ID: 1188723541

View in Genome Browser
Species Human (GRCh38)
Location X:33551975-33551997
Sequence TTAGCACAGCAGAGCTTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188723541_1188723545 6 Left 1188723541 X:33551975-33551997 CCAGAGAAGCTCTGCTGTGCTAA No data
Right 1188723545 X:33552004-33552026 TCTTCCATTCCCAGTTGGTTTGG No data
1188723541_1188723550 29 Left 1188723541 X:33551975-33551997 CCAGAGAAGCTCTGCTGTGCTAA No data
Right 1188723550 X:33552027-33552049 ACTCTTCAAAGCCTGTAGGCTGG No data
1188723541_1188723549 25 Left 1188723541 X:33551975-33551997 CCAGAGAAGCTCTGCTGTGCTAA No data
Right 1188723549 X:33552023-33552045 TTGGACTCTTCAAAGCCTGTAGG No data
1188723541_1188723544 1 Left 1188723541 X:33551975-33551997 CCAGAGAAGCTCTGCTGTGCTAA No data
Right 1188723544 X:33551999-33552021 GGATTTCTTCCATTCCCAGTTGG No data
1188723541_1188723551 30 Left 1188723541 X:33551975-33551997 CCAGAGAAGCTCTGCTGTGCTAA No data
Right 1188723551 X:33552028-33552050 CTCTTCAAAGCCTGTAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188723541 Original CRISPR TTAGCACAGCAGAGCTTCTC TGG (reversed) Intergenic
No off target data available for this crispr