ID: 1188708081

View in Genome Browser
Species Human (GRCh38)
Location X:33359897-33359919
Sequence CCGGTAGATTACCTGAGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188708073_1188708081 8 Left 1188708073 X:33359866-33359888 CCTGCAATCCCAGCACTTTGGGA 0: 5331
1: 293072
2: 261128
3: 150078
4: 131612
Right 1188708081 X:33359897-33359919 CCGGTAGATTACCTGAGGTCAGG No data
1188708075_1188708081 0 Left 1188708075 X:33359874-33359896 CCCAGCACTTTGGGAGGCTGAGG 0: 90349
1: 212695
2: 235979
3: 260133
4: 296590
Right 1188708081 X:33359897-33359919 CCGGTAGATTACCTGAGGTCAGG No data
1188708077_1188708081 -1 Left 1188708077 X:33359875-33359897 CCAGCACTTTGGGAGGCTGAGGC 0: 56931
1: 168651
2: 218048
3: 269456
4: 306914
Right 1188708081 X:33359897-33359919 CCGGTAGATTACCTGAGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188708081 Original CRISPR CCGGTAGATTACCTGAGGTC AGG Intergenic
No off target data available for this crispr