ID: 1188712527

View in Genome Browser
Species Human (GRCh38)
Location X:33418153-33418175
Sequence AAGTGTCTTTCCCAGTTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188712527_1188712531 -4 Left 1188712527 X:33418153-33418175 CCACCAAACTGGGAAAGACACTT No data
Right 1188712531 X:33418172-33418194 ACTTATAGACTGAAGGTAAAGGG No data
1188712527_1188712532 -3 Left 1188712527 X:33418153-33418175 CCACCAAACTGGGAAAGACACTT No data
Right 1188712532 X:33418173-33418195 CTTATAGACTGAAGGTAAAGGGG No data
1188712527_1188712533 0 Left 1188712527 X:33418153-33418175 CCACCAAACTGGGAAAGACACTT No data
Right 1188712533 X:33418176-33418198 ATAGACTGAAGGTAAAGGGGTGG No data
1188712527_1188712530 -5 Left 1188712527 X:33418153-33418175 CCACCAAACTGGGAAAGACACTT No data
Right 1188712530 X:33418171-33418193 CACTTATAGACTGAAGGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188712527 Original CRISPR AAGTGTCTTTCCCAGTTTGG TGG (reversed) Intergenic
No off target data available for this crispr