ID: 1188723549

View in Genome Browser
Species Human (GRCh38)
Location X:33552023-33552045
Sequence TTGGACTCTTCAAAGCCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188723546_1188723549 -8 Left 1188723546 X:33552008-33552030 CCATTCCCAGTTGGTTTGGACTC No data
Right 1188723549 X:33552023-33552045 TTGGACTCTTCAAAGCCTGTAGG No data
1188723541_1188723549 25 Left 1188723541 X:33551975-33551997 CCAGAGAAGCTCTGCTGTGCTAA No data
Right 1188723549 X:33552023-33552045 TTGGACTCTTCAAAGCCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188723549 Original CRISPR TTGGACTCTTCAAAGCCTGT AGG Intergenic
No off target data available for this crispr