ID: 1188712531

View in Genome Browser
Species Human (GRCh38)
Location X:33418172-33418194
Sequence ACTTATAGACTGAAGGTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188712528_1188712531 -7 Left 1188712528 X:33418156-33418178 CCAAACTGGGAAAGACACTTATA No data
Right 1188712531 X:33418172-33418194 ACTTATAGACTGAAGGTAAAGGG No data
1188712527_1188712531 -4 Left 1188712527 X:33418153-33418175 CCACCAAACTGGGAAAGACACTT No data
Right 1188712531 X:33418172-33418194 ACTTATAGACTGAAGGTAAAGGG No data
1188712524_1188712531 18 Left 1188712524 X:33418131-33418153 CCATATGCTGCTTATAGGAAGTC No data
Right 1188712531 X:33418172-33418194 ACTTATAGACTGAAGGTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188712531 Original CRISPR ACTTATAGACTGAAGGTAAA GGG Intergenic
No off target data available for this crispr