ID: 1188715643

View in Genome Browser
Species Human (GRCh38)
Location X:33456586-33456608
Sequence GGACCTGCCCTGAGACAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188715637_1188715643 12 Left 1188715637 X:33456551-33456573 CCAATTCTAGAACTTGGCTCTTG 0: 3
1: 7
2: 46
3: 143
4: 411
Right 1188715643 X:33456586-33456608 GGACCTGCCCTGAGACAGAGGGG No data
1188715636_1188715643 13 Left 1188715636 X:33456550-33456572 CCCAATTCTAGAACTTGGCTCTT No data
Right 1188715643 X:33456586-33456608 GGACCTGCCCTGAGACAGAGGGG No data
1188715635_1188715643 14 Left 1188715635 X:33456549-33456571 CCCCAATTCTAGAACTTGGCTCT No data
Right 1188715643 X:33456586-33456608 GGACCTGCCCTGAGACAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188715643 Original CRISPR GGACCTGCCCTGAGACAGAG GGG Intergenic
No off target data available for this crispr