ID: 1188705634

View in Genome Browser
Species Human (GRCh38)
Location X:33326115-33326137
Sequence TAGTAATATTAGAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188705630_1188705634 30 Left 1188705630 X:33326062-33326084 CCTAAACTGAATGAGGAGGAATC No data
Right 1188705634 X:33326115-33326137 TAGTAATATTAGAGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188705634 Original CRISPR TAGTAATATTAGAGGGAAGA AGG Intronic
No off target data available for this crispr