ID: 1188712396

View in Genome Browser
Species Human (GRCh38)
Location X:33416367-33416389
Sequence GGTGCTTGTACTCACCATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188712389_1188712396 0 Left 1188712389 X:33416344-33416366 CCCTTGCCATCCACATCAGGGAT No data
Right 1188712396 X:33416367-33416389 GGTGCTTGTACTCACCATTGGGG No data
1188712393_1188712396 -10 Left 1188712393 X:33416354-33416376 CCACATCAGGGATGGTGCTTGTA No data
Right 1188712396 X:33416367-33416389 GGTGCTTGTACTCACCATTGGGG No data
1188712390_1188712396 -1 Left 1188712390 X:33416345-33416367 CCTTGCCATCCACATCAGGGATG No data
Right 1188712396 X:33416367-33416389 GGTGCTTGTACTCACCATTGGGG No data
1188712392_1188712396 -6 Left 1188712392 X:33416350-33416372 CCATCCACATCAGGGATGGTGCT No data
Right 1188712396 X:33416367-33416389 GGTGCTTGTACTCACCATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188712396 Original CRISPR GGTGCTTGTACTCACCATTG GGG Intergenic
No off target data available for this crispr