ID: 1188723540

View in Genome Browser
Species Human (GRCh38)
Location X:33551965-33551987
Sequence AGAGCTTCTCTGGCAAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188723540_1188723545 16 Left 1188723540 X:33551965-33551987 CCATGTTTTGCCAGAGAAGCTCT No data
Right 1188723545 X:33552004-33552026 TCTTCCATTCCCAGTTGGTTTGG No data
1188723540_1188723544 11 Left 1188723540 X:33551965-33551987 CCATGTTTTGCCAGAGAAGCTCT No data
Right 1188723544 X:33551999-33552021 GGATTTCTTCCATTCCCAGTTGG No data
1188723540_1188723543 -10 Left 1188723540 X:33551965-33551987 CCATGTTTTGCCAGAGAAGCTCT No data
Right 1188723543 X:33551978-33552000 GAGAAGCTCTGCTGTGCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188723540 Original CRISPR AGAGCTTCTCTGGCAAAACA TGG (reversed) Intergenic
No off target data available for this crispr