ID: 1188715991

View in Genome Browser
Species Human (GRCh38)
Location X:33459601-33459623
Sequence TACCAGGTATAGTACCTGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188715991_1188715995 -10 Left 1188715991 X:33459601-33459623 CCTATCAGGTACTATACCTGGTA No data
Right 1188715995 X:33459614-33459636 ATACCTGGTACCTGGGTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188715991 Original CRISPR TACCAGGTATAGTACCTGAT AGG (reversed) Intergenic
No off target data available for this crispr