TAATTATATTAGAGAGTAGAAGG + Intronic
1016527075 6:145013789-145013811 AAGTAAGATTAGAGAGAAGAAGG - Intergenic
1016560223 6:145388341-145388363 TGGTTATAGTAGAGTGAAGAGGG - Intergenic
1017606515 6:156140432-156140454 AAATAATATTAGAGGGAAAAAGG - Intergenic
1022304911 7:29138108-29138130 TAGTAATAATAGCGTGGAGAGGG + Intronic
1024471109 7:49769573-49769595 AAGTAAGAAGAGAGGGAAGAAGG - Intergenic
1024850137 7:53703758-53703780 TAGCAATATTACAGGAAAAACGG + Intergenic
1026559081 7:71433129-71433151 AAGTAAAAATAGAGGAAAGATGG + Intronic
1026567551 7:71501919-71501941 TAGTGAAATGGGAGGGAAGAAGG - Intronic
1026578740 7:71596531-71596553 TAGTGAAATGGGAGGGAAGAAGG + Intronic
1028149858 7:87359139-87359161 TAGTAATAATAGAGGTGAGTTGG + Intronic
1028409423 7:90512326-90512348 GAGTAAAATTAGGGGAAAGAAGG + Intronic
1028482741 7:91325493-91325515 AAATCATATTAGAGGGAAGAGGG - Intergenic
1028605806 7:92654517-92654539 GAGTAATATTAGAAGAAACATGG - Intronic
1028621197 7:92831533-92831555 TTGTGATATTGGAGGGAAAAGGG - Intronic
1028909418 7:96191041-96191063 TATTATTATTAGGGTGAAGAAGG - Intronic
1031556188 7:123179653-123179675 TAGAAACATTAGAGGGAAGCAGG - Intronic
1031998857 7:128251567-128251589 TAGATATATTACAGGGATGAAGG + Intronic
1033425070 7:141236534-141236556 CTGCAATATTTGAGGGAAGATGG - Intronic
1035344560 7:158189661-158189683 TAGTAACATACGAGGGAAGGGGG - Intronic
1035417569 7:158703493-158703515 CACTAATATAAGAGGGAAAATGG - Intronic
1035785845 8:2260256-2260278 TATTAATAATTGAGGAAAGATGG - Intergenic
1035806962 8:2461460-2461482 TATTAATAATTGAGGAAAGATGG + Intergenic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1038180696 8:25224613-25224635 TAGTTATGGTTGAGGGAAGATGG + Intronic
1038317122 8:26495193-26495215 ATGTAATATTTGAGGGTAGAGGG + Intronic
1038931636 8:32200147-32200169 TAAAAATATTAGAGGGAAAATGG - Intronic
1040006370 8:42624604-42624626 CAGTAATTTTAAAGGGAAAAGGG - Intergenic
1041578908 8:59433904-59433926 TATGGATTTTAGAGGGAAGAGGG + Intergenic
1042272074 8:66964560-66964582 AAATAATATTAGAGGGAAGGTGG + Intronic
1043468631 8:80539289-80539311 TAGTAATTTTAAAATGAAGATGG - Intergenic
1043718703 8:83516284-83516306 TATTTATAGTAGAGAGAAGAAGG - Intergenic
1043841402 8:85108480-85108502 TAGTGAAATTAGACGGAAAATGG - Intronic
1043918678 8:85955248-85955270 TAGTACTACTAGAGTGGAGAAGG + Intergenic
1044132424 8:88541040-88541062 TTGTAATATTATAGCCAAGAAGG - Intergenic
1045349609 8:101326558-101326580 TAGTAGTTTTAGAGGAAAGGTGG + Intergenic
1046112819 8:109747093-109747115 TAATAATATGAGAGGTAGGAGGG - Intergenic
1046351685 8:113023373-113023395 AAGTAAAATTAGAGGAAAGTGGG - Intronic
1046430539 8:114120812-114120834 TAGTACTATTTGGGGGTAGAGGG + Intergenic
1046931999 8:119850922-119850944 TAGGGACATTAAAGGGAAGAGGG + Intronic
1046970286 8:120215586-120215608 TATTAATAGTAGGGGGAAGATGG + Intronic
1047861097 8:128967965-128967987 GACTAACATTGGAGGGAAGACGG + Intergenic
1048513024 8:135079440-135079462 CAGTAGTATTAGAGGGTAAAGGG + Intergenic
1049937761 9:516059-516081 CAATAATATTTAAGGGAAGATGG - Intronic
1050715394 9:8518463-8518485 TTGAAATATTATAGGGATGATGG - Intronic
1051219080 9:14829870-14829892 GAGTAATATTAGAAGAAAAAGGG + Intronic
1051735449 9:20193369-20193391 TAGAAATTTTAAAGGGAAGCTGG - Intergenic
1051752263 9:20355019-20355041 AAATAAGATTAGAGAGAAGAAGG - Intronic
1053423438 9:37995674-37995696 AAGGAATATTAGGGGGCAGAGGG + Intronic
1055131236 9:72777625-72777647 TAGTAATATAAAATGGAAGGTGG - Intronic
1055194790 9:73576430-73576452 TAGTAATATAAGAAAAAAGATGG - Intergenic
1056617029 9:88177601-88177623 TAGTCTCAATAGAGGGAAGAAGG + Intergenic
1059788409 9:117612585-117612607 TAGTAATCTCATAGGGAAGGAGG - Intergenic
1059876247 9:118638323-118638345 TGGTACTATTAGAGGAGAGAGGG - Intergenic
1060118207 9:120962853-120962875 TAGTAATAGTAAAGGAAAAATGG + Intronic
1061772803 9:132939756-132939778 TAGAAGTATTCTAGGGAAGAAGG + Intronic
1186230393 X:7447367-7447389 TAGTTATATAATGGGGAAGAGGG + Intergenic
1186482980 X:9910325-9910347 TATTAATAATAGGGGGAAGTGGG + Intronic
1186572383 X:10728883-10728905 TGGTGATATTAGAAGGGAGAAGG - Intronic
1187052719 X:15710387-15710409 CATTAATAAGAGAGGGAAGAAGG + Intronic
1187073579 X:15912248-15912270 TAGTGATAGTAGAGGGAACAGGG + Intergenic
1188705634 X:33326115-33326137 TAGTAATATTAGAGGGAAGAAGG + Intronic
1189703709 X:43738309-43738331 TTTTAATTTTAAAGGGAAGAAGG + Intronic
1189725803 X:43967176-43967198 TAGTATTGTTACAGGGAAGCTGG - Intronic
1192268791 X:69559142-69559164 TAGTAAGATTAGAGGTTAGATGG + Intergenic
1193500457 X:82267616-82267638 TTGTAATTTTTGAGGAAAGAAGG + Intergenic
1193819015 X:86139424-86139446 TAGTAGTAGAAAAGGGAAGAGGG - Intergenic
1195399603 X:104447443-104447465 TAGGAATATGAGAGGGCAGTGGG - Intergenic
1195492891 X:105493691-105493713 TACTAATATTAGTAGGAATACGG - Intronic
1195647773 X:107251991-107252013 TAGTAAAATTAAATGGGAGAAGG - Intergenic
1196653187 X:118189704-118189726 TAGTAAGATGGGTGGGAAGAGGG - Intergenic
1197011224 X:121566503-121566525 TATTAATTTTATAGAGAAGAAGG - Intergenic
1197330986 X:125154516-125154538 TAATAATATTAAGGGGAGGAAGG - Intergenic
1198762436 X:140046793-140046815 TAATAATATTAGAGGGATACAGG + Intergenic
1199191483 X:144977053-144977075 TTGTAATATTAGAGGAACAAAGG + Intergenic
1199645413 X:149905039-149905061 AAGTAATATTAGCAGAAAGATGG + Intergenic