ID: 1188712528

View in Genome Browser
Species Human (GRCh38)
Location X:33418156-33418178
Sequence TATAAGTGTCTTTCCCAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188712528_1188712534 30 Left 1188712528 X:33418156-33418178 CCAAACTGGGAAAGACACTTATA No data
Right 1188712534 X:33418209-33418231 TCCATGCAAACAAAAATCAAAGG No data
1188712528_1188712533 -3 Left 1188712528 X:33418156-33418178 CCAAACTGGGAAAGACACTTATA No data
Right 1188712533 X:33418176-33418198 ATAGACTGAAGGTAAAGGGGTGG No data
1188712528_1188712531 -7 Left 1188712528 X:33418156-33418178 CCAAACTGGGAAAGACACTTATA No data
Right 1188712531 X:33418172-33418194 ACTTATAGACTGAAGGTAAAGGG No data
1188712528_1188712532 -6 Left 1188712528 X:33418156-33418178 CCAAACTGGGAAAGACACTTATA No data
Right 1188712532 X:33418173-33418195 CTTATAGACTGAAGGTAAAGGGG No data
1188712528_1188712530 -8 Left 1188712528 X:33418156-33418178 CCAAACTGGGAAAGACACTTATA No data
Right 1188712530 X:33418171-33418193 CACTTATAGACTGAAGGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188712528 Original CRISPR TATAAGTGTCTTTCCCAGTT TGG (reversed) Intergenic
No off target data available for this crispr