ID: 1188711829

View in Genome Browser
Species Human (GRCh38)
Location X:33410464-33410486
Sequence AAGGTTAATAAGGTAGTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188711824_1188711829 17 Left 1188711824 X:33410424-33410446 CCTTATAGTTAGCTCCTGGAGGA No data
Right 1188711829 X:33410464-33410486 AAGGTTAATAAGGTAGTTGCAGG No data
1188711822_1188711829 20 Left 1188711822 X:33410421-33410443 CCACCTTATAGTTAGCTCCTGGA No data
Right 1188711829 X:33410464-33410486 AAGGTTAATAAGGTAGTTGCAGG No data
1188711827_1188711829 -6 Left 1188711827 X:33410447-33410469 CCTAAGTGAATTAAGAGAAGGTT No data
Right 1188711829 X:33410464-33410486 AAGGTTAATAAGGTAGTTGCAGG No data
1188711825_1188711829 3 Left 1188711825 X:33410438-33410460 CCTGGAGGACCTAAGTGAATTAA No data
Right 1188711829 X:33410464-33410486 AAGGTTAATAAGGTAGTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188711829 Original CRISPR AAGGTTAATAAGGTAGTTGC AGG Intergenic
No off target data available for this crispr