ID: 1188723545

View in Genome Browser
Species Human (GRCh38)
Location X:33552004-33552026
Sequence TCTTCCATTCCCAGTTGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188723540_1188723545 16 Left 1188723540 X:33551965-33551987 CCATGTTTTGCCAGAGAAGCTCT No data
Right 1188723545 X:33552004-33552026 TCTTCCATTCCCAGTTGGTTTGG No data
1188723541_1188723545 6 Left 1188723541 X:33551975-33551997 CCAGAGAAGCTCTGCTGTGCTAA No data
Right 1188723545 X:33552004-33552026 TCTTCCATTCCCAGTTGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188723545 Original CRISPR TCTTCCATTCCCAGTTGGTT TGG Intergenic
No off target data available for this crispr