ID: 1188712524

View in Genome Browser
Species Human (GRCh38)
Location X:33418131-33418153
Sequence GACTTCCTATAAGCAGCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188712524_1188712530 17 Left 1188712524 X:33418131-33418153 CCATATGCTGCTTATAGGAAGTC No data
Right 1188712530 X:33418171-33418193 CACTTATAGACTGAAGGTAAAGG No data
1188712524_1188712532 19 Left 1188712524 X:33418131-33418153 CCATATGCTGCTTATAGGAAGTC No data
Right 1188712532 X:33418173-33418195 CTTATAGACTGAAGGTAAAGGGG No data
1188712524_1188712529 11 Left 1188712524 X:33418131-33418153 CCATATGCTGCTTATAGGAAGTC No data
Right 1188712529 X:33418165-33418187 GAAAGACACTTATAGACTGAAGG No data
1188712524_1188712533 22 Left 1188712524 X:33418131-33418153 CCATATGCTGCTTATAGGAAGTC No data
Right 1188712533 X:33418176-33418198 ATAGACTGAAGGTAAAGGGGTGG No data
1188712524_1188712531 18 Left 1188712524 X:33418131-33418153 CCATATGCTGCTTATAGGAAGTC No data
Right 1188712531 X:33418172-33418194 ACTTATAGACTGAAGGTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188712524 Original CRISPR GACTTCCTATAAGCAGCATA TGG (reversed) Intergenic
No off target data available for this crispr